ID: 1165526187

View in Genome Browser
Species Human (GRCh38)
Location 19:36356923-36356945
Sequence GTGGTAAAACATATCTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165526187_1165526191 22 Left 1165526187 19:36356923-36356945 CCTTGTCAGATATGTTTTACCAC 0: 1
1: 0
2: 0
3: 21
4: 151
Right 1165526191 19:36356968-36356990 TCACCCATTCATCTGCTTATTGG 0: 1
1: 0
2: 3
3: 68
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165526187 Original CRISPR GTGGTAAAACATATCTGACA AGG (reversed) Intronic
902981459 1:20126457-20126479 GTGGTCAGACAGACCTGACATGG + Intergenic
906832942 1:49052624-49052646 GTGGTAGACCATAGCTGAAATGG + Intronic
909245876 1:73283491-73283513 GTAGAAAAACATAACTCACAGGG - Intergenic
910294026 1:85626864-85626886 GTGGAAAGACATATCTGCCCTGG + Intergenic
912363965 1:109117613-109117635 ATGGTAATACCTATCTCACAGGG + Intronic
914318707 1:146538739-146538761 TTGGGAAAACATAACTGAAATGG + Intergenic
914495653 1:148194618-148194640 TTGGGAAAACATAACTGAAATGG - Intergenic
915083991 1:153372043-153372065 CTGCCAAAACATATATGACATGG + Intergenic
917541121 1:175915735-175915757 GTGGTAAACCATCTATGTCAAGG - Intergenic
919072542 1:192774128-192774150 GTGGAAGAACATATATGGCAGGG - Intergenic
923644809 1:235808223-235808245 TGGTTAAAACAAATCTGACATGG + Intronic
923754952 1:236783734-236783756 GTGGTAAAATAAATCTCACTGGG - Intergenic
924413363 1:243830920-243830942 GTAGCAAAACAGAACTGACAGGG - Intronic
1064897493 10:20254652-20254674 AAGGCAAAACACATCTGACATGG + Intronic
1069730935 10:70612671-70612693 GTGGTAAAATATATGTAACATGG + Intergenic
1072136346 10:92550249-92550271 GTGGGAAAAAATATCTGATAAGG + Intronic
1076232027 10:128828233-128828255 GTCATATAACATATCTGACCAGG + Intergenic
1077259021 11:1605576-1605598 TTGGAAAAAAATATTTGACAAGG - Intergenic
1077961977 11:7085100-7085122 GTGGTAAAATACATGTAACATGG + Intergenic
1077961982 11:7085173-7085195 GTGGTAAAATACATATAACATGG + Intergenic
1080250106 11:30224416-30224438 ATTGTAAAACATATATCACATGG + Intergenic
1080636576 11:34129531-34129553 TTTGTAAATCATATCTGAAAAGG - Intronic
1081247499 11:40787049-40787071 CTGGTAAAACTTATTTGGCATGG - Intronic
1081304520 11:41495364-41495386 TTGGTAAAAAATATCTCAAATGG + Intergenic
1082622972 11:55446540-55446562 GTGGTAAGAAATAAATGACAAGG - Intergenic
1085484956 11:76855036-76855058 ATGGTACAACATATCTCATATGG + Intergenic
1085774539 11:79353305-79353327 CTGATAAAACAGATCTTACAGGG + Intronic
1088404249 11:109455272-109455294 GTGGTAAAACATATCTTTTTTGG + Intergenic
1088433149 11:109780452-109780474 GTGGCAAAAAATAACAGACATGG + Intergenic
1089941783 11:122425953-122425975 ATTGTATAACATATCTGAGAGGG - Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091370734 11:135056106-135056128 GAGGAAAAACATATCAGAGAGGG + Intergenic
1093773887 12:23049789-23049811 CTGGTAAAACATTTCTGTGAGGG + Intergenic
1094629815 12:32162384-32162406 GTGCCAAAAAATAACTGACATGG + Intronic
1098228539 12:68349564-68349586 GTGGTAATACAATTCTGACAAGG - Intergenic
1099884348 12:88508729-88508751 ATGGTAAAACATATCTCCCATGG - Intronic
1100000194 12:89825031-89825053 GAGGTAAAGCATATCAGCCAAGG - Intergenic
1105343631 13:19552427-19552449 GTCCTAAAAGAAATCTGACAAGG - Intergenic
1105536411 13:21269207-21269229 GTCCTAAAAGAAATCTGACAAGG + Intergenic
1107477178 13:40748994-40749016 GTCCTAAAATAAATCTGACAAGG - Intronic
1107699100 13:43029699-43029721 GTGGTAACAGATACCTGACATGG + Intronic
1116359635 14:43976957-43976979 GGATTAAAACATATCTTACAGGG - Intergenic
1117787990 14:59307418-59307440 TTAGTAAAAAATATTTGACATGG + Intronic
1120260766 14:82182453-82182475 GTTGTAAAAAATATATGAGAAGG - Intergenic
1122388878 14:101366863-101366885 GTGGTGCAATATATCTAACATGG - Intergenic
1130874510 15:88001242-88001264 TTTGTAAATCATATCTGATAAGG - Intronic
1133135630 16:3709316-3709338 GTGGTAAAACATCTTTTACTAGG - Intronic
1134036590 16:11036052-11036074 GTGGTAAAATCTACCTCACATGG + Intronic
1136931668 16:34423262-34423284 GTGGTAAAATATACATAACAAGG - Intergenic
1136972904 16:34988553-34988575 GTGGTAAAATATACATAACAAGG + Intergenic
1141886636 16:86896759-86896781 GTGGTAAACCGCAGCTGACATGG + Intergenic
1144349338 17:14379565-14379587 GTGGTGAAACACATATAACATGG + Intergenic
1145908900 17:28531503-28531525 GTGGACAAACACATCAGACAGGG + Intronic
1147703501 17:42410610-42410632 TTGGTTAAAAATATCTGAAAGGG + Intronic
1152213085 17:79013710-79013732 GTTGTAAAACATGACTCACAGGG - Intergenic
1155799039 18:30077289-30077311 GTGCTAAAATATATATGACATGG + Intergenic
1156968495 18:43126411-43126433 ATGGGAAAATATATTTGACAAGG + Intergenic
1157404898 18:47414504-47414526 GTGTGAAAACATTTCTGAAATGG + Intergenic
1157993473 18:52526169-52526191 TTAGTAAACCTTATCTGACAGGG + Intronic
1161758305 19:6151144-6151166 GTGGTAAAATATCTATAACATGG - Intronic
1162463726 19:10828948-10828970 CTGGAAAAACATCTCTCACAGGG - Intronic
1165526187 19:36356923-36356945 GTGGTAAAACATATCTGACAAGG - Intronic
926169660 2:10544611-10544633 GTGGTAAAATATACATAACATGG + Intergenic
926644269 2:15272126-15272148 CTGGTAAAACATACCAGAGAAGG - Intronic
927101609 2:19791797-19791819 GTGCTACAAAATATCTGACCAGG - Intergenic
931532106 2:63227547-63227569 GTGGTAAAAAATATGGGAAATGG + Intronic
932977250 2:76618252-76618274 GTGGAAAAACATAACAGAGACGG - Intergenic
937592098 2:123627149-123627171 GTGGCAATAAATATCTCACAAGG - Intergenic
937634042 2:124135705-124135727 GTGGTGAGAAATATTTGACAGGG - Intronic
938599081 2:132818966-132818988 TTGGAAAAACATATATGAGATGG - Intronic
942844871 2:180411988-180412010 GAGTTAAAACATTTCTTACACGG + Intergenic
942874482 2:180777925-180777947 GTGGCAAAACAGAGCGGACATGG + Intergenic
944750054 2:202699692-202699714 GTGGTAAAATATATATAACAAGG + Intronic
947002384 2:225471703-225471725 GTGATAACACATATTTCACAGGG - Intronic
948294736 2:236852137-236852159 GTGGTAAATCATAGGTGTCAGGG - Intergenic
1170121829 20:12920650-12920672 ATGGTAAAACATATCCCACAGGG - Intergenic
1170609222 20:17898430-17898452 ATTGTAAAACATTTCTAACACGG + Intergenic
1171216263 20:23354773-23354795 CTGGTCAAACACATCAGACAGGG - Exonic
1171725387 20:28614802-28614824 GTGGTCTAACATATCTATCATGG + Intergenic
1171752678 20:29068274-29068296 GTGGTCTAACATATCTATCATGG - Intergenic
1171789590 20:29509293-29509315 GTGGTCTAACATATCTATCATGG + Intergenic
1172033728 20:31997877-31997899 GTGGGAAAAGATCTCTGAGAAGG + Exonic
1173635169 20:44549667-44549689 ATGGAAAAAAATAGCTGACATGG + Intronic
1175095499 20:56538249-56538271 GTGGTTAAAAATATCAGGCAGGG + Intergenic
1182912364 22:33995739-33995761 GTGGAAAAACATATCAAACTGGG + Intergenic
949349909 3:3114808-3114830 TTGCAAAGACATATCTGACAAGG + Intronic
950224295 3:11221248-11221270 GTGGTAAAATATCTGTAACACGG + Intronic
952699168 3:36307352-36307374 GTGGTTAAATATATCTTAAATGG - Intergenic
953156112 3:40375629-40375651 GAGCAAAATCATATCTGACATGG - Intergenic
957002019 3:74898061-74898083 GAGGTAAAATATACCAGACATGG + Intergenic
957840687 3:85664874-85664896 ATGGGAAAAAATATCTGAAAAGG - Intronic
959768960 3:110069808-110069830 GTGGTGAAACTTTTCTGAGAAGG + Intergenic
961670291 3:128523760-128523782 GTTGCAAAATATATCTGGCATGG + Intergenic
961747447 3:129073690-129073712 GTGGTAAAACATACATGGCATGG - Intergenic
963077840 3:141364317-141364339 ATTGTAAAATATATCTGATAAGG + Intronic
965037310 3:163457586-163457608 GTGATAAAACATATCTGGCCGGG + Intergenic
966328197 3:178780775-178780797 GTAATAACACATATCTGATAGGG + Intronic
967806393 3:193717852-193717874 TTGTAAAAACATATCTGATAAGG + Intergenic
970763862 4:19523220-19523242 GGGGTAGAACATATATGACAAGG - Intergenic
971516034 4:27487634-27487656 GTGGGATTACATATTTGACATGG + Intergenic
973815329 4:54614104-54614126 GAGGGAAAACACACCTGACAGGG + Intergenic
974355801 4:60811197-60811219 GTAGTAAAAGATATCAGACTAGG + Intergenic
974865336 4:67573286-67573308 GTGTTCAAACATCTCTAACATGG - Intronic
975675318 4:76822139-76822161 GAGGATAAACATATCTGTCAGGG - Intergenic
975996070 4:80317292-80317314 TTTGCAAAACATATCTGATAGGG + Intronic
977180822 4:93871423-93871445 CTGGCAAAACAGATCTGACGGGG + Intergenic
978109716 4:104948056-104948078 GTGGTATCACACATCTGAGATGG - Intergenic
979324044 4:119358261-119358283 GGGGTAACACCTATCTTACATGG - Intergenic
979738799 4:124123967-124123989 AAGGTAAAACATATTTGACTGGG + Intergenic
981260560 4:142713694-142713716 GTGGACAACCATATCTGGCAAGG - Intronic
981685965 4:147455370-147455392 TTGGTAACACAAATCTGAGATGG + Intergenic
982034377 4:151331268-151331290 GTGGTAGAAGGTATCTGATATGG - Intergenic
985319141 4:188689272-188689294 GTGTGAAAAGATATCTGTCATGG - Intergenic
985435188 4:189922968-189922990 GTGGTCTAACATATCTATCATGG - Intergenic
986353897 5:6905540-6905562 CTGGTAAAACATATCCCTCAGGG - Intergenic
987877720 5:23700755-23700777 CTGGTAAAACATATTTTACAAGG + Intergenic
988123633 5:27000119-27000141 TTTGTAACACATATCTGATAAGG + Intronic
988219649 5:28326983-28327005 GTGGTTAAAAATTTCAGACAGGG + Intergenic
993166959 5:84368712-84368734 TTTGCAAAACATATCTGATAAGG + Intronic
994371990 5:98977960-98977982 GGGGGTAAACATATCTAACAGGG - Intergenic
995845758 5:116492092-116492114 TTGGTATAAAATATCTGAAAAGG - Intronic
998872323 5:146564935-146564957 GAAGTAAATCATATATGACAAGG - Intergenic
998948927 5:147372045-147372067 ATGGTAACACATGTCAGACATGG - Intronic
999931757 5:156440859-156440881 TTGGTAATTCATATCTGATAAGG - Intronic
1004289905 6:14357205-14357227 CTGCTAACACGTATCTGACAAGG - Intergenic
1005485399 6:26294621-26294643 CTGGTAGTGCATATCTGACATGG - Intergenic
1008531049 6:52459307-52459329 TTTGTAAAACATATTTGAGAAGG + Intronic
1008862473 6:56166354-56166376 GGGGAAAAACATTACTGACAGGG + Intronic
1010082278 6:71877754-71877776 GTGGTAGAACAATTCTGAAAAGG + Intergenic
1011430222 6:87278130-87278152 GTGATAATACATATCTCACAGGG - Intergenic
1012691715 6:102321332-102321354 TTTCTAAAACATATCTGACAAGG + Intergenic
1013594810 6:111650825-111650847 GTGGTAAAATCAATCTGTCAGGG + Intergenic
1013792322 6:113851653-113851675 ATGGAAAAACATTTCTGAGAAGG - Intergenic
1015051187 6:128842361-128842383 GTGGTAAAACAATTCACACAAGG + Intergenic
1018539505 6:164863324-164863346 GCGTTAAAACATATCTGGCCGGG - Intergenic
1022361843 7:29667621-29667643 GTTGTAAAATATATATGAAAAGG - Intergenic
1022699548 7:32746112-32746134 GTTGTAAAATATATATGAAAAGG + Intergenic
1024315509 7:48012487-48012509 GTGTTAACACATTTCTGACATGG + Intronic
1024921345 7:54558446-54558468 ATGGTAATACTTATCTGCCAAGG + Intronic
1025534130 7:61927124-61927146 GGGGGAAAACATATATGACCAGG + Intergenic
1026438726 7:70423957-70423979 GTGATATAACATATCTTTCATGG + Intronic
1026537563 7:71252531-71252553 GTGGTAAAACCTAACTGTAATGG + Intronic
1027206181 7:76101440-76101462 GTGGAAAATAAAATCTGACACGG + Intergenic
1027548243 7:79557584-79557606 GTCCTAAAACATCTCTGACAGGG + Intergenic
1028304332 7:89244431-89244453 CTAGCAAAACATATCTGAAAAGG - Intronic
1028943325 7:96549662-96549684 GTGTAAAAGCATGTCTGACAAGG - Intronic
1029686982 7:102155693-102155715 GTCTTAAAACATATCAGAAAAGG - Intronic
1031653613 7:124323433-124323455 GTGGTAAAACACACATAACATGG + Intergenic
1032086993 7:128889558-128889580 GTGGGCAAAAGTATCTGACAAGG + Intronic
1041590919 8:59582229-59582251 GTAGTAAAACAGAACTCACATGG + Intergenic
1041755722 8:61311337-61311359 GTGGTAGAGTATATCTGACAAGG - Intronic
1042881274 8:73493377-73493399 TTTGCAAAACATATATGACAAGG + Intronic
1045425257 8:102059881-102059903 CTGGTAAAACACAGCTGCCAGGG + Intronic
1045669627 8:104534977-104534999 GTCTGAAAAAATATCTGACATGG - Intronic
1046065812 8:109195680-109195702 GTGCTAAATCATGTCTTACATGG + Intergenic
1050777169 9:9278914-9278936 GTAGTAAAGCATATCTGACCTGG - Intronic
1054886649 9:70205865-70205887 GTGGTAAAACTTGTCAAACAGGG + Intronic
1056004029 9:82247928-82247950 GTGCCAAAACACATCTGAGAGGG - Intergenic
1056583490 9:87913010-87913032 CTGATAAACCATATCTGACAAGG + Intergenic
1056583984 9:87916481-87916503 CTGATAAACCATATCTGACAAGG + Intergenic
1056612885 9:88136445-88136467 CTGATAAACCATATCTGACAAGG - Intergenic
1056613385 9:88139935-88139957 CTGATAAACCGTATCTGACAAGG - Intergenic
1058531532 9:105910480-105910502 GTGGAAAAATATATTTGCCAAGG - Intergenic
1059815983 9:117915865-117915887 GTGGTCAAACAATTTTGACAAGG + Intergenic
1059934190 9:119291315-119291337 GTGGTGAAGGGTATCTGACAAGG + Intronic
1060125426 9:121039985-121040007 GTAGTGAAACAAATCAGACATGG + Intronic
1203450904 Un_GL000219v1:114703-114725 GTGGTCTAACATATCTATCATGG + Intergenic
1186902828 X:14076164-14076186 TTGGCAAAACATTTCTGAAAAGG - Intergenic
1187211754 X:17238892-17238914 GGGGAAAAAAATATGTGACAGGG - Intergenic
1190984039 X:55484566-55484588 GTGAGAAAACATTACTGACAAGG + Intergenic
1198668866 X:139055905-139055927 TTGGTATAACATATCTGAACAGG - Intronic
1199163527 X:144643305-144643327 GAGGTAAAATATATCTGTAATGG + Intergenic
1199671826 X:150154170-150154192 GTGATAAAGCATATCAGACCTGG + Intergenic