ID: 1165519141

View in Genome Browser
Species Human (GRCh38)
Location 19:36304185-36304207
Sequence TCCCAGCGGGTGATCGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165519141_1165519152 19 Left 1165519141 19:36304185-36304207 CCATTCCCGATCACCCGCTGGGA No data
Right 1165519152 19:36304227-36304249 AGGAGTCCGCGCAGCCCAGCCGG No data
1165519141_1165519147 -1 Left 1165519141 19:36304185-36304207 CCATTCCCGATCACCCGCTGGGA No data
Right 1165519147 19:36304207-36304229 ATCCATCATCGGACCCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165519141 Original CRISPR TCCCAGCGGGTGATCGGGAA TGG (reversed) Intergenic
No off target data available for this crispr