ID: 1165522832

View in Genome Browser
Species Human (GRCh38)
Location 19:36328123-36328145
Sequence GCTCATCACCCATTGCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165522832_1165522844 30 Left 1165522832 19:36328123-36328145 CCAAGAGGCAATGGGTGATGAGC No data
Right 1165522844 19:36328176-36328198 ATGACCCTAAGGGAGTAGGCTGG No data
1165522832_1165522842 20 Left 1165522832 19:36328123-36328145 CCAAGAGGCAATGGGTGATGAGC No data
Right 1165522842 19:36328166-36328188 GAGACATGGGATGACCCTAAGGG No data
1165522832_1165522836 -2 Left 1165522832 19:36328123-36328145 CCAAGAGGCAATGGGTGATGAGC No data
Right 1165522836 19:36328144-36328166 GCCTACAGGGGACATAGCCGAGG No data
1165522832_1165522839 7 Left 1165522832 19:36328123-36328145 CCAAGAGGCAATGGGTGATGAGC No data
Right 1165522839 19:36328153-36328175 GGACATAGCCGAGGAGACATGGG No data
1165522832_1165522838 6 Left 1165522832 19:36328123-36328145 CCAAGAGGCAATGGGTGATGAGC No data
Right 1165522838 19:36328152-36328174 GGGACATAGCCGAGGAGACATGG No data
1165522832_1165522843 26 Left 1165522832 19:36328123-36328145 CCAAGAGGCAATGGGTGATGAGC No data
Right 1165522843 19:36328172-36328194 TGGGATGACCCTAAGGGAGTAGG No data
1165522832_1165522841 19 Left 1165522832 19:36328123-36328145 CCAAGAGGCAATGGGTGATGAGC No data
Right 1165522841 19:36328165-36328187 GGAGACATGGGATGACCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165522832 Original CRISPR GCTCATCACCCATTGCCTCT TGG (reversed) Intergenic
No off target data available for this crispr