ID: 1165521359

View in Genome Browser
Species Human (GRCh38)
Location 19:36316764-36316786
Sequence AGTGGGTTAGTTATCTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165521359_1165521364 -1 Left 1165521359 19:36316764-36316786 CCTCCCAAGATAACTAACCCACT No data
Right 1165521364 19:36316786-36316808 TCTAGCTTCATCCATTCATGAGG No data
1165521359_1165521365 0 Left 1165521359 19:36316764-36316786 CCTCCCAAGATAACTAACCCACT No data
Right 1165521365 19:36316787-36316809 CTAGCTTCATCCATTCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165521359 Original CRISPR AGTGGGTTAGTTATCTTGGG AGG (reversed) Intergenic
No off target data available for this crispr