ID: 1165531777

View in Genome Browser
Species Human (GRCh38)
Location 19:36408887-36408909
Sequence TTATACTTAGATATTTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 365}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165531777 Original CRISPR TTATACTTAGATATTTTGGT TGG Intronic
900661343 1:3785833-3785855 TGATTTTTTGATATTTTGGTGGG - Intronic
901888078 1:12238188-12238210 TTATATATATATATTTTGGGGGG - Intronic
906995896 1:50794087-50794109 CTATACTTTGATACTTTGGTAGG + Intronic
907791493 1:57669778-57669800 TTATGCTTAAATAATGTGGTAGG - Intronic
908694968 1:66829316-66829338 TTATACTTAAATTTTTTTGTAGG - Intronic
908835874 1:68229861-68229883 TTATACATAGATATTTTTCAAGG + Intronic
910571458 1:88709350-88709372 TTACTCTTAAATATTTTGATGGG - Intronic
911567558 1:99481203-99481225 ATATACATAGATACGTTGGTGGG - Intergenic
912259474 1:108096054-108096076 CTAAAGTTAGACATTTTGGTTGG - Intergenic
915709324 1:157879436-157879458 TTATATTTATATATTTTTCTGGG + Intronic
917783459 1:178425852-178425874 TTATACCTGGATATATTGGTGGG + Intronic
918286578 1:183061343-183061365 TTGTCTTTAGATTTTTTGGTTGG + Intronic
918601652 1:186370823-186370845 TTATATTTACATATTTTTGTTGG + Intronic
918953287 1:191169941-191169963 TTATTCTTAAATACTTTAGTGGG + Intergenic
919181516 1:194089498-194089520 TTAGAATAAGATATTTAGGTTGG - Intergenic
919236678 1:194854533-194854555 TTATAATCAGATATTTTTGTTGG - Intergenic
921116751 1:212099105-212099127 TTCTACTTTTATATTTTGTTTGG + Intronic
922716643 1:227878621-227878643 TTAATATTAGGTATTTTGGTGGG - Intergenic
1063828489 10:9925462-9925484 TTATATTAAAATATTTGGGTTGG - Intergenic
1063888784 10:10607786-10607808 TGATACTTAGAAGTTTTGTTTGG - Intergenic
1064246401 10:13670969-13670991 TTAAACTTAGATATTTGAGCAGG - Intronic
1064776240 10:18780713-18780735 ATATATTGAGATATTTTAGTAGG + Intergenic
1065546768 10:26829294-26829316 TTATTCTTAGATCTTTTCATTGG - Intronic
1066339180 10:34512882-34512904 TTAATCTTAGATTTTTGGGTGGG - Intronic
1068278861 10:54840901-54840923 ATATACTTAGATCTATTGTTGGG - Intronic
1068338608 10:55670832-55670854 TTGAACTTAGACATTTTGCTGGG + Intergenic
1068885156 10:62090609-62090631 TAATACTTTGCTATTTTGATAGG + Intronic
1069297130 10:66860359-66860381 ATAAACTTTGATATTTTTGTAGG - Intronic
1069352589 10:67547211-67547233 TTATACTTGTATTTTTTGGGGGG - Intronic
1069415069 10:68191747-68191769 TTTTACTTATTTATTTTTGTAGG + Intronic
1069545481 10:69324989-69325011 TTATACTTAGAAACTTTGTAAGG + Intronic
1070081979 10:73197942-73197964 TTATAGTTAGTTATTTTTGTTGG - Intronic
1071040142 10:81297815-81297837 TTAGGCTTATATATTTTGGAAGG - Intergenic
1071100479 10:82030963-82030985 TTATAATCAGGTATTTTGGGAGG - Intronic
1071110815 10:82153448-82153470 TTATCCTTTGATCATTTGGTGGG + Intronic
1071507139 10:86239537-86239559 TTATAATTTGAGATTTGGGTGGG - Intronic
1071768242 10:88693750-88693772 GCATACTTTGATATTTTGATAGG - Intergenic
1074972747 10:118552813-118552835 TTAATTTTAGATATTCTGGTGGG + Intergenic
1075497377 10:122935825-122935847 ATATCCTTATATATTTTGTTAGG + Intronic
1075599941 10:123760272-123760294 TTTTACTTAAAGCTTTTGGTAGG + Intronic
1075851831 10:125595291-125595313 TAATATTTATTTATTTTGGTGGG - Intronic
1077768414 11:5187915-5187937 ATATACCTAGATATTTTTGCAGG + Intergenic
1077971118 11:7192095-7192117 TTACACTTAGCTTTTCTGGTGGG - Intergenic
1078226459 11:9396062-9396084 TTATACTTATATGTTTTTGAAGG + Intronic
1078816393 11:14826633-14826655 TTTTATTTATTTATTTTGGTTGG - Intronic
1079830410 11:25259579-25259601 TTATACTTATAAATTTATGTTGG - Intergenic
1079896602 11:26126947-26126969 TTATAATTAGAAATTTGGGTGGG + Intergenic
1079931125 11:26562541-26562563 TCATTCATAGATATTATGGTTGG + Intronic
1080125450 11:28728639-28728661 TAATACTGAGATATTTTTGTTGG - Intergenic
1081571240 11:44292655-44292677 TTATACCTAAAAGTTTTGGTTGG + Intronic
1082639707 11:55642989-55643011 TTTTACTTATATATTTTAATTGG - Intergenic
1082861107 11:57857581-57857603 TTATACTTAAATGTTTTATTTGG - Intergenic
1083094082 11:60232347-60232369 TCTTCCTTAGTTATTTTGGTTGG - Intronic
1083142214 11:60731281-60731303 TTATTCTAAGATATTTTGGAAGG + Intronic
1084626962 11:70315117-70315139 TTATAATTCGAGATTTTGGGTGG + Intronic
1085871009 11:80349219-80349241 TGAGAATTAAATATTTTGGTAGG + Intergenic
1086093652 11:83029145-83029167 TTATACTTCTTTATTCTGGTTGG - Intronic
1087453994 11:98360290-98360312 TTATACTCAGATATTTTAAGGGG + Intergenic
1087639267 11:100738059-100738081 ATATTTTTAGATATTTTGATGGG + Intronic
1087970989 11:104483789-104483811 TTTTACTTATTTATTTTGATTGG + Intergenic
1089854410 11:121529937-121529959 TTTTATTTAGATTTTTTGGGGGG + Intronic
1093048430 12:14479924-14479946 TCAAAATTAGATATTTTGGAAGG + Intronic
1093156493 12:15692153-15692175 TTTTACTTTTTTATTTTGGTAGG + Intronic
1093499185 12:19791704-19791726 ATATACTTATATATTTATGTTGG - Intergenic
1094615767 12:32034929-32034951 TTTTATTTATTTATTTTGGTGGG + Intergenic
1094744242 12:33326271-33326293 TTATCTTTAGCCATTTTGGTAGG - Intergenic
1096042758 12:48533032-48533054 TTATATATATATATTTTTGTGGG - Intergenic
1097952073 12:65442342-65442364 TATTACTTACATTTTTTGGTTGG - Intronic
1098864916 12:75750928-75750950 ATTTACTGAGATATTTAGGTAGG + Intergenic
1099544502 12:83961328-83961350 ATCTACTTTGGTATTTTGGTGGG - Intergenic
1099693101 12:85985715-85985737 TTATACATAAATATTTTCATTGG + Intronic
1100061540 12:90583545-90583567 TTATCCTTAGCTCTTTTGATAGG - Intergenic
1100158621 12:91831689-91831711 TTATCCTTAAAAATTTTGGATGG + Intergenic
1103317961 12:120072228-120072250 ATATAATCAGTTATTTTGGTGGG - Intronic
1103470208 12:121174342-121174364 TTATTTTTAAATTTTTTGGTCGG - Intronic
1103818746 12:123680055-123680077 TTAAATTTAAAAATTTTGGTGGG + Intronic
1104424162 12:128660832-128660854 TTTATTTTAGATATTTTGGTGGG - Intronic
1106652582 13:31707673-31707695 TTTTACCTAGTTATTTTGGGAGG + Intergenic
1107406477 13:40118758-40118780 TTACATTTATATATTTTTGTAGG - Intergenic
1107784455 13:43940980-43941002 TTATATTTGGTTATTTTGATAGG + Intergenic
1107838396 13:44431186-44431208 TTATTCTTCGAACTTTTGGTGGG - Intergenic
1108069848 13:46617197-46617219 TTATACTTGGATGCTTTGGATGG + Intronic
1109910280 13:68901895-68901917 TAATAGTTAGATATATTTGTGGG + Intergenic
1110095560 13:71515343-71515365 TTAAACTTTTATATTTTCGTTGG - Intronic
1110333967 13:74304667-74304689 TATTACTTAGATAGTATGGTAGG + Intergenic
1110367468 13:74702954-74702976 TTATATTTATATAAATTGGTAGG - Intergenic
1111406462 13:87813120-87813142 TAATAATGAGATATTTTGGAGGG + Intergenic
1111690129 13:91553309-91553331 TTATGCTTGGATTTTTTGGAAGG + Intronic
1111707195 13:91764989-91765011 TTCTGCTGAGATCTTTTGGTGGG + Intronic
1111802869 13:93001375-93001397 ATATATTTACATATTTTTGTAGG + Intergenic
1113111062 13:106824272-106824294 GAATAATTGGATATTTTGGTAGG - Intergenic
1114380262 14:22195971-22195993 TTAATTTTAGACATTTTGGTTGG - Intergenic
1114785633 14:25594526-25594548 TTCCACATCGATATTTTGGTTGG + Intergenic
1115447395 14:33507151-33507173 ATATCCTTAGATCTTTGGGTTGG - Intronic
1116074592 14:40094370-40094392 TTATATTTGCATATTTTGGTAGG - Intergenic
1117256034 14:53978805-53978827 TTATAATTTGAGACTTTGGTAGG - Intergenic
1117630164 14:57682943-57682965 ACATACTGAGATTTTTTGGTAGG - Intronic
1120061436 14:79988047-79988069 TTACACTTAAATATTTTATTTGG + Intergenic
1121487908 14:94332508-94332530 TTATAATTGTGTATTTTGGTGGG + Intergenic
1125157489 15:36604814-36604836 TTAAACTAAGATATTGTGCTTGG - Intronic
1125402229 15:39316481-39316503 TTATTCTTATAAACTTTGGTTGG - Intergenic
1125789634 15:42354441-42354463 TTATACTTACATTTTTCTGTTGG - Exonic
1126967123 15:54066860-54066882 TTAAATTTAGATATTTCTGTGGG - Intronic
1127092228 15:55478634-55478656 TTATAGTTGGAGATTTGGGTGGG - Intronic
1127709419 15:61580689-61580711 TAAGACTCAGACATTTTGGTGGG - Intergenic
1128115256 15:65101287-65101309 TGATACTTACATAATTTGGAAGG + Intronic
1130142360 15:81238636-81238658 TTTTACTTATATTTTATGGTTGG - Intronic
1130633486 15:85593824-85593846 TTATACTTAGCTATTATCATTGG - Intronic
1131310825 15:91288285-91288307 TTATAATTGTATATTTTGATGGG + Intronic
1131711417 15:95060037-95060059 TTCTACTTTTATATTTTGCTTGG + Intergenic
1131932417 15:97458315-97458337 TTATGCTAGGATATTTTTGTTGG + Intergenic
1131936282 15:97509231-97509253 TTATAGTTAGACATTATAGTGGG - Intergenic
1132283293 15:100639569-100639591 TGCTACTTTGATATTTTTGTAGG + Intronic
1133976940 16:10605974-10605996 TTAAATTGAGATATTTGGGTAGG - Intergenic
1134853502 16:17500869-17500891 TTATACATACATATATAGGTAGG - Intergenic
1137019761 16:35414134-35414156 TTTTATTTATTTATTTTGGTTGG + Intergenic
1139184418 16:64788767-64788789 TTATTTTTAAATATTTTTGTGGG - Intergenic
1141617637 16:85219354-85219376 TTATATTTTGACACTTTGGTTGG + Intergenic
1142940547 17:3376917-3376939 TTCTACTTTTATATTTTGCTCGG + Intergenic
1144234951 17:13251220-13251242 TTATATTATGATATTATGGTTGG - Intergenic
1144235730 17:13258523-13258545 TTAGAAGCAGATATTTTGGTGGG + Intergenic
1149145052 17:53480317-53480339 TTTTACTTAGATAATATGGAGGG - Intergenic
1149947701 17:60948637-60948659 TTATAGTCATTTATTTTGGTGGG - Intronic
1153324072 18:3800126-3800148 TTATACTTTCCTATTTTGGTGGG + Intronic
1155089964 18:22498179-22498201 TTATACCTAAATATTTTATTTGG - Intergenic
1155366525 18:25054746-25054768 GTATACTTATAAATTATGGTAGG - Intergenic
1155543936 18:26895450-26895472 TTATGCGAAGATATTTTGGGGGG + Intergenic
1156344867 18:36247592-36247614 TTCTACTTTTATATTTTGCTTGG + Intronic
1158031412 18:52969374-52969396 TTCTACTTCGGTAATTTGGTTGG - Intronic
1158153388 18:54398035-54398057 TTATACTTTGATAGCTTCGTAGG + Intergenic
1158383084 18:56957037-56957059 GTATACCTAGGTATTTTTGTAGG - Intronic
1159250657 18:65871687-65871709 TTAAACTTAGAAATTTTGAATGG + Intronic
1159538992 18:69751344-69751366 TTATAATTATATATATTTGTGGG - Intronic
1159665033 18:71147508-71147530 TTATAATTAAATATTCTAGTAGG - Intergenic
1160309935 18:77779613-77779635 TTATCCTTGGTTATTTGGGTGGG + Intergenic
1160360555 18:78272563-78272585 TTATTCCTAGGTATTTTGTTTGG + Intergenic
1163886755 19:19971946-19971968 TTCTACTTTTATATTTTGCTTGG + Intergenic
1165531777 19:36408887-36408909 TTATACTTAGATATTTTGGTTGG + Intronic
1165550074 19:36576420-36576442 TAATAATTGGATATTTTGGCCGG + Intronic
1166018914 19:40006755-40006777 TTATTCTTAGGCATTTAGGTTGG - Intronic
1166265233 19:41677733-41677755 TTACACTCAGATATTTTTGAAGG + Intronic
1166603430 19:44118420-44118442 TTTTACTTAGATTTTTTTCTAGG + Intronic
929843329 2:45495052-45495074 GTATACTTAGATCCTCTGGTTGG - Intronic
930546776 2:52777766-52777788 TGATTATTAGATATTTTGGTTGG - Intergenic
931196816 2:60059609-60059631 TGATACTTTGATATTGTTGTGGG + Intergenic
931364047 2:61603341-61603363 TAATACATAGAAATTTTGGTCGG - Intergenic
931507684 2:62949682-62949704 TTTTCCTTAGGTATTTTAGTTGG + Intronic
933320080 2:80762854-80762876 TAATACTTAGTTATATTTGTGGG - Intergenic
933524892 2:83424375-83424397 TGATATATAAATATTTTGGTAGG - Intergenic
933570626 2:84006613-84006635 ATATAGTTTGATTTTTTGGTTGG - Intergenic
933903945 2:86870728-86870750 TTGTAGTTATATATTTAGGTGGG + Intergenic
935036077 2:99375237-99375259 TTATAGCTGGATATTTTGCTTGG + Intronic
935776564 2:106478245-106478267 TTGTAGTTATATATTTAGGTGGG - Intergenic
935923308 2:108038925-108038947 TGATCCTGAGATTTTTTGGTTGG - Intergenic
936368290 2:111881406-111881428 TTGTAGTTATATATTTAGGTGGG - Intronic
936397817 2:112142355-112142377 TTGTAATGATATATTTTGGTAGG + Intronic
936609763 2:113990842-113990864 TTTTTCTTAAATATTTTCGTTGG + Intergenic
937533229 2:122855137-122855159 TTATATTTTTATATTTTTGTTGG + Intergenic
937847944 2:126601910-126601932 TTATACCTAGATTTTTTTTTTGG + Intergenic
938813978 2:134880970-134880992 ATATGAATAGATATTTTGGTTGG - Intronic
938821053 2:134960526-134960548 TTATGCTTAAATATTTTTGAAGG - Intergenic
939170897 2:138694047-138694069 ATATAATTATATATTTTAGTTGG - Intronic
939599963 2:144176611-144176633 TTACAATTAGAGAATTTGGTAGG + Intronic
940896852 2:159089305-159089327 TTGTAGTTAGATATTTTACTAGG + Intronic
941000162 2:160194228-160194250 TAACACTTAGAAATTTTGTTTGG - Intronic
941189733 2:162365964-162365986 TTATACTGACATATATTGTTTGG - Intronic
941350997 2:164436023-164436045 TTATACTTATATTTTTGGGGGGG + Intergenic
941995003 2:171594030-171594052 TTTGACTTAGATTTATTGGTGGG - Intergenic
942018351 2:171841030-171841052 TTATGCTAAGATAGTTTGGCTGG - Intronic
942031230 2:171962280-171962302 TTCTAGTTAGATATTCTGGTAGG - Intronic
942600725 2:177638407-177638429 TTATACTTAGATATTTCAGAGGG - Intronic
943048153 2:182883150-182883172 AAATACTTATATATTTAGGTTGG + Intergenic
943599669 2:189900481-189900503 TAATACTGAGATATTTTATTTGG - Intronic
944064207 2:195602097-195602119 TTATACTTAGGTATTATGTTGGG + Intronic
944901420 2:204220400-204220422 TTATTATTAGACATTTAGGTTGG + Intergenic
945049820 2:205813117-205813139 TTATATTTAGATTTTTTTGGGGG + Intergenic
945363138 2:208916530-208916552 ATATTATTACATATTTTGGTTGG - Intergenic
945703961 2:213205752-213205774 TTAGACTTAAATAATTAGGTAGG - Intergenic
946050623 2:216859434-216859456 GTTTACTTTGATCTTTTGGTTGG - Intergenic
946267485 2:218559370-218559392 ATATACTTTGATGTTTTGGGAGG - Intronic
946550534 2:220796822-220796844 TTATTTTTAGAAATTTGGGTGGG - Intergenic
946554509 2:220840709-220840731 TTTTACTTTGAGAATTTGGTTGG + Intergenic
948227871 2:236326122-236326144 CTATACCTAGATATATTGTTGGG - Intronic
948536042 2:238647886-238647908 TTATGTCTAGATGTTTTGGTTGG + Intergenic
1170160548 20:13305802-13305824 TTAAACTTTGTTCTTTTGGTGGG - Intergenic
1170278623 20:14620846-14620868 ATATACTTAGATATTTTAAAGGG + Intronic
1170563260 20:17576265-17576287 TTTTACGTAGATTTTTTGTTTGG + Intronic
1174234745 20:49080153-49080175 TTAGACTTAGATTCCTTGGTCGG + Intronic
1174884399 20:54316317-54316339 TTCTGCTTCGATACTTTGGTTGG + Intergenic
1176946871 21:14992534-14992556 TTATAGTTAGACTTTTTGGGGGG - Intronic
1177371480 21:20209827-20209849 CTATACTAAGATGTTTTGGAGGG + Intergenic
1181691393 22:24563665-24563687 TAATTCTTAGAAGTTTTGGTGGG + Intronic
1182721059 22:32400685-32400707 TTTTACTTAGGTATTTTTTTTGG + Intronic
949432026 3:3987354-3987376 TACTCTTTAGATATTTTGGTAGG - Intronic
951301390 3:21001661-21001683 TTATACTTAGATTTTATTTTAGG - Intergenic
951594633 3:24304308-24304330 TTAAAAGTAGATATTTTGATAGG + Intronic
952201723 3:31136071-31136093 TTAGACACAGATATTTGGGTGGG - Intergenic
953122667 3:40060509-40060531 TTATACTTGAATATTTTAGAGGG + Intronic
953942575 3:47113510-47113532 TTGAACTTAGATGTTTTTGTAGG - Intronic
955001971 3:54935531-54935553 TTTTACTTAGATCTTTTGAGTGG + Intronic
956137003 3:66109305-66109327 TTAGATTTAGATATTTTGCCAGG + Intergenic
956959516 3:74382251-74382273 TTATAATTATATATTTTTATGGG + Intronic
956963351 3:74429945-74429967 TTGTTTTTAGGTATTTTGGTAGG - Intronic
957503369 3:81087056-81087078 CTATCCTTAGATATTTTAGTTGG + Intergenic
957561834 3:81832358-81832380 TTAAACTTATATATTTGGGAAGG - Intergenic
957676301 3:83370694-83370716 TTATATGTATATATTTTGGGGGG - Intergenic
957943178 3:87030976-87030998 TTATATTAATATGTTTTGGTAGG - Intergenic
958490713 3:94768490-94768512 TTATACATAGAAATTTTGCAAGG + Intergenic
958604179 3:96337367-96337389 GAATACTTTGATTTTTTGGTGGG - Intergenic
958687668 3:97420806-97420828 CTATACTTAGCTGGTTTGGTTGG - Intronic
959293220 3:104501282-104501304 TTATACTTAAATATTTTGTAGGG - Intergenic
960026065 3:113011570-113011592 TTATACTTGGATTTTTCTGTTGG - Intronic
962217265 3:133533425-133533447 TGAAACTTAGCTTTTTTGGTAGG + Intergenic
962774064 3:138642078-138642100 ATACACCTAGGTATTTTGGTAGG + Intergenic
963019080 3:140854801-140854823 TTATACAGAGAGGTTTTGGTTGG + Intergenic
963423328 3:145090340-145090362 TTATAAGTAGATTTTTTTGTAGG - Intergenic
963758808 3:149264274-149264296 TTATTCTTAGGTTTTTTGTTTGG - Intergenic
964028930 3:152113885-152113907 TAATACTTAGATATTATTTTTGG - Intergenic
964222100 3:154358418-154358440 TTATACTTAGATATTTTTCAAGG - Intronic
964603820 3:158536619-158536641 TTATCCCTAAATATTTTAGTAGG - Intronic
965616532 3:170599127-170599149 TTACAATTAGATATTTTTATAGG + Intronic
965712903 3:171574232-171574254 TTAAAGTTTGATATTTTGTTTGG + Intergenic
965742585 3:171891421-171891443 TAATCCTGATATATTTTGGTGGG - Intronic
966314612 3:178631835-178631857 TTATACCTAGTTATTATGCTAGG - Intronic
966601430 3:181779092-181779114 ATATATTAAGATATTTTGGCTGG - Intergenic
970040211 4:11787938-11787960 TTATACCCTGACATTTTGGTAGG - Intergenic
970376599 4:15464101-15464123 TAAAACCTAAATATTTTGGTAGG + Intergenic
971932066 4:33097531-33097553 TTATAATAAGATATTCTGGCTGG + Intergenic
972384596 4:38552880-38552902 TTATTTTTAGAGATATTGGTTGG - Intergenic
973049813 4:45582693-45582715 TTATTTCTAGATATTTTGTTGGG + Intergenic
974247032 4:59333356-59333378 TTATTCTTGGACATTTGGGTTGG - Intergenic
974274205 4:59695121-59695143 TTATACTTAGATAATAGGATAGG - Intergenic
975249026 4:72155664-72155686 TTAGACATAGATATCTTGGAAGG - Intergenic
975425501 4:74222061-74222083 TTATACTTTGATTATCTGGTTGG + Intronic
975451117 4:74527953-74527975 TTAGGCTTAGAAATTTTAGTGGG - Intergenic
976168518 4:82280291-82280313 TTTTATTTAGACATTTTTGTTGG - Intergenic
980087940 4:128410559-128410581 TTCTACTTTTATATTTTGCTTGG + Intergenic
980297497 4:130941435-130941457 GTATACTTAAAAATTTTGTTGGG + Intergenic
980599599 4:135004005-135004027 TTTCATTTAGATATTTTGATTGG - Intergenic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
981234250 4:142396427-142396449 TTCCACTTAGCTATTTTAGTGGG - Intronic
981953202 4:150436383-150436405 ATGTACTTATATATTTTGGAAGG - Intronic
983008766 4:162519440-162519462 TCATACATAGATATTCTAGTAGG + Intergenic
983079329 4:163365898-163365920 TTTTACTTAGGTTTTGTGGTAGG + Intergenic
983083876 4:163419779-163419801 TTATGCTTATATCTTTTGGTTGG + Intergenic
984114416 4:175662142-175662164 ATATATTTAGATATTTTCTTTGG - Intronic
984218212 4:176941015-176941037 TTATTGTTTGATATTTTGTTTGG + Intergenic
984406436 4:179337745-179337767 TCCTACTTAGACATTTTTGTAGG - Intergenic
984615359 4:181890807-181890829 TTTTACTGAAATATTTTAGTGGG + Intergenic
985416613 4:189741949-189741971 TTCTACTTTTATATTTTGCTCGG - Intergenic
987035789 5:14017110-14017132 CTATTCTCAGATATTTTTGTGGG + Intergenic
987602656 5:20091736-20091758 TAATACTAGGATATTTTGTTTGG + Intronic
987960332 5:24799102-24799124 TTATTCTTTGGTATTTTGTTTGG + Intergenic
988947236 5:36217358-36217380 TTATACTTAAATATATTTATTGG - Intronic
989184836 5:38613577-38613599 TTATATTTAGTTACTCTGGTTGG + Intergenic
990091481 5:52056436-52056458 TCATACTTACATATTTTGATTGG - Intronic
991002045 5:61792445-61792467 TCAGTCTTAGATATTTTGTTGGG - Intergenic
991420153 5:66432065-66432087 TAAAACCTAGATATTTTGGCTGG - Intergenic
992248751 5:74856512-74856534 TTATTCCTAGGTATTTTGTTTGG + Intronic
992432582 5:76723630-76723652 TTATATTTAGATAATTTATTTGG - Intronic
992499519 5:77328113-77328135 TTATTCTGAGATATCTTGGAAGG - Intronic
993406574 5:87518669-87518691 TCATTGTTAGATATTTGGGTTGG - Intergenic
993450927 5:88071039-88071061 TGGCACTTAGATATATTGGTTGG - Intergenic
993894070 5:93510030-93510052 ACATTTTTAGATATTTTGGTTGG - Intergenic
994023590 5:95056067-95056089 TAATACTTTTATATTTTGATTGG - Intronic
994519043 5:100806523-100806545 TTATTCTTAGCTACTTTGGGGGG - Intergenic
994838386 5:104887343-104887365 ATTTACTTAGATATTCTGATAGG - Intergenic
994971311 5:106742728-106742750 TTATTGTTGGATATTTGGGTTGG + Intergenic
995196961 5:109381427-109381449 TTATAATTAAATTTTTGGGTGGG - Intronic
995622004 5:114036317-114036339 GTATTCTTAGATATTTTTGGTGG + Intergenic
995814958 5:116157856-116157878 TTAGTTTTAGCTATTTTGGTGGG + Intronic
996598838 5:125237401-125237423 TTTTGCTTAGAGATTTAGGTTGG + Intergenic
996609108 5:125358159-125358181 TTCTACTTTCATATTTTGCTTGG + Intergenic
996806959 5:127466589-127466611 TAATATTTAGATATTTAAGTTGG - Intergenic
996870736 5:128190367-128190389 TTATAGTTAGAAATATAGGTTGG + Intergenic
997007847 5:129840839-129840861 AAAGACTTAGAGATTTTGGTGGG + Intergenic
997695907 5:135860564-135860586 TTTTCATGAGATATTTTGGTTGG + Intronic
998948327 5:147364845-147364867 TTAAATTTAGAAATTTTGGGGGG + Intronic
998987645 5:147779290-147779312 TTAAAGTTAAATATTTTGATTGG - Intronic
1000364293 5:160476807-160476829 TATTTTTTAGATATTTTGGTTGG - Intergenic
1000729264 5:164811284-164811306 TTTTATTTAGATGTTTTGGCTGG + Intergenic
1000816450 5:165928572-165928594 CTGTACTTACATATTTTAGTGGG + Intergenic
1004010740 6:11684803-11684825 TTCCACATTGATATTTTGGTGGG - Intergenic
1005421026 6:25651444-25651466 ATATATTTAGAAATTTTCGTTGG - Intergenic
1007864310 6:44951564-44951586 TTATACTAACATATTTTGTCAGG + Intronic
1008212671 6:48744065-48744087 TGAATCTTAGACATTTTGGTGGG - Intergenic
1008707718 6:54183028-54183050 ATATACTCTGATATTTTGGAAGG - Intronic
1009196300 6:60689989-60690011 TAAAATTTAGACATTTTGGTGGG + Intergenic
1009630744 6:66196946-66196968 TTATACTGATATATTTAAGTTGG - Intergenic
1010013195 6:71073792-71073814 ATTTACTTATATAATTTGGTGGG + Intergenic
1010088835 6:71954258-71954280 TTATACTAAGATTTATTGCTGGG - Intronic
1010975829 6:82312779-82312801 TTCTACTTTAATATTTTGCTTGG - Intergenic
1011237652 6:85235336-85235358 TTAAACCTAGATACTTTGGATGG - Intergenic
1011348900 6:86401234-86401256 TTATAAGTTGATATTTGGGTGGG + Intergenic
1012917182 6:105182628-105182650 ATATACTAAGATATATTGCTTGG + Intergenic
1015481865 6:133720715-133720737 TTTTACTTAAACATTTTGGTGGG + Intergenic
1015899755 6:138052703-138052725 TTCTACTTTTATATTTTGCTTGG - Intergenic
1016222358 6:141690907-141690929 TTATACTTAAGTATTTTATTTGG - Intergenic
1017345077 6:153370463-153370485 TGATACTTAGGTGTGTTGGTTGG - Intergenic
1017952219 6:159145014-159145036 ATTTACTTAAATATTTTGATAGG + Intergenic
1020317986 7:6920294-6920316 CTATAATTAGAGATTTGGGTGGG - Intergenic
1020473798 7:8570833-8570855 TTATATTTTGATAATTTGGTAGG + Intronic
1020894872 7:13927647-13927669 TGATTCGTAGATATTTTGTTTGG - Intronic
1021241305 7:18205225-18205247 ATATAATTAGATATTTTACTGGG + Intronic
1022984202 7:35634610-35634632 ATAGACTTAGAGATTTGGGTTGG - Intronic
1023715512 7:43039860-43039882 GTAAACTAAGATATCTTGGTGGG - Intergenic
1023739362 7:43264902-43264924 TTATCCTCAGATATTTTAGAAGG - Intronic
1023742851 7:43295941-43295963 TTTGACTTAGATATTTTCATTGG + Intronic
1023901895 7:44488013-44488035 ATATTCCTGGATATTTTGGTTGG - Intronic
1023957177 7:44895630-44895652 TTAGATTTAGAGATATTGGTAGG + Intergenic
1024786738 7:52916015-52916037 TTATACTTATATATATTTGGGGG + Intergenic
1025949376 7:66131623-66131645 TTATAATTACATATTTTGGAAGG - Intronic
1026932240 7:74229793-74229815 TTTTATTGAGATGTTTTGGTTGG - Exonic
1028124726 7:87099672-87099694 TGATATTTTGATATTTTGTTTGG + Intergenic
1028354034 7:89884968-89884990 TGCTACTTAGATATTATGGCAGG + Intergenic
1029102349 7:98142474-98142496 TTAAACTTCATTATTTTGGTTGG - Intronic
1030586869 7:111431719-111431741 TTAGAATTAGAGCTTTTGGTAGG - Intronic
1030590271 7:111472561-111472583 TTACAGCTAAATATTTTGGTTGG - Intronic
1030724102 7:112904876-112904898 TCATATTTTGATATTTTGGGAGG + Intronic
1031118249 7:117691526-117691548 TCACATTGAGATATTTTGGTTGG - Intronic
1031799502 7:126224177-126224199 TTCTACTTTTATATTTTGCTTGG + Intergenic
1031869749 7:127079040-127079062 TTATGCTTATATATCATGGTTGG - Intronic
1032538169 7:132681931-132681953 TGATGCTTTTATATTTTGGTTGG - Intronic
1032829041 7:135603804-135603826 TTAGACTTAGAGATTTCGGGTGG - Intronic
1033667984 7:143461678-143461700 TTTTATTTAGATGCTTTGGTAGG - Intergenic
1035063522 7:156088576-156088598 TTTTTATTAGAGATTTTGGTGGG + Intergenic
1035410785 7:158639019-158639041 TTATACTGAGGTATTGGGGTGGG + Intronic
1035966855 8:4201871-4201893 TTATACATGGAAATTTTGGGGGG + Intronic
1036666310 8:10744128-10744150 TTATAATTAAGTATTATGGTGGG - Intronic
1036915665 8:12801126-12801148 TTATAGATAGATATTTGGATTGG - Intergenic
1037862242 8:22413731-22413753 TTATTCTTAAATTTTTTTGTGGG - Intronic
1038615242 8:29087969-29087991 TTATACATATATATTTTGGCTGG + Intronic
1039130091 8:34253821-34253843 AAAAACTTAGCTATTTTGGTTGG - Intergenic
1039252328 8:35680298-35680320 TTAATCTTGGCTATTTTGGTAGG + Intronic
1039648889 8:39319073-39319095 TTGTACTTATATCTTTTGGGAGG + Intergenic
1040712087 8:50200840-50200862 TTATACTTAGAGGTTTTTTTTGG - Intronic
1040717506 8:50275089-50275111 TTAGACTTCTATATTTTGGAAGG + Intronic
1040898828 8:52395788-52395810 CTAAAATTAGATATTTAGGTTGG - Intronic
1041861933 8:62524217-62524239 ATATATATATATATTTTGGTGGG - Intronic
1042390816 8:68231537-68231559 TTATACTTTGATATTTATGCTGG + Exonic
1043235886 8:77865653-77865675 TTATACTCAAACATTTTGATAGG + Intergenic
1043638526 8:82418195-82418217 TTATAGATAGATATATTGTTGGG + Intergenic
1047004186 8:120603013-120603035 TTATTCTCAGTTATTTTTGTGGG + Intronic
1047043255 8:121022444-121022466 GGCTACTTAGATAATTTGGTTGG + Intergenic
1047270036 8:123348683-123348705 TTATATTGAGTTTTTTTGGTTGG - Intronic
1047433729 8:124816764-124816786 ATATAATGATATATTTTGGTAGG + Intergenic
1048598273 8:135890098-135890120 TGATACAAAGAAATTTTGGTAGG + Intergenic
1050723779 9:8622505-8622527 TTATACATATATACTGTGGTTGG - Intronic
1050971217 9:11877754-11877776 ATATAGTTAGATATTTAAGTGGG + Intergenic
1051897278 9:22000852-22000874 TTATCCTTACATATTTGGTTTGG + Intronic
1052090215 9:24318584-24318606 ATATATTTAGATATTTAGATAGG + Intergenic
1052182071 9:25541887-25541909 TAATAGTTAGATATTTTTATTGG - Intergenic
1052406887 9:28072667-28072689 TTATTCTTAGATAGTGAGGTAGG + Intronic
1055443446 9:76359050-76359072 TCATTCTTACATATTCTGGTTGG - Exonic
1055765249 9:79656064-79656086 CTATAAATAGATGTTTTGGTTGG + Intronic
1055818599 9:80236024-80236046 TTAAAATTATATATTATGGTAGG - Intergenic
1058339102 9:103872599-103872621 TTCTATATAGATATTTTGTTAGG - Intergenic
1058682638 9:107453547-107453569 ATAAACTTAGACATTTTAGTAGG - Intergenic
1058805309 9:108585472-108585494 TTATCCTTACAGGTTTTGGTAGG - Intergenic
1059524902 9:114981809-114981831 TAATCATTAGATATTTTGCTTGG - Intergenic
1060084745 9:120687064-120687086 TTAAAATTAGATATTTTTTTTGG - Intronic
1060360944 9:122956691-122956713 TAATACTTATATATTTTTGGAGG + Intronic
1061227601 9:129289782-129289804 TTATACATGTATATGTTGGTGGG - Intergenic
1203446967 Un_GL000219v1:65763-65785 TCATTCTTGGATATTTGGGTTGG + Intergenic
1203380583 Un_KI270435v1:33958-33980 TTATTCTTGGACATTTGGGTTGG - Intergenic
1186864849 X:13709676-13709698 TTATACTTGGATTTTTTCCTGGG + Exonic
1186986788 X:15025283-15025305 TTATACTTAAAAATTTGGGAAGG + Intergenic
1187169565 X:16838061-16838083 TAATAATCATATATTTTGGTTGG + Intronic
1187694845 X:21909106-21909128 TTAAAGTTAGATATTTGGCTGGG + Intergenic
1188165081 X:26852506-26852528 TTACACTTCTATAGTTTGGTAGG - Intergenic
1189547944 X:42062292-42062314 GTATTCCTAGGTATTTTGGTGGG + Intergenic
1189762873 X:44340778-44340800 TAAATTTTAGATATTTTGGTTGG - Intronic
1189937430 X:46084316-46084338 TTAAATTAAGCTATTTTGGTGGG + Intergenic
1191879213 X:65828064-65828086 TTCTACTTTTATATTTTGCTTGG - Intergenic
1191966853 X:66768086-66768108 TTATACCTTATTATTTTGGTTGG - Intergenic
1192853715 X:74985092-74985114 TCATTGTTGGATATTTTGGTTGG + Intergenic
1193202996 X:78714624-78714646 TTCTACTTTTATATTTTGCTTGG - Intergenic
1193364824 X:80619782-80619804 TTGTCCTGAGATTTTTTGGTTGG + Intergenic
1195311060 X:103632012-103632034 TTATCCTTGGATATTTGGGAGGG - Intergenic
1196094197 X:111781259-111781281 TTATATTCAGATGTTTGGGTGGG - Intronic
1196501577 X:116389379-116389401 TTATTCATCCATATTTTGGTTGG - Intergenic
1198650554 X:138859302-138859324 TTTTATTTAAATATTTTGGATGG - Intronic
1199333949 X:146596607-146596629 TTATATTCAGATTTTTTAGTTGG + Intergenic
1199586742 X:149423087-149423109 TTCTACTTTTATATTTTGCTTGG - Intergenic
1199898087 X:152144571-152144593 TTACACATAGGTATTTTGTTTGG + Intergenic
1201497442 Y:14603765-14603787 TTAGATTTAGATATTGTGTTTGG + Intronic
1201934842 Y:19397728-19397750 TTGTTTTTAGATATTTTGCTTGG + Intergenic
1202274769 Y:23105081-23105103 TTAAATTTAGCTATTGTGGTAGG - Intergenic
1202291258 Y:23315607-23315629 TTAAATTTAGCTATTGTGGTAGG + Intergenic
1202427761 Y:24738815-24738837 TTAAATTTAGCTATTGTGGTAGG - Intergenic
1202443030 Y:24931275-24931297 TTAAATTTAGCTATTGTGGTAGG + Intergenic