ID: 1165522837

View in Genome Browser
Species Human (GRCh38)
Location 19:36328145-36328167
Sequence TCCTCGGCTATGTCCCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165522837_1165522849 22 Left 1165522837 19:36328145-36328167 CCTACAGGGGACATAGCCGAGGA No data
Right 1165522849 19:36328190-36328212 GTAGGCTGGTTTTAAGGCGGTGG No data
1165522837_1165522851 28 Left 1165522837 19:36328145-36328167 CCTACAGGGGACATAGCCGAGGA No data
Right 1165522851 19:36328196-36328218 TGGTTTTAAGGCGGTGGGACTGG No data
1165522837_1165522848 19 Left 1165522837 19:36328145-36328167 CCTACAGGGGACATAGCCGAGGA No data
Right 1165522848 19:36328187-36328209 GGAGTAGGCTGGTTTTAAGGCGG No data
1165522837_1165522844 8 Left 1165522837 19:36328145-36328167 CCTACAGGGGACATAGCCGAGGA No data
Right 1165522844 19:36328176-36328198 ATGACCCTAAGGGAGTAGGCTGG No data
1165522837_1165522852 29 Left 1165522837 19:36328145-36328167 CCTACAGGGGACATAGCCGAGGA No data
Right 1165522852 19:36328197-36328219 GGTTTTAAGGCGGTGGGACTGGG No data
1165522837_1165522842 -2 Left 1165522837 19:36328145-36328167 CCTACAGGGGACATAGCCGAGGA No data
Right 1165522842 19:36328166-36328188 GAGACATGGGATGACCCTAAGGG No data
1165522837_1165522843 4 Left 1165522837 19:36328145-36328167 CCTACAGGGGACATAGCCGAGGA No data
Right 1165522843 19:36328172-36328194 TGGGATGACCCTAAGGGAGTAGG No data
1165522837_1165522847 16 Left 1165522837 19:36328145-36328167 CCTACAGGGGACATAGCCGAGGA No data
Right 1165522847 19:36328184-36328206 AAGGGAGTAGGCTGGTTTTAAGG No data
1165522837_1165522841 -3 Left 1165522837 19:36328145-36328167 CCTACAGGGGACATAGCCGAGGA No data
Right 1165522841 19:36328165-36328187 GGAGACATGGGATGACCCTAAGG No data
1165522837_1165522850 23 Left 1165522837 19:36328145-36328167 CCTACAGGGGACATAGCCGAGGA No data
Right 1165522850 19:36328191-36328213 TAGGCTGGTTTTAAGGCGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165522837 Original CRISPR TCCTCGGCTATGTCCCCTGT AGG (reversed) Intergenic
No off target data available for this crispr