ID: 1165528514

View in Genome Browser
Species Human (GRCh38)
Location 19:36377197-36377219
Sequence GGGGATCAAAGAGACCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165528507_1165528514 1 Left 1165528507 19:36377173-36377195 CCCTGCTTTTGAACTCAGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1165528514 19:36377197-36377219 GGGGATCAAAGAGACCTAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1165528509_1165528514 0 Left 1165528509 19:36377174-36377196 CCTGCTTTTGAACTCAGGGCGGT 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1165528514 19:36377197-36377219 GGGGATCAAAGAGACCTAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1165528503_1165528514 9 Left 1165528503 19:36377165-36377187 CCTCCTTTCCCTGCTTTTGAACT 0: 1
1: 1
2: 1
3: 49
4: 388
Right 1165528514 19:36377197-36377219 GGGGATCAAAGAGACCTAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1165528500_1165528514 28 Left 1165528500 19:36377146-36377168 CCTGTCGCCAATCAAACCACCTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1165528514 19:36377197-36377219 GGGGATCAAAGAGACCTAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1165528501_1165528514 21 Left 1165528501 19:36377153-36377175 CCAATCAAACCACCTCCTTTCCC 0: 1
1: 0
2: 2
3: 21
4: 279
Right 1165528514 19:36377197-36377219 GGGGATCAAAGAGACCTAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1165528502_1165528514 12 Left 1165528502 19:36377162-36377184 CCACCTCCTTTCCCTGCTTTTGA 0: 1
1: 0
2: 4
3: 69
4: 743
Right 1165528514 19:36377197-36377219 GGGGATCAAAGAGACCTAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 93
1165528504_1165528514 6 Left 1165528504 19:36377168-36377190 CCTTTCCCTGCTTTTGAACTCAG 0: 1
1: 0
2: 0
3: 30
4: 317
Right 1165528514 19:36377197-36377219 GGGGATCAAAGAGACCTAGTGGG 0: 1
1: 0
2: 0
3: 9
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165528514 Original CRISPR GGGGATCAAAGAGACCTAGT GGG Intronic
902272082 1:15311932-15311954 GGGGATCCTCGAGCCCTAGTCGG - Intronic
902576490 1:17381192-17381214 GGGCAGCAAAGAGACCAAGAAGG - Intronic
905230995 1:36514892-36514914 GGGGACCACAGGGACCTGGTGGG + Intergenic
905488288 1:38323264-38323286 AGGGATAAAAGAAACCTAGGAGG + Intergenic
908559081 1:65286930-65286952 TGGGATCAAAGAAACCTATATGG - Intronic
915525309 1:156472407-156472429 GGGGCTCAAAGACACCTGGGTGG + Intronic
921659128 1:217777806-217777828 GGGGACAAAAGAGAGATAGTAGG + Intronic
922562529 1:226579592-226579614 GGGGATCAGGGAGACCAACTTGG + Intronic
923236932 1:232043064-232043086 CTGGATCAAAGAGACCTGATAGG + Intergenic
1065132926 10:22640877-22640899 GGAGCCCAATGAGACCTAGTGGG + Intronic
1065893879 10:30144279-30144301 GTGGCTCAAAGAGACAGAGTAGG + Intergenic
1066118007 10:32257261-32257283 AAGGATCACAGAGACCTGGTGGG - Intergenic
1066679125 10:37919552-37919574 GGGGATGAAAGAGAACAGGTTGG + Intergenic
1071457024 10:85858754-85858776 AGGGGTCAAAGAGACCTGGCTGG - Intronic
1073659843 10:105462825-105462847 AGGGATCAAAGAGTCAAAGTAGG - Intergenic
1085460722 11:76691661-76691683 GGGCATCGAAGAGACCTACTGGG - Intergenic
1085905518 11:80756602-80756624 GGAGAACAAAGAAAGCTAGTAGG - Intergenic
1087234471 11:95702945-95702967 GGGGAACACAGAGACTTAGAAGG - Intergenic
1091354575 11:134926378-134926400 GGGGATGAAAGAGAGATTGTTGG + Intergenic
1093021251 12:14206376-14206398 GGGAATCTAAGAGACCTATAAGG - Intergenic
1113676253 13:112209757-112209779 GGAGATGAAGGAGACCTAGTGGG + Intergenic
1117480511 14:56139256-56139278 GGGGAGGAGAGAGACCTTGTGGG + Intronic
1118093680 14:62512186-62512208 GGTGATCAAACAGAACTACTAGG + Intergenic
1119229241 14:72967560-72967582 TGTGATCAATGAGACCAAGTGGG - Intergenic
1120477461 14:85006319-85006341 GAGGATCAAAGAGACAGAGAGGG + Intergenic
1120921653 14:89761005-89761027 GGGGGTCAAAGAAACCAAGGAGG + Intergenic
1124061287 15:26295822-26295844 AGAAGTCAAAGAGACCTAGTGGG + Intergenic
1124623937 15:31297502-31297524 GGGGATAAGACAGAGCTAGTGGG + Intergenic
1128704372 15:69827987-69828009 GGAGATCAAAGGGAACTAGCAGG - Intergenic
1134336635 16:13305731-13305753 AGGGATCAAAGTGATCTAGTTGG - Intergenic
1134684239 16:16147525-16147547 GGGGGTCAAAGCCACCTAGTTGG - Intergenic
1137523828 16:49216324-49216346 GGGGATCAATTACACCAAGTGGG + Intergenic
1138182068 16:54948080-54948102 TGGAGTCAGAGAGACCTAGTGGG - Intergenic
1140642393 16:76991446-76991468 GGGGATCAAAGAAGCATATTTGG - Intergenic
1140954228 16:79847334-79847356 GTGGATCAAAGAGCTCTGGTTGG + Intergenic
1142479910 17:212950-212972 GGGATTCAAAGAAACCTAATAGG + Exonic
1144761398 17:17709577-17709599 GGGAAGGAAAGAGACCTAGTGGG - Intronic
1146616695 17:34362424-34362446 GGGGATTCAAGAGACTGAGTAGG - Intronic
1148187431 17:45654827-45654849 GGAGATGACAGAGACCCAGTGGG - Intergenic
1149605253 17:57920126-57920148 TGGAATCAAAAAGACCTACTGGG - Intronic
1154932392 18:21013508-21013530 TGGTATCAAAGAGACATGGTAGG - Intronic
1157753880 18:50200962-50200984 GAGGAGCAAAGAGAGCCAGTTGG - Intergenic
1158285233 18:55873522-55873544 TGGAATCAAAGAGACCTTTTGGG - Intergenic
1165528514 19:36377197-36377219 GGGGATCAAAGAGACCTAGTGGG + Intronic
925761238 2:7186780-7186802 GGGGCTTAAAGAGCCCCAGTTGG + Intergenic
925794564 2:7528139-7528161 GGGGAGCAAGGAGAACCAGTTGG + Intergenic
926717263 2:15934645-15934667 TGGGTTCAAAGAGACCAAGATGG - Intergenic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
930632685 2:53771134-53771156 GTGGATCAAAATGACCTAGAGGG - Intronic
932399522 2:71470243-71470265 GGGGATCTTATAGAACTAGTTGG + Intronic
933847883 2:86339863-86339885 GTGGTTCAAAGAGACCCTGTTGG + Intergenic
935098370 2:99968834-99968856 GGGGAGCAAAGAGAGGTAGAGGG - Intronic
940100641 2:150034720-150034742 TGGGATCAGAGGGACCTAGCAGG + Intergenic
946249415 2:218403484-218403506 GGGGATCCAAGAGGCCAAGGTGG - Intronic
1174398982 20:50265635-50265657 TGGGATCAAAGAGGCCCAGTAGG - Intergenic
1184879550 22:47296274-47296296 GGGGCTCAAAGAGACCTTGGAGG - Intergenic
951920083 3:27844936-27844958 AGGGATCTAAGAGATCTAGGAGG - Intergenic
952323885 3:32302987-32303009 GGGGGTCAAAGAGACGAAATTGG - Intronic
953310100 3:41868790-41868812 GGGGAAAAAAAAGACCTAGCTGG - Intronic
967477660 3:189940113-189940135 TGGGTTCAAAGAGACCAGGTAGG + Intergenic
967799310 3:193638268-193638290 GAGGATGACAGAGACCCAGTTGG + Intronic
968433250 4:571925-571947 GGGGTGCACAGAGACCTAGCTGG - Intergenic
972479569 4:39485106-39485128 GAGGACCAAAGAGACCAAATGGG - Intergenic
974255795 4:59452715-59452737 GAGGAGCAAGGAGACCCAGTTGG - Intergenic
975396018 4:73874230-73874252 ACTGATCAAAGAGACCCAGTGGG + Intergenic
977152087 4:93525418-93525440 GTGGAACAAAGACACCTACTGGG + Intronic
984011309 4:174375196-174375218 TGAGACCAAAGAAACCTAGTGGG + Intergenic
987281553 5:16419026-16419048 GGGGCTGAGAGTGACCTAGTGGG + Intergenic
996814558 5:127560457-127560479 TTGGATCAAAAAAACCTAGTTGG + Intergenic
997614593 5:135237666-135237688 GGGGACCAGAGAGACCCAGCTGG - Intronic
998411257 5:141913244-141913266 GAGGATCAGAAAGACCTAGGAGG + Intergenic
998490789 5:142544672-142544694 GGGGAGGAACGAGACCAAGTAGG + Intergenic
1000370237 5:160528174-160528196 GGGAATCAAAGAGGAATAGTTGG + Intergenic
1002627972 5:180545801-180545823 ATGGATCAAAGACATCTAGTAGG - Intronic
1002771613 6:294875-294897 TGGGATGAAAGTGACCTAGAAGG + Intronic
1005102067 6:22182063-22182085 GGGGAGCAAAGATAACTATTCGG - Intergenic
1007008984 6:38396324-38396346 GGGAATCTTAGAGACATAGTAGG - Intronic
1011598639 6:89039985-89040007 TGGGAGCAAAGAGACCAATTGGG - Intergenic
1013967805 6:115976032-115976054 GAGGATCTATGAGATCTAGTTGG + Intronic
1018668997 6:166164326-166164348 GTGGATCATTGAGACCTAGCTGG - Intronic
1022276682 7:28862199-28862221 AGAGAACAAAGAGACCTAGAGGG + Intergenic
1023628299 7:42138472-42138494 TGGGATCACAGACACCAAGTTGG + Intronic
1024000613 7:45187078-45187100 GGGGATCACAGAGACATACAAGG + Intergenic
1024435436 7:49348244-49348266 GGGGATCAAAAGTACCTATTGGG - Intergenic
1026141420 7:67710143-67710165 GGAGATCAAAGAGACAAATTTGG - Intergenic
1029533130 7:101138496-101138518 GGGGATCAAAAGGACGGAGTGGG + Exonic
1033354061 7:140585413-140585435 GGGGCTCCAAGAGAACTAGAGGG + Intronic
1036799431 8:11779381-11779403 TGGGAGCAAGGAGACTTAGTTGG - Intronic
1040023579 8:42761891-42761913 TCGGATCAAAAAGACCAAGTGGG + Intronic
1040305796 8:46211147-46211169 TGGGATGAAAGAGGCCTACTTGG - Intergenic
1040333797 8:46405912-46405934 TGGGATGAAAGAGACCTCCTTGG - Intergenic
1040719441 8:50299481-50299503 GGGGAACAAAGAGACATCATAGG + Intronic
1048466179 8:134666229-134666251 AGGCATCAAAGAGACTGAGTGGG + Intronic
1051350556 9:16194511-16194533 GAGGCTCAAAGAGACTTAGTTGG - Intergenic
1052995349 9:34549152-34549174 GGGGAGCAAAGAGAAGTAGGGGG + Intergenic
1053094636 9:35314174-35314196 GGAAATCAAATAGACCTAGTGGG + Intronic
1192420677 X:71027372-71027394 GGATACCAAAAAGACCTAGTTGG + Intergenic
1193855023 X:86590048-86590070 GGGGAACAAAGAGAAAGAGTTGG + Intronic
1196494343 X:116306885-116306907 AGGGATCCAAGGGACCCAGTTGG + Intergenic
1196786737 X:119427412-119427434 GGGGATCAAGGGGAGCTTGTAGG + Intronic
1199427287 X:147717630-147717652 TGGGGTCAGAGAGACATAGTAGG - Intergenic
1201861074 Y:18597659-18597681 GAGGACCAAAGAGACCTATATGG + Intergenic
1201872249 Y:18722721-18722743 GAGGACCAAAGAGACCTATATGG - Intergenic