ID: 1165526868

View in Genome Browser
Species Human (GRCh38)
Location 19:36363550-36363572
Sequence ACCAAAATTGTCTCCAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 9, 2: 31, 3: 78, 4: 242}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165526868_1165526870 -8 Left 1165526868 19:36363550-36363572 CCATATCTGGAGACAATTTTGGT 0: 1
1: 9
2: 31
3: 78
4: 242
Right 1165526870 19:36363565-36363587 ATTTTGGTTGTCACAATCGGAGG 0: 1
1: 0
2: 37
3: 162
4: 574
1165526868_1165526875 24 Left 1165526868 19:36363550-36363572 CCATATCTGGAGACAATTTTGGT 0: 1
1: 9
2: 31
3: 78
4: 242
Right 1165526875 19:36363597-36363619 GAGTGTTACAGGCATCTAATGGG 0: 1
1: 1
2: 17
3: 125
4: 514
1165526868_1165526874 23 Left 1165526868 19:36363550-36363572 CCATATCTGGAGACAATTTTGGT 0: 1
1: 9
2: 31
3: 78
4: 242
Right 1165526874 19:36363596-36363618 TGAGTGTTACAGGCATCTAATGG 0: 1
1: 0
2: 2
3: 47
4: 284
1165526868_1165526872 -2 Left 1165526868 19:36363550-36363572 CCATATCTGGAGACAATTTTGGT 0: 1
1: 9
2: 31
3: 78
4: 242
Right 1165526872 19:36363571-36363593 GTTGTCACAATCGGAGGAAAGGG 0: 1
1: 0
2: 1
3: 14
4: 122
1165526868_1165526876 30 Left 1165526868 19:36363550-36363572 CCATATCTGGAGACAATTTTGGT 0: 1
1: 9
2: 31
3: 78
4: 242
Right 1165526876 19:36363603-36363625 TACAGGCATCTAATGGGTAGAGG 0: 1
1: 32
2: 276
3: 752
4: 1314
1165526868_1165526873 13 Left 1165526868 19:36363550-36363572 CCATATCTGGAGACAATTTTGGT 0: 1
1: 9
2: 31
3: 78
4: 242
Right 1165526873 19:36363586-36363608 GGAAAGGGTGTGAGTGTTACAGG 0: 1
1: 0
2: 1
3: 21
4: 256
1165526868_1165526871 -3 Left 1165526868 19:36363550-36363572 CCATATCTGGAGACAATTTTGGT 0: 1
1: 9
2: 31
3: 78
4: 242
Right 1165526871 19:36363570-36363592 GGTTGTCACAATCGGAGGAAAGG 0: 1
1: 0
2: 2
3: 34
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165526868 Original CRISPR ACCAAAATTGTCTCCAGATA TGG (reversed) Intronic
900195025 1:1371718-1371740 ACCACAGATGTCTCCAGATGCGG + Intergenic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902110790 1:14076603-14076625 ACCCAAAATGCTTCCAGATATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902284797 1:15400547-15400569 ACTAAAATTATGTCCAGACATGG - Intergenic
904474335 1:30755207-30755229 ACCAAAAATGTCTCTAGTTATGG - Intronic
904929656 1:34076522-34076544 ACCACAAATTTCTCCAGATGTGG + Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907536073 1:55158954-55158976 TCCACAATTGTCACCAGATCCGG + Exonic
910324042 1:85983524-85983546 ACCCAAATTGTTTGCAAATAGGG + Intronic
910368952 1:86495916-86495938 ATCAAAAATGTCTCCATATGTGG + Intronic
910502918 1:87914614-87914636 ATCAAAATTCTCTGCAGATGGGG + Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
912944587 1:114074604-114074626 ACCAGAATTCTCTCCAGAGGTGG + Intergenic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
913699342 1:121359468-121359490 AAAAAAATTGTTTTCAGATATGG - Intronic
914138202 1:144920568-144920590 AAAAAAATTGTTTTCAGATATGG + Intronic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916762426 1:167829261-167829283 CTCAAAATTGTTTCCAGGTAGGG - Exonic
917039951 1:170793956-170793978 ACTAAAATTGTTTCCTGTTAGGG + Intergenic
918214880 1:182384749-182384771 TCCAACCTTGTCTCCAGGTATGG + Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918729410 1:187972191-187972213 GACAAAATTGGCTCCAGTTAAGG + Intergenic
920486750 1:206378180-206378202 AAAAAAATTGTTTTCAGATATGG - Intronic
920707997 1:208268919-208268941 ACCAGCCTTGTCTCCAGACAGGG - Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921346798 1:214194591-214194613 TCAGAAATTATCTCCAGATAGGG + Intergenic
922123387 1:222697941-222697963 ACCAAATTTGACTCAAGACAGGG + Intronic
922948313 1:229536112-229536134 AGCAAAATTGTGTGGAGATAGGG - Intronic
922959271 1:229632037-229632059 AACAAATTTGTCTTCAGCTAGGG - Intronic
922965604 1:229688546-229688568 ACCAATAATGTCTCCAGCTCTGG + Intergenic
923547834 1:234936674-234936696 AGCAAAACTGTTTCAAGATATGG - Intergenic
924164582 1:241268445-241268467 ATGAAAAATGTCTCTAGATATGG + Intronic
1063383857 10:5603734-5603756 ACCAATGTTGTCTCCAGAGCTGG - Intergenic
1064426082 10:15230884-15230906 ACAAAATTTCTCTCCAGATGGGG - Intronic
1068684651 10:59857302-59857324 AGCATAATTTTCTGCAGATAAGG + Intronic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1071161870 10:82756123-82756145 GCCAAAGTTCTCTCCAGATATGG + Intronic
1071954683 10:90744683-90744705 ACCAAAAATCCCTCCAGAAATGG + Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1075792428 10:125094612-125094634 ACCAGAGATGTCGCCAGATAGGG - Intronic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083045580 11:59732023-59732045 ACCATAGTTATTTCCAGATAGGG + Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1086038166 11:82441974-82441996 ACCATAGTTGTCTCCTGCTAGGG - Intergenic
1086329275 11:85737574-85737596 ACCAAATGTGTCTCCAGAGAAGG - Exonic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087823427 11:102737335-102737357 CCCAAGACTGTCTCCAGATGGGG - Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1088371802 11:109097593-109097615 ACAAAAATTGTCTCAATATCAGG - Intergenic
1089179958 11:116576662-116576684 ACCACAAATGTCTCCAGAGTGGG - Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093512262 12:19943482-19943504 ACCATGATGGACTCCAGATAAGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1095119486 12:38399707-38399729 GCAATAATTGTCTCTAGATAAGG + Intergenic
1096541432 12:52309527-52309549 ACTAAAAATGTCTCTAGATGTGG + Intergenic
1099048940 12:77760129-77760151 ACCAATATTAAATCCAGATATGG + Intergenic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1101187434 12:102293835-102293857 TCTAAAATTGACTGCAGATATGG - Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101330789 12:103756259-103756281 ACCAAACCTTTCTCCAGATGAGG - Intronic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1103426559 12:120840555-120840577 ACCAGAATTGTGGCCAGATGCGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1106657645 13:31763379-31763401 ACCAAAAGTGTCTCCAGGCTGGG - Intronic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1110564459 13:76944392-76944414 ACCAAAATTGTTTCCACCTTAGG - Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112614596 13:100990380-100990402 ACCAAACATATCTCCAGATGTGG - Intergenic
1112805040 13:103155465-103155487 ATCAGAAGGGTCTCCAGATATGG + Intergenic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1126793928 15:52244518-52244540 ACCAAAATTTTCTTCAGAGCAGG - Exonic
1127438599 15:58983745-58983767 ACCAAATTAGTCTGCATATATGG - Intronic
1128794635 15:70456340-70456362 ACTAAAATTTTCTGCAGAAATGG - Intergenic
1129051638 15:72786047-72786069 ACCCAAATTGCTTCCAGACATGG + Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130762954 15:86839704-86839726 ACCAAAATTGCCTCCTGTCAAGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133404347 16:5510867-5510889 ACCAGAAGTGTCTCTAGCTATGG + Intergenic
1133742794 16:8663986-8664008 ACCAAAACTGTCTCCAGCTGTGG + Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137952269 16:52794875-52794897 ACCAAAAGTGACTCCAGATGGGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1141026041 16:80549344-80549366 ACTAAAATTGTTACCAGAGAGGG + Intronic
1141178823 16:81738677-81738699 TCAAAAACTGTCTCCAGATAGGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141475586 16:84270955-84270977 TCGAAGATTGTCTCCAAATAGGG - Intergenic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143965009 17:10750879-10750901 ATCAAAAATGTTTCCAGATGTGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1150357953 17:64504782-64504804 TCCAAACTTCTTTCCAGATAAGG + Exonic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1155785544 18:29895266-29895288 TCCAAAAATTGCTCCAGATATGG - Intergenic
1157315624 18:46587087-46587109 ACCAATATTGTCTCCTCATAGGG + Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1157884794 18:51356410-51356432 ACAAAAATTGTATCCATATTGGG + Intergenic
1159158252 18:64610535-64610557 AACAAAAATGTCTCCAGATGTGG + Intergenic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1164469398 19:28516895-28516917 ACCAAAATTGGCATCAAATATGG - Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
925053483 2:835594-835616 ACCAAAATAGCCTCCAAATTTGG - Intergenic
925421000 2:3711733-3711755 AACAAACTTGTCTCCACAAAGGG - Intronic
925574227 2:5343937-5343959 ACCAGTATTGTCTCCACAGATGG - Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
929669219 2:43856586-43856608 GGGAAAATTGTATCCAGATAGGG - Intronic
932425074 2:71627338-71627360 ACCTAAATTGTCTAAAAATATGG + Intronic
933055754 2:77662166-77662188 ACCAAAAGTTTGTCCAGCTATGG + Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937065780 2:119016166-119016188 TCCTAAATTGTCTTCCGATAAGG + Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
939329923 2:140744412-140744434 ATCTTAATTCTCTCCAGATAGGG - Intronic
939530552 2:143355085-143355107 ACCTAAACTGTCTCCAGTTTTGG + Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940495995 2:154429375-154429397 ACTAAAACTGTCTCTATATACGG - Intronic
942264664 2:174210517-174210539 ACCAAAACTGTCTACTCATAAGG + Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
944773926 2:202942522-202942544 ACCAAAATTGTCCACAGGAATGG - Intronic
945557066 2:211290588-211290610 ACAATAATTGTCTCCAGGAAAGG - Intergenic
945937717 2:215920096-215920118 AACAAGATTGTTTGCAGATAGGG - Intergenic
945939452 2:215933506-215933528 GCTAAGAATGTCTCCAGATATGG + Intergenic
947071673 2:226294477-226294499 GCCAAAACTGTCTCCAGATTTGG - Intergenic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
1169849075 20:10031133-10031155 ACCAACTTTGTCTCCAAACATGG + Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1173925378 20:46777310-46777332 AACAAAATCTTCTCCAGATATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1174992774 20:55530628-55530650 AGCAAAATTGTTCCCAGAGAAGG + Intergenic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175261972 20:57680373-57680395 ACCACAAGTGTTTCCAGATATGG - Intronic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175665507 20:60855320-60855342 AACAAAGTTGTCTCCAGAAGTGG - Intergenic
1177561956 21:22767423-22767445 ACCAAAATTGTATCAAAAAAGGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1180781861 22:18524976-18524998 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181238747 22:21464320-21464342 ATCAAAAATGTCTTCAGATCGGG - Intergenic
1181757122 22:25031979-25032001 ACCAGAATGCTCTCCAGAGATGG + Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
950327547 3:12126039-12126061 ACCAAAATTGTTTACACATAAGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956089979 3:65656204-65656226 AACAAAATTTTCTCAATATATGG - Intronic
957143374 3:76390050-76390072 ATAAAAATTGTCTTCACATAAGG + Intronic
957266128 3:77968610-77968632 ACCAAAATTCTTTCCAGGTCAGG - Intergenic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
957526615 3:81386353-81386375 ACCAAAATTGTGTTCAGAAAGGG + Intergenic
957987993 3:87595922-87595944 GCCAAAATTGCCTCCAGACTAGG + Intergenic
959775226 3:110151597-110151619 ACAAAAATTAACTCAAGATAGGG - Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961739429 3:129023753-129023775 ACCAAAAATGTCTGCAGCTTAGG + Intronic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963711308 3:148750787-148750809 ACCAAAAGTGATTCCAGACATGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964721936 3:159775805-159775827 AGCAAAGTTCTCTCCATATATGG - Intronic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
965314835 3:167178628-167178650 ACCCAAATTGGCTGCTGATAAGG + Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
968336690 3:197919565-197919587 CCCAAAATTGCCTTCAGATCGGG + Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
970307570 4:14749313-14749335 ACCCAAATTATTTCCAAATAAGG + Intergenic
970820621 4:20207713-20207735 ACTAAAATTGACTCAAGAAAGGG + Intergenic
971730559 4:30373923-30373945 ACAAAAATTGCTTACAGATAAGG - Intergenic
972363484 4:38350914-38350936 AAAAGCATTGTCTCCAGATAAGG - Intergenic
972426093 4:38934376-38934398 CCAAAAATTGTCTGCAGAAAGGG - Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
977523867 4:98121053-98121075 ACAAAAATTAGCTCAAGATATGG - Intronic
978134245 4:105237398-105237420 AGCAAATTTATCTTCAGATATGG + Intronic
983015007 4:162602782-162602804 ATCAAACTTGTCTCCATCTAGGG - Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984385699 4:179054506-179054528 ACCAAGATTGTCTTCAGAGAGGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988874868 5:35432672-35432694 CCCTAAATTGTCTACAGAGATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991201018 5:63992735-63992757 ACCAAGATTCTTTCCAGGTAAGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993069456 5:83141376-83141398 GCCAAATTTCTCTCCAGAAAAGG + Intronic
993345936 5:86782706-86782728 AACTAAATTGCCTGCAGATAGGG - Intergenic
993422832 5:87722579-87722601 ACAAAAATTGTCTCTAGTTGAGG + Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
995953877 5:117750864-117750886 GCCAATATTGTTTTCAGATAAGG + Intergenic
996151564 5:120042550-120042572 ACAAAAATTGTTTCAACATAGGG + Intergenic
996785347 5:127231013-127231035 ACCAAGATAGTGTCCAGATTTGG - Intergenic
997149301 5:131475290-131475312 ACCAAAACAGTCTCCTGAGAAGG + Intronic
997306108 5:132837862-132837884 ACCACAGTTGTCTAAAGATAGGG + Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
1000490769 5:161910584-161910606 ATCACAATTATCTCCAGGTAAGG + Intergenic
1000497238 5:162000013-162000035 ATCAAAATTGTCTCCAGAAGTGG + Intergenic
1000771992 5:165366127-165366149 AAGAATATTGTCTCCAGATGAGG - Intergenic
1000915455 5:167075689-167075711 ACCAAAAATGTTTCCAATTATGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005187092 6:23174702-23174724 ATCAAAATTTTCTCCATACATGG + Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008127131 6:47681446-47681468 TCCAATGTTATCTCCAGATATGG - Exonic
1008232217 6:48996708-48996730 CCCCAAACTGTCCCCAGATAGGG + Intergenic
1008552341 6:52645192-52645214 AGCAAAATTGCCACCTGATATGG + Intergenic
1009037698 6:58137809-58137831 AACAAAAATGTCCCCAGATATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1017345328 6:153372785-153372807 TCAAACCTTGTCTCCAGATAAGG - Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1025245827 7:57316487-57316509 ATCAAAATAGCCTCCAGATCTGG + Intergenic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029168132 7:98610486-98610508 TCCAGATCTGTCTCCAGATATGG + Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032572123 7:133011572-133011594 ACCTAAAAGGTCTCCAGGTATGG + Intronic
1036159293 8:6371477-6371499 ACCAAATTTTCATCCAGATAAGG - Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036687316 8:10920651-10920673 AACAAAATTGTCTCGTGATGAGG + Intronic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037125446 8:15342504-15342526 TACAAAATTGTCTCCAAAAAGGG - Intergenic
1038387604 8:27163941-27163963 ACCAAAAATGTCTTCAAATCTGG + Intergenic
1038464058 8:27743602-27743624 ACCACACTTGTCCCCTGATATGG - Intronic
1042838759 8:73102553-73102575 AACAAACTTGTTTCCACATAAGG + Intronic
1043561966 8:81503470-81503492 ACCAAAAATGCCTCAAGATTTGG - Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1045909994 8:107396402-107396424 ACCAAAATTATCTTTAGAAATGG + Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1047043762 8:121028237-121028259 ACCAAAAATATCTGGAGATATGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1047899281 8:129402365-129402387 ATCAAAATTGTGACTAGATATGG - Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050176975 9:2878394-2878416 CCCAACCCTGTCTCCAGATAAGG + Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1051774116 9:20615454-20615476 AACAAAATTGTTTTCAGAAAAGG - Intronic
1052883608 9:33622304-33622326 TCCAAAAATGGCACCAGATAGGG - Intergenic
1055613495 9:78047398-78047420 GCCAAATTTCTCTCCAGAAAAGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056417018 9:86386593-86386615 ATCAAATATGTCTCCAGATCTGG + Intergenic
1056636565 9:88336154-88336176 ACCAAAATTGTATGGGGATATGG - Intergenic
1056827209 9:89884560-89884582 ACACAGATTGTCTCCAGACAGGG - Intergenic
1058836081 9:108859585-108859607 CCCATAATTGTCACCAGCTAAGG - Intergenic
1058981449 9:110174294-110174316 CCCAAAATTGACTGCAAATAGGG + Intergenic
1059604779 9:115822743-115822765 ATCAATAGTGTCTCCAGATAAGG - Intergenic
1059759143 9:117321875-117321897 ACCAAAACTGGCTCCAAATATGG + Intronic
1059983022 9:119794065-119794087 TCCAGAATTGTATGCAGATATGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060195180 9:121618886-121618908 ACCAAAATTGGGACCAGATTAGG - Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186614435 X:11171867-11171889 ACCAGAATTATCTCTAGACATGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187987512 X:24830347-24830369 ACTAAAATGGTCTCCCCATACGG - Intronic
1188407828 X:29833683-29833705 ACCAGAATTTTCTCAAGAGATGG - Intronic
1188761795 X:34041485-34041507 ACCAAAACTATTTCCAGATATGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1194087634 X:89548532-89548554 ACTAACATTTTCTCCAGAAAAGG + Intergenic
1194613397 X:96071921-96071943 ATCAAAATTATCTCCAGAAAGGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195645690 X:107228578-107228600 ACCAAAAATGCCTCCACCTAGGG - Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1197518733 X:127471719-127471741 TCAAATATTGTCTCCAGAGATGG - Intergenic
1198313715 X:135445529-135445551 ACTAAAAACGTCTCCAGATCTGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1200440277 Y:3204402-3204424 ACTAACATTTTCTCCAGAAAAGG + Intergenic
1200801619 Y:7392443-7392465 ACCTAAACTTTGTCCAGATAGGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic