ID: 1165520240

View in Genome Browser
Species Human (GRCh38)
Location 19:36309228-36309250
Sequence TCCCAGCGGGTGATCGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165520240_1165520246 -1 Left 1165520240 19:36309228-36309250 CCATTCCCGATCACCCGCTGGGA No data
Right 1165520246 19:36309250-36309272 ATCCATCGTCGGACCCCAAGAGG No data
1165520240_1165520251 19 Left 1165520240 19:36309228-36309250 CCATTCCCGATCACCCGCTGGGA No data
Right 1165520251 19:36309270-36309292 AGGAGTCCGCGCAGCCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165520240 Original CRISPR TCCCAGCGGGTGATCGGGAA TGG (reversed) Intergenic
No off target data available for this crispr