ID: 1165529178

View in Genome Browser
Species Human (GRCh38)
Location 19:36382415-36382437
Sequence CTGGAATTCTAGAGGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165529173_1165529178 23 Left 1165529173 19:36382369-36382391 CCTAATCTTGCATGAGTTTATCT No data
Right 1165529178 19:36382415-36382437 CTGGAATTCTAGAGGCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165529178 Original CRISPR CTGGAATTCTAGAGGCAAGA GGG Intergenic
No off target data available for this crispr