ID: 1165516384

View in Genome Browser
Species Human (GRCh38)
Location 19:36291534-36291556
Sequence TCCCAGCGGGTGATCGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165516384_1165516390 -1 Left 1165516384 19:36291534-36291556 CCATTCCCGATCACCCGCTGGGA No data
Right 1165516390 19:36291556-36291578 ATCCATCATCGGACCCCAAGAGG No data
1165516384_1165516395 19 Left 1165516384 19:36291534-36291556 CCATTCCCGATCACCCGCTGGGA No data
Right 1165516395 19:36291576-36291598 AGGAGTCCGCGCAGCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165516384 Original CRISPR TCCCAGCGGGTGATCGGGAA TGG (reversed) Intergenic
No off target data available for this crispr