ID: 1165516936

View in Genome Browser
Species Human (GRCh38)
Location 19:36294060-36294082
Sequence TCCCAGCGGGTGATCGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165516936_1165516942 -1 Left 1165516936 19:36294060-36294082 CCATTCCCGATCACCCGCTGGGA No data
Right 1165516942 19:36294082-36294104 ATCCATCATCGGACCCCAAGAGG No data
1165516936_1165516947 19 Left 1165516936 19:36294060-36294082 CCATTCCCGATCACCCGCTGGGA No data
Right 1165516947 19:36294102-36294124 AGGAGTCCGCGCAGCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165516936 Original CRISPR TCCCAGCGGGTGATCGGGAA TGG (reversed) Intergenic
No off target data available for this crispr