ID: 1165536685

View in Genome Browser
Species Human (GRCh38)
Location 19:36453547-36453569
Sequence ATCTATTAGCAAATGATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165536685_1165536688 29 Left 1165536685 19:36453547-36453569 CCTACAATCATTTGCTAATAGAT 0: 1
1: 0
2: 1
3: 14
4: 221
Right 1165536688 19:36453599-36453621 CATCAATAATGTAATGTGGGTGG 0: 1
1: 0
2: 2
3: 18
4: 187
1165536685_1165536686 25 Left 1165536685 19:36453547-36453569 CCTACAATCATTTGCTAATAGAT 0: 1
1: 0
2: 1
3: 14
4: 221
Right 1165536686 19:36453595-36453617 GTAACATCAATAATGTAATGTGG 0: 1
1: 1
2: 4
3: 20
4: 212
1165536685_1165536687 26 Left 1165536685 19:36453547-36453569 CCTACAATCATTTGCTAATAGAT 0: 1
1: 0
2: 1
3: 14
4: 221
Right 1165536687 19:36453596-36453618 TAACATCAATAATGTAATGTGGG 0: 1
1: 1
2: 4
3: 30
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165536685 Original CRISPR ATCTATTAGCAAATGATTGT AGG (reversed) Intronic
902471795 1:16652587-16652609 ACCTATTAACAAATGATAGACGG + Intergenic
902487011 1:16754858-16754880 ACCTATTAACAAATGATAGACGG - Intronic
906471810 1:46137203-46137225 CTCACTTAGCAAATGTTTGTTGG + Intronic
907849570 1:58242297-58242319 ATGTATTTGCAAATGATTATAGG + Intronic
909247874 1:73311581-73311603 AACTATTAGCAAATGTTGATGGG + Intergenic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910003236 1:82362058-82362080 ACCTATTTCCAAATGAATGTGGG - Intergenic
910003240 1:82362097-82362119 ACCTATTTCCAAATGAATGTGGG - Intergenic
910003244 1:82362136-82362158 ACCTATTTCCAAATGAATGTGGG - Intergenic
910813803 1:91266464-91266486 ATCTATGACCAAATGGGTGTGGG - Intronic
911375116 1:97043196-97043218 ATATATTAGCAAAGTATTTTTGG + Intergenic
918268815 1:182874776-182874798 ATGAATTAGCAAATGAATTTAGG + Intronic
920881412 1:209883896-209883918 ATCTATTAACAAATTATTACAGG + Intergenic
920998672 1:211019542-211019564 TTCTATTAGCCAATTATTATTGG + Intronic
923242010 1:232095356-232095378 ATCTTTTAGCAAATGTCAGTTGG + Intergenic
924669921 1:246113815-246113837 ATCTTTTAGAAAAAGAGTGTGGG + Intronic
1063535605 10:6879543-6879565 ATCCATTAGCATCTGTTTGTAGG + Intergenic
1063832229 10:9966680-9966702 ATCTATTAGTAAGTGATTTGAGG + Intergenic
1064475305 10:15682072-15682094 TTCTTCTAGCAAATGATTATTGG - Intronic
1064964894 10:21005239-21005261 GTCTTTTAGCAAATGTTTATTGG - Intronic
1065525128 10:26612450-26612472 CTAAGTTAGCAAATGATTGTTGG - Intergenic
1065543143 10:26790394-26790416 ATTTTTTTTCAAATGATTGTTGG + Intronic
1065600778 10:27366161-27366183 ATGTATTAACATATGATGGTTGG + Intergenic
1067959549 10:50832997-50833019 ATCTATCAGCTAATGATACTGGG - Intronic
1069418406 10:68223568-68223590 ATTTATTCTCAACTGATTGTTGG + Intergenic
1069576514 10:69533932-69533954 ATCTATGACCAAATGTCTGTGGG - Intergenic
1070695936 10:78563068-78563090 ATCTCTTAGCAAATGAAGGCAGG + Intergenic
1071230317 10:83579021-83579043 ATATATTAGCAAAGTATTTTTGG + Intergenic
1072919074 10:99560205-99560227 ATATATTAGAAAATAACTGTGGG - Intergenic
1079144068 11:17834975-17834997 ATCACTTAACAAATAATTGTTGG + Intronic
1079192235 11:18289157-18289179 ATGTATCAGAAAATGAATGTTGG - Intronic
1081018872 11:37917692-37917714 ATCTATAACCAAATTCTTGTTGG + Intergenic
1085367429 11:75963369-75963391 CTCTATTGTCAAATGATTGTGGG - Intronic
1086831595 11:91572422-91572444 ATATAATATCAAATGAATGTAGG + Intergenic
1087915782 11:103809052-103809074 ATCTCTTAGCAAATTAATGAAGG - Intergenic
1088227938 11:107642241-107642263 ATCTATTAAAAAATGAGTGAGGG - Intronic
1088872415 11:113902233-113902255 ACTTATTCTCAAATGATTGTGGG - Intergenic
1089035887 11:115390613-115390635 ACCTATTAGAAAATGAATGGTGG - Intronic
1092637834 12:10470445-10470467 ATCCTTTAACAAATTATTGTAGG - Intergenic
1094081475 12:26540503-26540525 ATTTGGTAGCTAATGATTGTAGG - Intronic
1097732268 12:63141784-63141806 ATCTATAGGCAAATGATAGTAGG - Intergenic
1103753899 12:123187741-123187763 ATCTATTTAAAAATGATTCTGGG + Intronic
1105491965 13:20897522-20897544 AAATATTAGCAAATGTTGGTTGG - Intronic
1107094105 13:36516105-36516127 AACTATTCTCAGATGATTGTAGG - Intergenic
1107632889 13:42360505-42360527 ATAGATTAGCACATGAGTGTGGG + Intergenic
1108769125 13:53676191-53676213 ATCCATTAGCAATTGATAATTGG + Intergenic
1109351963 13:61194190-61194212 ATCTATTAGCAAAACTCTGTAGG - Intergenic
1111083927 13:83348864-83348886 ATCTATCTGCTAATGATTTTAGG - Intergenic
1112654523 13:101436134-101436156 AGCTATTAACTAATGACTGTTGG - Intergenic
1114331658 14:21643026-21643048 ATCTAATAGCAAATGCTGCTGGG + Intergenic
1116852100 14:49918945-49918967 ATCTATGAGCAAAAGAATGTAGG - Intergenic
1117152251 14:52901459-52901481 ATCACTTATCAAATGATTTTAGG + Intronic
1120409291 14:84131636-84131658 AGATGTTAACAAATGATTGTTGG + Intergenic
1120698831 14:87675363-87675385 TTCTATTGCCAAATGCTTGTGGG - Intergenic
1125090018 15:35779505-35779527 ATATATTTTCAAATGTTTGTAGG - Intergenic
1125885056 15:43222763-43222785 ATTTATCAGTAAATGATTTTGGG + Intergenic
1126774118 15:52085119-52085141 ATATATTAGCAAAAGTCTGTTGG - Intergenic
1127011922 15:54640830-54640852 CTCTGTTAGAAAATGATTTTGGG - Intergenic
1128255447 15:66192777-66192799 ACCTATTAGCTGATGATTTTAGG - Intronic
1134566213 16:15254169-15254191 ATTTACTACCAAATGATAGTGGG + Intergenic
1134736282 16:16502529-16502551 ATTTACTACCAAATGATAGTGGG - Intergenic
1135240594 16:20804215-20804237 CTCTACAATCAAATGATTGTAGG - Intronic
1136033750 16:27522399-27522421 ATCTATGGTCAAATGATTCTCGG - Intronic
1136674541 16:31891283-31891305 ATTCATTAACAAATTATTGTAGG + Intronic
1138783537 16:59817926-59817948 ATTTGTTAGCATATAATTGTTGG - Intergenic
1138891418 16:61149023-61149045 ATATATTAGCAAAGTATTTTTGG + Intergenic
1139097400 16:63721092-63721114 ATATATTGGCAAATGTTTCTTGG + Intergenic
1140727218 16:77824453-77824475 AAGTATTAAAAAATGATTGTGGG + Intronic
1143841991 17:9739740-9739762 ATGTAGTAGTAAATGTTTGTTGG - Intergenic
1146116080 17:30140136-30140158 ATCTGTTAACAAATGATTGCTGG - Intronic
1146902865 17:36599746-36599768 ACCTATGAGCAAATGAAGGTGGG + Exonic
1149502186 17:57161876-57161898 ATCTATTGTCAATTGATTTTTGG - Intergenic
1154141597 18:11828867-11828889 ATCTATTCTCATATGGTTGTGGG + Intronic
1155484251 18:26324722-26324744 CTGTATTAACAAATGAGTGTAGG - Intronic
1157952128 18:52050984-52051006 AACTATTAGCAAATGAATACTGG + Intergenic
1160405677 18:78644911-78644933 ATCTTTTAGCAAAAGATTTATGG - Intergenic
1161196803 19:2991461-2991483 ATCTATCAGCATATGTTTGCAGG + Intronic
1161424792 19:4197344-4197366 ATGAATGAGCAAATGAGTGTGGG + Intronic
1165536685 19:36453547-36453569 ATCTATTAGCAAATGATTGTAGG - Intronic
1166382406 19:42361935-42361957 ATCTATTACCAAATGGTGGTGGG + Intronic
1202704195 1_KI270713v1_random:9380-9402 ACCTATTAACAAATGATAGACGG + Intergenic
928046034 2:27933224-27933246 ATATTCTAGCAAATTATTGTTGG + Intronic
929327322 2:40632182-40632204 ATCTAATAGAAAATGATGTTTGG - Intergenic
931022265 2:58060949-58060971 ATCTATTAAGAAATGATTTCAGG - Intronic
931495007 2:62796075-62796097 ATCTCCTAGCAAAAGATGGTGGG - Intronic
932109885 2:68988490-68988512 ATCTATGACAAACTGATTGTTGG - Intergenic
933182246 2:79240568-79240590 ATCTACTGTCAATTGATTGTTGG + Intronic
935507407 2:103922684-103922706 ATCAATCAGCAAATGTTTATTGG + Intergenic
936496805 2:113029500-113029522 ATCTATTAGCAAAGATTGGTAGG - Intronic
936823309 2:116551082-116551104 AGATATTAGCAAAGGGTTGTAGG + Intergenic
939071637 2:137551398-137551420 ATCTCTTGTCAAATGAATGTAGG - Intronic
939294720 2:140245823-140245845 AGCTATGAGCATATAATTGTAGG - Intronic
939847869 2:147269496-147269518 ATGTTTTAGCAAAAGATTGGTGG - Intergenic
940026632 2:149215210-149215232 ATCTATTTGCAAATTATGGGGGG + Exonic
940595666 2:155789391-155789413 AAATATTAGCATATGATTATAGG + Intergenic
940657032 2:156500001-156500023 GTATATTAGCAGATGATTGTGGG + Intronic
942161062 2:173187931-173187953 CTCTTTTAGAAAATGATTCTAGG - Intronic
942727958 2:179030807-179030829 TTCTAGTAGCAAATGTTTGAAGG - Intronic
943735989 2:191355304-191355326 ATTTATTAGCTCACGATTGTGGG - Intronic
944384271 2:199147344-199147366 ATTTATTAGGAAATGTTTCTAGG - Intergenic
946505251 2:220293411-220293433 ATCTATCAACAAATTATTATTGG + Intergenic
1169329062 20:4702327-4702349 ATCTATTAGCAATTAAGTTTTGG - Intergenic
1169970311 20:11262657-11262679 ATTTATGTGCAAATGTTTGTGGG - Intergenic
1177914784 21:27075647-27075669 ACCTATTATCAAATAATAGTAGG + Intergenic
1182948249 22:34345380-34345402 ATTCATTTCCAAATGATTGTTGG + Intergenic
951119547 3:18909134-18909156 ACCTATTAACAAATGATAGATGG - Intergenic
952216362 3:31281819-31281841 TTCTATAAGCAAATAAGTGTGGG + Intergenic
952302251 3:32113724-32113746 ATTTATTAGCTCATGATTCTGGG + Intronic
952626743 3:35415034-35415056 ATCTACTAGCAAAAGCTGGTGGG - Intergenic
952647945 3:35684761-35684783 ATCTATTAGGAATTTATTTTTGG - Intronic
953676236 3:45005077-45005099 ATCTTTTAGAAAATGATGCTGGG - Intronic
953918499 3:46935906-46935928 ATCTATTAGAAAAAGCTTGCTGG - Intronic
955034511 3:55253230-55253252 AACAATTAGCCAATGATGGTGGG + Intergenic
955069824 3:55562846-55562868 ATATGATAGCAAATGAATGTTGG + Intronic
956626256 3:71269868-71269890 ATCTCTTAGCATATGATTTATGG - Intronic
957921506 3:86754542-86754564 ATCTGCTATTAAATGATTGTTGG - Intergenic
958561518 3:95753680-95753702 ATCTCTTAACAAATTATTGTAGG - Intergenic
958782442 3:98558877-98558899 ATCTTTTAGAAAAAGATTTTAGG - Intronic
961056424 3:123792802-123792824 ATCTCTTACCAGAAGATTGTTGG - Intronic
961060588 3:123825255-123825277 ATCTATTAAGAAATGTTGGTAGG + Intronic
963204680 3:142620495-142620517 ATCTCTAAGCAAATGTTTATGGG + Intronic
963276359 3:143334350-143334372 ATATATTAGCAGATGGCTGTTGG + Intronic
963868259 3:150385886-150385908 AACTATAAGAAAGTGATTGTGGG + Intergenic
964133799 3:153320646-153320668 ATGTATTAGCAAACTATTCTAGG + Intergenic
965548358 3:169938190-169938212 ATCTATTAACATATAGTTGTGGG - Intronic
966324344 3:178737567-178737589 ATTATTTAGCAAATGGTTGTTGG - Intronic
967103718 3:186238345-186238367 ATCCATTTGCAAATGATGTTTGG + Intronic
967153738 3:186673791-186673813 ATCTATTTGTAAATGATTAGAGG - Intronic
967866267 3:194192561-194192583 ATCTATTGGCATTAGATTGTAGG - Intergenic
970272813 4:14365462-14365484 ATCTATGAGCAAATCAATGTGGG + Intergenic
970715996 4:18923699-18923721 ATCTATAAGGAAATGAATTTTGG - Intergenic
971560551 4:28074545-28074567 AGCTATTAGCAAGTGAGGGTTGG + Intergenic
971858036 4:32068432-32068454 GTCTATGATCAGATGATTGTAGG + Intergenic
972481969 4:39505333-39505355 ATATATTAGCAAATATTTGATGG - Exonic
972903428 4:43714070-43714092 AACTATGAGCAAAAGATTTTAGG + Intergenic
973140861 4:46766325-46766347 ATTTGTTAACAAATTATTGTAGG - Intronic
974060686 4:57032070-57032092 ATTTAAAAGAAAATGATTGTGGG - Intronic
974310712 4:60206104-60206126 ATCTATTAGTAAATAAATTTTGG - Intergenic
975389900 4:73803462-73803484 ATATATTAGCAAAGTATTTTTGG - Intergenic
976454288 4:85228397-85228419 ATATATTAGCAAAATATTTTTGG + Intergenic
976877691 4:89875186-89875208 ATCAGTAAGCATATGATTGTTGG - Intergenic
978057892 4:104295469-104295491 TTTTATTAGAAAAAGATTGTGGG - Intergenic
978953177 4:114585801-114585823 ATCTGTTAGCAAAGGGGTGTTGG + Intergenic
979972642 4:127156384-127156406 ATCTATCACTAAATGACTGTGGG - Intergenic
982058184 4:151574941-151574963 ATTTTTTAGCAAATTATTTTTGG + Intronic
982401525 4:154972964-154972986 ATTCAATAGCAAATGATTATAGG - Intergenic
982783553 4:159516423-159516445 ATTTATTAGCAAAAGATTGGAGG - Intergenic
983121577 4:163891923-163891945 ATATATTAGTTGATGATTGTGGG - Intronic
983921673 4:173352409-173352431 ATCTTTTATCAAATTATTGATGG - Intergenic
983997352 4:174199881-174199903 TCATATTAGCAAATGATTGATGG + Intergenic
984202563 4:176743988-176744010 ATCTAGTAACAAATGTTTCTGGG - Intronic
984450302 4:179891791-179891813 ATATATTAGCAAATTATTTTAGG - Intergenic
987554254 5:19426034-19426056 AAATTTTAGCAAATGCTTGTTGG - Intergenic
988359667 5:30219519-30219541 TTCTATTAACCAATGAATGTGGG + Intergenic
988445422 5:31280946-31280968 AATTAATAGCAAATGATTCTAGG - Intronic
989306269 5:39960214-39960236 ATATATTGGCAAATGCTTGATGG + Intergenic
989454909 5:41632442-41632464 ATTTATTATCAATTGATTTTTGG + Intergenic
990790047 5:59467255-59467277 TTCTATTAAAAAATGATTTTAGG + Intronic
990927257 5:61040667-61040689 ATTTATTAGCATATAACTGTGGG + Intronic
992313959 5:75533375-75533397 GTCAAATATCAAATGATTGTAGG + Intronic
992813957 5:80417835-80417857 ACCTAGTAGCACATGATTGCTGG + Intronic
995773348 5:115697348-115697370 AACTATTAACGAATGAATGTGGG - Intergenic
996663150 5:126027507-126027529 ATGTATTAGCAAAGTAATGTTGG - Intergenic
997043846 5:130289954-130289976 CTCTTTAAGCAAAAGATTGTTGG + Intergenic
998762286 5:145445854-145445876 AAATATTAGCAAATGCTGGTGGG + Intergenic
1001247957 5:170119377-170119399 ATCTATTTGCATATCTTTGTTGG - Intergenic
1003088437 6:3080733-3080755 ATGCATTACCAAATTATTGTGGG + Intronic
1005096214 6:22119620-22119642 ATATGTTAGCATATGATTTTAGG - Intergenic
1008354604 6:50537251-50537273 AGCTTTTTGCATATGATTGTTGG - Intergenic
1010577837 6:77554703-77554725 ATCTTTTAGAAAATAATTTTAGG + Intergenic
1014264094 6:119254724-119254746 ATCTTTTAGAAAATTCTTGTTGG - Intronic
1014286760 6:119507636-119507658 ATCTATTTGCACCTGAGTGTTGG - Intergenic
1015013254 6:128376847-128376869 ACGTATTAGCAAAAGATTGGTGG - Intronic
1015172837 6:130273175-130273197 ATATATTTACAAATGATGGTAGG + Intronic
1015574443 6:134656371-134656393 AACTATAAGAAAATGAATGTGGG + Intergenic
1018567762 6:165173836-165173858 ACCTATTTGCAAATGATAGCAGG + Intergenic
1019955913 7:4414335-4414357 ATCAATTAAAAACTGATTGTGGG + Intergenic
1020518386 7:9154806-9154828 ATCTGTGAGCACATGATTTTAGG + Intergenic
1020730971 7:11879644-11879666 AGCCAATAGCAAATGCTTGTGGG + Intergenic
1022971072 7:35517935-35517957 ATCTAATTGCAAATGAGAGTGGG - Intergenic
1023236190 7:38091264-38091286 ATCTATTAACAAATTATTTTTGG - Intergenic
1023259562 7:38345057-38345079 ATCTAATTGAAAATGATTCTGGG - Intergenic
1023260024 7:38349382-38349404 ATCTAATTGAAAATGATTCTGGG - Intergenic
1023261006 7:38358539-38358561 ATCTAATTGAAAATGATTCTGGG - Intergenic
1023459822 7:40384107-40384129 ATATATTGACACATGATTGTGGG + Intronic
1024482543 7:49879362-49879384 TTCTTTTAGCAAATGTTTGTAGG + Intronic
1027695919 7:81410428-81410450 ATCTATTATAAAATGATATTTGG + Intergenic
1027869973 7:83694619-83694641 ATCTAAGAGCAAAGGAATGTGGG + Intergenic
1027997460 7:85443095-85443117 ATCTAACAGCATATGATTGAAGG - Intergenic
1028804689 7:95011359-95011381 TTCTATGAGCTACTGATTGTAGG + Intronic
1030581594 7:111363162-111363184 ATTTATTATAAAATTATTGTTGG + Intronic
1031402818 7:121345760-121345782 ATTTAAAAGCAAATGATGGTTGG - Intergenic
1031669500 7:124525462-124525484 ATTTCATAGCAAATGATTGAAGG - Intergenic
1033061940 7:138118118-138118140 ATCTATAAGCAACTGATCTTGGG - Intergenic
1033876474 7:145825052-145825074 ATCTGTGAGCAAATGACTTTGGG - Intergenic
1034905804 7:154944825-154944847 ATCTATTAGAAAATTATTGTAGG - Exonic
1034929429 7:155149878-155149900 ATCTATTTGCAAATGAAGCTTGG - Intergenic
1035924910 8:3716960-3716982 ATTTTTTTGTAAATGATTGTAGG - Intronic
1035942807 8:3922733-3922755 ATTTATTAACCAATTATTGTAGG + Intronic
1038621130 8:29144185-29144207 TTTTCTTAGAAAATGATTGTAGG - Intronic
1041699271 8:60770147-60770169 ATAAATTAGCAAATAATTGGTGG + Intronic
1041794377 8:61730847-61730869 ATCAAGTAGAAAATGATTGAAGG - Intergenic
1042564648 8:70099794-70099816 GTCTATAAGTAAATGAGTGTGGG + Intergenic
1042670128 8:71252909-71252931 ATCAATTAACAAATGACTGGGGG + Intronic
1043963952 8:86450789-86450811 ATCTATAAGTAAATGAATGGTGG + Intronic
1044245350 8:89937853-89937875 ATTTATTAGGAGATGATTCTGGG - Intronic
1044504161 8:92998170-92998192 AACTCTTAGTAAATGTTTGTAGG + Intronic
1045072561 8:98524146-98524168 ATCTATGGTCAAATGATTTTCGG - Intronic
1045376987 8:101584241-101584263 AGTTATTAGCATATGATTATAGG + Intronic
1045900786 8:107277506-107277528 ATCTATTTTGAAATGGTTGTGGG - Intronic
1046592233 8:116220562-116220584 AGATGTTAGCAAAAGATTGTGGG - Intergenic
1047666364 8:127096148-127096170 AACAAATAGCAAATTATTGTGGG + Intergenic
1049391138 8:142372316-142372338 TTCTTTCAGCAAATGGTTGTGGG - Intronic
1050654656 9:7813752-7813774 ATCCACTAGCAAATTATTTTGGG - Intronic
1052085636 9:24262506-24262528 TTCTATTAGCATATTATTGCAGG + Intergenic
1052245034 9:26324091-26324113 ATCTATTACCTAATGACTGGAGG - Intergenic
1052507176 9:29370751-29370773 ACCTAATAGCACATAATTGTTGG - Intergenic
1054833391 9:69650545-69650567 ATCTGTTAGTGAATGGTTGTTGG + Intronic
1055269194 9:74536995-74537017 ATATATTACCAAGTGGTTGTAGG - Intronic
1058246401 9:102631709-102631731 ATATATTAGCAAAATATTTTTGG + Intergenic
1058436201 9:104965920-104965942 ATCTTTTATCAAATTAATGTTGG + Intergenic
1059094080 9:111393675-111393697 TTCTATCAGAAAATGATGGTAGG - Exonic
1060745802 9:126130175-126130197 AATTATTGGGAAATGATTGTTGG - Intergenic
1186030038 X:5358323-5358345 ATATATTAGTAAAAGATTATTGG + Intergenic
1186186072 X:7020885-7020907 GTCTATTAGCAATTGGATGTGGG + Intergenic
1187283550 X:17881535-17881557 AGCTATTAGCAAATGATAACAGG + Intergenic
1188565906 X:31526391-31526413 ATTTATTTGCAAGTGATTTTTGG - Intronic
1192778347 X:74268360-74268382 ATCCATTAACAACTGACTGTTGG - Intergenic
1194895513 X:99434751-99434773 ATTTACTACCAAATTATTGTAGG - Intergenic
1195917052 X:109946454-109946476 ATTCATTAGCAAAAGATTGTGGG + Intergenic
1196142799 X:112283668-112283690 CTCTATTTGGAAATGGTTGTGGG - Intergenic
1196416770 X:115479472-115479494 GACTATGAGCAAATGAATGTAGG + Intergenic
1196507528 X:116464902-116464924 TTCTATTAGTATGTGATTGTGGG + Intergenic
1196523124 X:116696956-116696978 TTCTATTAGTATGTGATTGTGGG + Intergenic
1197913542 X:131511860-131511882 GTATATTAGCAAATAATTTTTGG + Intergenic
1198752833 X:139952576-139952598 ATGTATTAAAAAAGGATTGTGGG - Intergenic
1200914530 Y:8559837-8559859 AGCTATCAGCAAAAGATGGTTGG - Intergenic