ID: 1165536778

View in Genome Browser
Species Human (GRCh38)
Location 19:36454398-36454420
Sequence TCAGGATTAGCTCGGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165536778 Original CRISPR TCAGGATTAGCTCGGCAGAG GGG Intronic
901869834 1:12131779-12131801 TGAGGACTAGCTGGGCACAGTGG - Intronic
901998372 1:13172309-13172331 TCAGGATTACCTGGGTGGAGTGG + Intergenic
902576130 1:17378890-17378912 TAAGGATTAGCTGGGCATGGTGG - Intronic
902873835 1:19329382-19329404 TCAGGACGAGCTGAGCAGAGGGG + Intergenic
903186622 1:21632938-21632960 TCAGGAATGGTTGGGCAGAGGGG + Intronic
903626634 1:24735383-24735405 TCAGGGTTCACTAGGCAGAGTGG + Intergenic
903701217 1:25249627-25249649 CCAGGATTTGCTGGGCACAGTGG - Intronic
905378231 1:37539796-37539818 TCAAAATTAGCTGGGCACAGAGG + Intronic
906171129 1:43726437-43726459 TTAAGATTAGCTGGGCATAGTGG - Intronic
906370627 1:45250373-45250395 TAAGAATTAGCTGGGCATAGTGG + Intronic
907312642 1:53547758-53547780 CCAGGCTTGGCTCAGCAGAGGGG - Intronic
909378963 1:74975040-74975062 TCATGATTGGCTGGGAAGAGAGG + Intergenic
912493613 1:110077101-110077123 TCAGGAGAAGCTTGGCTGAGTGG + Intergenic
912626060 1:111205051-111205073 TCAGGATTAGAAGGGGAGAGGGG - Intronic
913667705 1:121064289-121064311 TAAGGATTAGCTGGGCACGGTGG - Intergenic
913701950 1:121382754-121382776 CCAGGTTTAACTCAGCAGAGAGG - Exonic
914019397 1:143851421-143851443 TAAGGATTAGCTGGGCACGGTGG - Intergenic
914042507 1:144063223-144063245 CCAGGTTTAACTCAGCAGAGAGG - Intergenic
914135580 1:144897265-144897287 CCAGGTTTAACTCAGCAGAGAGG + Exonic
914657946 1:149759634-149759656 TAAGGATTAGCTGGGCACGGTGG - Intergenic
917454956 1:175178228-175178250 TCAGAACTTGCTCAGCAGAGTGG - Intronic
917589359 1:176460681-176460703 TCAGGAATTGCATGGCAGAGTGG - Intergenic
918516940 1:185373928-185373950 TCTGGACTAGCTCAGCATAGGGG - Intergenic
919631976 1:199968194-199968216 TAAGGGTTAGCTGGGCACAGAGG + Intergenic
919907153 1:202085872-202085894 GCAGGATTTGCTGTGCAGAGTGG + Intergenic
920275348 1:204800329-204800351 TCAGGCTCAGCTCTGGAGAGAGG + Intergenic
920489373 1:206401474-206401496 CCAGGTTTAACTCAGCAGAGAGG - Exonic
921149266 1:212386637-212386659 TCAGGGAAAGCTTGGCAGAGAGG - Intronic
922901107 1:229137398-229137420 TCCAGATTAGCTGGGCACAGTGG - Intergenic
923090539 1:230737183-230737205 TCAGTATAAACTAGGCAGAGAGG - Intergenic
1063837463 10:10031609-10031631 TCAGGATAGGCTGGGCACAGTGG + Intergenic
1066227672 10:33399993-33400015 TCAGAATAAGATTGGCAGAGTGG - Intergenic
1067158307 10:43801260-43801282 TCAGGAATAGATGGGGAGAGAGG + Intergenic
1067905831 10:50290002-50290024 TCAGGAGTAGCTCTGCAGTTTGG + Intergenic
1069538629 10:69275800-69275822 TCTGTATTAGCTGGGCACAGTGG + Intronic
1069791701 10:71026799-71026821 TCAGGAGTAGCCAGGCAGTGTGG - Intergenic
1071895436 10:90061345-90061367 TGAGGACTAGCTCTGCAGTGGGG + Intergenic
1072007695 10:91270210-91270232 TCAGGATGAGCTGGGAAAAGGGG - Intronic
1072594316 10:96856762-96856784 ACAGTATTAGCTGGGCACAGTGG - Intronic
1072780652 10:98249065-98249087 AAAGGATGAGCTGGGCAGAGTGG - Intronic
1074410933 10:113227928-113227950 TAAGGATTAGCTGGGCACAGTGG + Intergenic
1075563621 10:123486992-123487014 TAATGATTAGCTGGGCACAGTGG + Intergenic
1078672562 11:13377846-13377868 TATGAATTAGCTTGGCAGAGAGG - Intronic
1083047419 11:59749319-59749341 TGAAGATTTGCTCTGCAGAGGGG + Intronic
1084140967 11:67228877-67228899 TAAGAATTAGCTGGGCATAGTGG - Intronic
1086170288 11:83828238-83828260 TAAAAATTAGCTGGGCAGAGTGG + Intronic
1093424770 12:19016009-19016031 ACAGAATTAGCTGGGCATAGTGG + Intergenic
1097236258 12:57541985-57542007 TCAGGATTGGCCAGGCACAGTGG + Intronic
1104754583 12:131261213-131261235 TCAGAATGAGCCCGACAGAGAGG + Intergenic
1105028673 12:132867588-132867610 TCAGGAGTAGCTGAGCTGAGCGG + Intronic
1107062003 13:36169784-36169806 TAAGGAATAGCTAGGTAGAGGGG - Intronic
1108127603 13:47261402-47261424 TCAGGAGTAGCCAGGCAGGGTGG - Intergenic
1111299040 13:86322473-86322495 TTAGGATTGGCTCGGCAATGTGG + Intergenic
1113948931 13:114060495-114060517 CCAGGATTTGCTCGGCACCGTGG - Intronic
1115585086 14:34803091-34803113 TCAGGATAGGCTGGGCACAGTGG + Intronic
1119355457 14:74002552-74002574 TCTTGATTAGCTGGGCACAGTGG - Intronic
1121127033 14:91414717-91414739 TCAGGATGAGTTGGGCACAGAGG - Intronic
1122917970 14:104867513-104867535 TCAGGATGTGCTGGGCAGTGGGG + Intronic
1202926666 14_KI270724v1_random:31779-31801 TCGGGAGCAGCTGGGCAGAGCGG + Intergenic
1128276847 15:66360977-66360999 TAAGAATTAGCTGGGCATAGTGG + Intronic
1131288176 15:91080667-91080689 TCAGGTTTGGCTGGGCACAGTGG - Intergenic
1131530129 15:93183832-93183854 TCAGTATTAACTCTGCACAGAGG - Intergenic
1136426962 16:30175008-30175030 TCAGTATTAGCCAGGCACAGTGG - Intergenic
1136474897 16:30506748-30506770 TCAGGCTCAGCTCCACAGAGAGG - Exonic
1138668461 16:58593404-58593426 ACAGTATTAGCTAGGCATAGTGG + Intronic
1138802377 16:60048917-60048939 ACAGGAGTAGATAGGCAGAGAGG - Intergenic
1139505075 16:67394597-67394619 TCTGGCTTAGCTGGGCCGAGAGG - Exonic
1140052731 16:71497018-71497040 TAAAAATTAGCTGGGCAGAGTGG + Intronic
1140310732 16:73845962-73845984 TCTACATTAGCTGGGCAGAGTGG - Intergenic
1143097194 17:4484606-4484628 TCAATATTAGCTGGGCACAGTGG - Intronic
1146704266 17:34989127-34989149 TCAGGACTGGCTGGGCACAGTGG - Intronic
1147451269 17:40506211-40506233 TCAGGAGTGGCTGGGCACAGTGG - Intergenic
1147716461 17:42512055-42512077 TGAGGACTGGCTGGGCAGAGAGG + Intronic
1147862360 17:43530945-43530967 TCAGGAGTAGCTGGGGGGAGGGG + Intronic
1152366457 17:79859394-79859416 TCAGCATTAGCTGGGCATGGGGG + Intergenic
1156898276 18:42271552-42271574 TCAGGATTAGCATGGGACAGAGG - Intergenic
1157420092 18:47540271-47540293 TTAGGATTATCTTGGCAGTGCGG + Intergenic
1157643287 18:49240216-49240238 TCAGGATGAGATAGGTAGAGTGG - Intronic
1157688024 18:49658651-49658673 TCAGGATCAGCTAGGCAGGGTGG + Intergenic
1163869576 19:19808408-19808430 TAATGATTGGCTGGGCAGAGTGG - Intronic
1165536778 19:36454398-36454420 TCAGGATTAGCTCGGCAGAGGGG + Intronic
941448272 2:165628434-165628456 TCAGTATTGGCTGGGCACAGTGG + Intronic
943889366 2:193266926-193266948 TCTGGAGTAGCTGGCCAGAGGGG + Intergenic
946224811 2:218258754-218258776 TAAAGATTAGCTGGGCACAGTGG - Intergenic
1171370075 20:24656750-24656772 TCAGGCTTAGCTTGCCTGAGAGG - Intronic
1175159227 20:56995566-56995588 TCGCCACTAGCTCGGCAGAGGGG + Intergenic
1175276069 20:57771692-57771714 TAAAAATTAGCTGGGCAGAGTGG + Intergenic
1178483659 21:33003216-33003238 TCAGGAGCAGCTGGGCACAGTGG + Intergenic
1180642602 22:17311148-17311170 TCAGGATCGGCTGGGCACAGTGG + Intergenic
1181051255 22:20239261-20239283 GCAGGCTGAGCTCAGCAGAGGGG - Intergenic
1181276800 22:21692439-21692461 TCAGGATTGGCCAGGCACAGTGG - Intronic
1182291147 22:29280824-29280846 ACAAAATTAGCTGGGCAGAGTGG - Intronic
1183919992 22:41158160-41158182 ACAGGAATAGCTGGGCAGGGTGG - Intronic
949461800 3:4302624-4302646 TCAGGTTAACCTTGGCAGAGAGG + Intronic
949513903 3:4789903-4789925 TCAGGATTGGCTGGGCGCAGTGG - Intronic
950508325 3:13410147-13410169 TCAGTAATAGCTGGGCACAGTGG - Intronic
956200343 3:66699021-66699043 CCAGGATTAGCTGGGCATGGTGG + Intergenic
958039465 3:88208476-88208498 TCAGAATTGGCTGGGCACAGTGG - Intergenic
960704748 3:120471060-120471082 CCAGGATTTGCTTGGCAAAGAGG - Intergenic
961573070 3:127814171-127814193 TCAGCATTAGCCCGGGAGAGAGG + Intronic
962012140 3:131402200-131402222 ACAGGAGTTGCCCGGCAGAGTGG - Intergenic
964320656 3:155493538-155493560 TCAGAATTAGCTGGGCATAGTGG - Intronic
968182998 3:196610924-196610946 TAAGAATTAGCTGGGCATAGTGG + Intergenic
973224806 4:47771231-47771253 TCAGGACTACATCAGCAGAGTGG + Intronic
975316790 4:72963272-72963294 TCAGGATAGGCTGGGCACAGTGG + Intergenic
979845223 4:125500853-125500875 TCAATATTCGCTCTGCAGAGGGG - Intergenic
981464949 4:145057354-145057376 TCAGGATTATCTAGGCAGATAGG - Intronic
984459242 4:180012023-180012045 TCAAGAGTAGCTGGGCAGATTGG - Intergenic
988200100 5:28056115-28056137 TCAGGATGAGCTGGAAAGAGTGG + Intergenic
988292421 5:29305613-29305635 ACAGAATTAGCTAGGCAGAATGG - Intergenic
988799780 5:34685445-34685467 TCAGGACTAGGTTGGGAGAGAGG + Intronic
990867713 5:60398464-60398486 TCAGGAGTAGCCCAGCTGAGAGG + Intronic
992133352 5:73718029-73718051 TCAGAATTAGCTGGGCATGGTGG - Intronic
993635906 5:90343478-90343500 TAAGGATCAGCTAGGCAAAGAGG + Intergenic
998197748 5:140090071-140090093 CCAGGATTGGCTGGGCACAGTGG - Intergenic
998248560 5:140532818-140532840 TCATGATTAGCTGGGCATGGTGG + Intronic
998815635 5:146011340-146011362 TTAGGATTGACTCGGCAGTGTGG + Intronic
1000523142 5:162321913-162321935 TCAGGATTTGCTAGGCAGGCTGG - Intergenic
1012709582 6:102582151-102582173 TCAGGATTAGTTGAGGAGAGGGG - Intergenic
1013274767 6:108573538-108573560 TAAGAATTAGCTGGGCACAGTGG + Intronic
1015674704 6:135732267-135732289 TCAGGATTAGATCAAGAGAGAGG - Intergenic
1017750921 6:157489909-157489931 AAAGGATTAGCTGGGAAGAGTGG + Intronic
1020844197 7:13261858-13261880 ACAAAATTAGCTCGGCATAGTGG - Intergenic
1021967217 7:25932305-25932327 TCAGGATTACAGCTGCAGAGTGG + Intergenic
1024033439 7:45484865-45484887 TCAGGATAAACTCTGCAGGGTGG - Intergenic
1024270273 7:47636426-47636448 TCTGGATTAACTGCGCAGAGTGG + Intergenic
1026451651 7:70534577-70534599 ACAGAATTAGCTGGGCATAGTGG - Intronic
1027163209 7:75817151-75817173 TCATGATGAGCTGGGCACAGTGG - Intronic
1027217623 7:76194167-76194189 TCTGGATGGGCTAGGCAGAGGGG + Intergenic
1028870331 7:95764537-95764559 TAAAAATTAGCTGGGCAGAGTGG - Intergenic
1031980958 7:128123960-128123982 TCAGTATTAGCTGGGCATGGTGG - Intergenic
1033073270 7:138224174-138224196 AAAGAATTAGCTCGGCATAGTGG + Intergenic
1035074127 7:156167185-156167207 TCAGGATCCGCACTGCAGAGCGG - Intergenic
1037616672 8:20525450-20525472 TCAGAATTAGCCTGGCATAGTGG - Intergenic
1040336564 8:46419003-46419025 TCAGGTTGAGGTGGGCAGAGGGG + Intergenic
1043890911 8:85651865-85651887 TTAGGATTATCTTGGCAGTGGGG + Intergenic
1043893578 8:85718638-85718660 TTAGGATTATCTTGGCAGTGGGG - Intergenic
1043896259 8:85740087-85740109 TTAGGATTATCTTGGCAGTGGGG - Intergenic
1043898743 8:85760088-85760110 TTAGGATTATCTTGGCAGTGGGG + Intergenic
1043900356 8:85772282-85772304 TTAGGATTATCTTGGCAGTGGGG + Intergenic
1043902318 8:85787557-85787579 TTAGGATTATCTTGGCAGTGGGG + Intergenic
1043903928 8:85799750-85799772 TTAGGATTATCTTGGCAGTGGGG + Intergenic
1043905540 8:85811944-85811966 TTAGGATTATCTTGGCAGTGGGG + Intergenic
1043907148 8:85824131-85824153 TTAGGATTATCTTGGCAGTGGGG + Intergenic
1046195571 8:110859697-110859719 ACAGAAATAGCTGGGCAGAGTGG - Intergenic
1046757643 8:117988572-117988594 TCAGGATCGGCCGGGCAGAGAGG + Intronic
1047767931 8:128004460-128004482 TCAGGACTCTCTCGGCAGAGAGG - Intergenic
1048204430 8:132403962-132403984 TCAGGATGAGCCCTGGAGAGAGG - Intronic
1049844178 8:144792152-144792174 TCACGATTAGCGCGGCCGGGCGG + Intronic
1049987941 9:969978-970000 CCAGGTTTGGCTCGGCAGAGCGG + Intergenic
1050600933 9:7249747-7249769 TCAGTATGAGCTGGGCACAGCGG - Intergenic
1050932875 9:11351779-11351801 TCAGCGTTAGCAAGGCAGAGTGG + Intergenic
1056404083 9:86257762-86257784 TCAGACTTAGCTCCTCAGAGAGG + Intronic
1057590496 9:96369050-96369072 TCAGGTTTAGCTGGGCACAGTGG - Intronic
1058580061 9:106446220-106446242 TCAGGATAGGCTGGGCACAGTGG + Intergenic
1059183579 9:112244012-112244034 TCAGGAATAGCAGGGCACAGTGG + Intronic
1061084644 9:128391947-128391969 TCAGGAGTTGCTTGGGAGAGGGG - Exonic
1192851237 X:74958363-74958385 TCTGGTTTAGCTGGGGAGAGGGG + Intergenic
1192999802 X:76551767-76551789 TCAGGCTTGGCTTGGCACAGTGG - Intergenic
1195435024 X:104833290-104833312 TCAAAATTAGCCAGGCAGAGTGG - Intronic
1200986190 Y:9305041-9305063 TAAGGATTAGGTCCTCAGAGAGG + Intergenic
1202124392 Y:21555860-21555882 TAAGGATTAGGTCCTCAGAGAGG - Intergenic
1202154616 Y:21873520-21873542 TAAGGATTAGGTCCTCAGAGAGG + Intergenic
1202394442 Y:24408491-24408513 TTAGGATTGGCTTGGCAGTGCGG + Intergenic
1202476342 Y:25261601-25261623 TTAGGATTGGCTTGGCAGTGCGG - Intergenic