ID: 1165517489

View in Genome Browser
Species Human (GRCh38)
Location 19:36296583-36296605
Sequence TCCCAGCGGGTGATCGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165517489_1165517495 -1 Left 1165517489 19:36296583-36296605 CCATTCCCGATCACCCGCTGGGA No data
Right 1165517495 19:36296605-36296627 ATCCATCATCGGACCCCAAGAGG No data
1165517489_1165517500 19 Left 1165517489 19:36296583-36296605 CCATTCCCGATCACCCGCTGGGA No data
Right 1165517500 19:36296625-36296647 AGGAGTCCGCGCAGCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165517489 Original CRISPR TCCCAGCGGGTGATCGGGAA TGG (reversed) Intergenic
No off target data available for this crispr