ID: 1165522843

View in Genome Browser
Species Human (GRCh38)
Location 19:36328172-36328194
Sequence TGGGATGACCCTAAGGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165522837_1165522843 4 Left 1165522837 19:36328145-36328167 CCTACAGGGGACATAGCCGAGGA No data
Right 1165522843 19:36328172-36328194 TGGGATGACCCTAAGGGAGTAGG No data
1165522832_1165522843 26 Left 1165522832 19:36328123-36328145 CCAAGAGGCAATGGGTGATGAGC No data
Right 1165522843 19:36328172-36328194 TGGGATGACCCTAAGGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165522843 Original CRISPR TGGGATGACCCTAAGGGAGT AGG Intergenic
No off target data available for this crispr