ID: 1165522992

View in Genome Browser
Species Human (GRCh38)
Location 19:36329213-36329235
Sequence GATTTCCTTGCTCACCTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165522992_1165522998 21 Left 1165522992 19:36329213-36329235 CCAAAGAGGTGAGCAAGGAAATC No data
Right 1165522998 19:36329257-36329279 CCACCACCAGTTTAGTTTAGAGG No data
1165522992_1165523000 24 Left 1165522992 19:36329213-36329235 CCAAAGAGGTGAGCAAGGAAATC No data
Right 1165523000 19:36329260-36329282 CCACCAGTTTAGTTTAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165522992 Original CRISPR GATTTCCTTGCTCACCTCTT TGG (reversed) Intergenic
No off target data available for this crispr