ID: 1165519691

View in Genome Browser
Species Human (GRCh38)
Location 19:36306700-36306722
Sequence TCCCAGCGGGTGATCGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165519691_1165519697 -1 Left 1165519691 19:36306700-36306722 CCATTCCCGATCACCCGCTGGGA No data
Right 1165519697 19:36306722-36306744 ATCCATCATCGGACCCCAAGAGG No data
1165519691_1165519702 19 Left 1165519691 19:36306700-36306722 CCATTCCCGATCACCCGCTGGGA No data
Right 1165519702 19:36306742-36306764 AGGAGTCCGCGCAGCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165519691 Original CRISPR TCCCAGCGGGTGATCGGGAA TGG (reversed) Intergenic
No off target data available for this crispr