ID: 1165541640

View in Genome Browser
Species Human (GRCh38)
Location 19:36496995-36497017
Sequence CTCAGGAGGTTGTAAGTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165541628_1165541640 29 Left 1165541628 19:36496943-36496965 CCCATGTTTTGTGGGCTGGTTGG 0: 1
1: 4
2: 1
3: 18
4: 134
Right 1165541640 19:36496995-36497017 CTCAGGAGGTTGTAAGTCATTGG 0: 1
1: 0
2: 0
3: 10
4: 122
1165541630_1165541640 28 Left 1165541630 19:36496944-36496966 CCATGTTTTGTGGGCTGGTTGGG No data
Right 1165541640 19:36496995-36497017 CTCAGGAGGTTGTAAGTCATTGG 0: 1
1: 0
2: 0
3: 10
4: 122
1165541627_1165541640 30 Left 1165541627 19:36496942-36496964 CCCCATGTTTTGTGGGCTGGTTG 0: 1
1: 5
2: 1
3: 15
4: 165
Right 1165541640 19:36496995-36497017 CTCAGGAGGTTGTAAGTCATTGG 0: 1
1: 0
2: 0
3: 10
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165541640 Original CRISPR CTCAGGAGGTTGTAAGTCAT TGG Intergenic
901330640 1:8405190-8405212 CTCAGGAGGATGCAAGGCACTGG + Intronic
905401835 1:37709189-37709211 TTCTGGAGGTTTTATGTCATTGG + Exonic
906652816 1:47525110-47525132 CTCAGGAGGTGGTGAGTTCTTGG + Intergenic
907021493 1:51070718-51070740 CTTAGGAGGATAAAAGTCATGGG - Intergenic
909470131 1:76018356-76018378 GTCAGGAGTTTGTAAGTTGTAGG - Intergenic
911983216 1:104592271-104592293 CTCTGGAGGTCATAAGCCATAGG + Intergenic
916462428 1:165040425-165040447 TTCTGGATGCTGTAAGTCATGGG - Intergenic
918710451 1:187721291-187721313 AGCAGAAGGTTCTAAGTCATTGG + Intergenic
919157360 1:193783494-193783516 TTCTGGAGGTTGTAAGGAATAGG + Intergenic
919993949 1:202730401-202730423 CTCAGGAGCCTGTAGGTCACAGG - Intronic
920692462 1:208157554-208157576 CTCAGGATGTTGTAAGTGAGGGG + Intronic
921556698 1:216607156-216607178 CTCAGGAGTCTGAATGTCATTGG - Intronic
923680494 1:236114617-236114639 CTCAGGAGGTGCTCAGTCAGTGG - Intergenic
1064602059 10:17004162-17004184 GTAAGGAGGCTGGAAGTCATTGG - Intronic
1064875167 10:19985824-19985846 CTAAGGAGGTGGAAAGTCACTGG - Intronic
1069411233 10:68155443-68155465 CTGAGGAGGTTGTAGATCTTTGG + Intronic
1071883203 10:89921765-89921787 CTGAGTAGCTTGTAAGTCTTTGG + Intergenic
1073192785 10:101663703-101663725 CTCAGGAGGTTGTATCTCTGAGG + Intronic
1073716472 10:106114132-106114154 CCCAGTAGATTCTAAGTCATTGG - Intergenic
1075776062 10:124989600-124989622 GTCGGGAGGTTGTGAGTCACTGG + Exonic
1077907689 11:6546775-6546797 TTCATCAGCTTGTAAGTCATAGG - Exonic
1079303768 11:19304388-19304410 CTCAGGAAGCTGACAGTCATGGG + Intergenic
1081485385 11:43523163-43523185 GTCGGGAGGTTGTGAGTCACTGG - Intergenic
1084672686 11:70616504-70616526 CTCAGGAGGCTGAAAGTCCAGGG + Intronic
1084691718 11:70731302-70731324 TTCTGGAGGCTGGAAGTCATAGG - Intronic
1085236852 11:75021890-75021912 CTTAAGATGTTGCAAGTCATCGG + Intergenic
1087539450 11:99496754-99496776 CTCAAGAGGTGGTAAGTAACTGG + Intronic
1087713032 11:101576495-101576517 CTCAAGAGGCTTTAAGCCATTGG - Intronic
1092174421 12:6393477-6393499 CTCTGGAGGCTGGAAGTCAGAGG + Intergenic
1096449587 12:51727141-51727163 TTTAGGAGGTTGGAAGTCAGTGG + Intronic
1108551662 13:51551992-51552014 CTCAAGAATTTGTTAGTCATTGG - Intergenic
1109411660 13:61978320-61978342 TTCTGGAGGTTGTAAGTCTAAGG + Intergenic
1112185508 13:97124452-97124474 CTCAGGAGCTTGTAAGGAAAAGG - Intergenic
1116117837 14:40679859-40679881 TTCAGGAGGTTGTAAGTAACTGG + Intergenic
1119286981 14:73463142-73463164 CTCATGAGGTTCCAAGTGATTGG - Intronic
1120718885 14:87869270-87869292 CTCAGGTAGTTGAAAGACATGGG - Intronic
1122763712 14:104050125-104050147 CTCTGGAGGCTGGAAGTCCTAGG + Intronic
1122901740 14:104784854-104784876 CTCAGGAGGTGGTCAGTCCCGGG - Intronic
1202869569 14_GL000225v1_random:148119-148141 GTCGGGAGGTTGTGAGTCAATGG - Intergenic
1125518742 15:40336887-40336909 CTCAGGAAGCTGTCAGTCCTCGG + Intronic
1129604902 15:77020070-77020092 CTCAGGGGATTGTGAGTCACAGG + Intronic
1130940794 15:88507269-88507291 ATGAGGATGTTTTAAGTCATGGG - Intergenic
1131739048 15:95366907-95366929 CTCATGAGGTTGTAAGTGAATGG - Intergenic
1140724236 16:77797724-77797746 CCCAGGAGCTTGGAGGTCATCGG - Intronic
1141222440 16:82083729-82083751 CTCAGGAGCTAGTAAGTGACGGG - Intronic
1144688015 17:17238944-17238966 CTGAGGAGGTAGTAAGTTACAGG + Intergenic
1147895707 17:43750010-43750032 CTCAGGAAGTTGTCAGGCAGGGG + Intergenic
1149916914 17:60618216-60618238 CTCAGGAGGCTGTGAGGCAGGGG - Intronic
1150313423 17:64148278-64148300 CCCAGGTGGTTGTACCTCATTGG + Exonic
1151040154 17:70850169-70850191 TTCAGGATATTGTATGTCATAGG + Intergenic
1154244371 18:12682727-12682749 CTCAGGAGGCTGAGAATCATTGG - Intronic
1154247671 18:12714051-12714073 CTCAAGAATTTGTTAGTCATTGG + Intronic
1158669843 18:59464813-59464835 CTCAGGAGGTGGTGATTCTTGGG - Intronic
1160232572 18:77058964-77058986 CTCAGGGGGTTGTAAGTTGGTGG - Intronic
1165541640 19:36496995-36497017 CTCAGGAGGTTGTAAGTCATTGG + Intergenic
1167033874 19:46981618-46981640 CTCAGGAGCTTGGAAATCAATGG - Intronic
926353551 2:12019497-12019519 CTATGGAGGTGGTAAGTCACAGG + Intergenic
937289155 2:120771609-120771631 GTCGGGAGGCTGTGAGTCATTGG + Intronic
939234239 2:139470431-139470453 TGCAGGAGGTTGTGAATCATTGG + Intergenic
940600021 2:155847006-155847028 CTCAGGTAGTTGTAAGTATTTGG + Intergenic
941981903 2:171467584-171467606 CTTAGGAGGTTGTAATACTTAGG + Intronic
1169713924 20:8594416-8594438 CTCATGTGCTTGCAAGTCATTGG + Intronic
1173849028 20:46206229-46206251 TTCAGGAAGTGGTGAGTCATGGG + Intronic
1174330204 20:49812002-49812024 CTCTGGAGATTGGAAGCCATTGG + Intergenic
951215307 3:20019150-20019172 CTCAGGAGGTTGAAAGTGGGAGG - Intergenic
953467113 3:43131791-43131813 ATCAGTAGTTTCTAAGTCATGGG - Intergenic
955448460 3:59039763-59039785 GTAATGAGGTTGTAACTCATAGG - Intronic
956408867 3:68957844-68957866 CTCAGGAGAATGGATGTCATGGG - Intergenic
958965259 3:100551324-100551346 CTTAGGAGGTTGTAAGTGGTAGG + Intronic
959915399 3:111811132-111811154 CTCAGGAGGATTTAAGTAACTGG + Intronic
960549145 3:118954202-118954224 ATCAGGTGGTTGTAAGTATTTGG + Intronic
960962256 3:123080285-123080307 CTCAGGAGATTTTGAGTCCTTGG + Intronic
963460021 3:145600200-145600222 TACAGGATGTTGGAAGTCATTGG - Intergenic
964770954 3:160224635-160224657 CTAAGGAGGTTACAAGTGATTGG - Intergenic
967708481 3:192679488-192679510 CTCAGGAGGTGGGAGGTCAGAGG + Intronic
970123733 4:12786371-12786393 ATCAGGTAGTTGTAGGTCATGGG - Intergenic
975967688 4:79994590-79994612 CTCAGGAGGATGTAATTCTCAGG - Intronic
977805353 4:101291325-101291347 CTCCTTAGGTTGCAAGTCATAGG - Intronic
978524861 4:109655028-109655050 CACAGGAGGCTGTAAATCAGGGG + Intronic
979838431 4:125404705-125404727 ATCAGGAGCTTATAAGCCATGGG - Intronic
981271438 4:142850734-142850756 TTCAGGAGGCTGTAAGTCAAAGG + Intergenic
981946918 4:150358299-150358321 CTTAGGAGGTTATTAGTCCTGGG - Intronic
982503826 4:156193838-156193860 CTCAGCAGGTTTGAAATCATGGG - Intergenic
984040165 4:174722588-174722610 CACAGGAGGATGAAAGTAATGGG - Intronic
984595585 4:181663766-181663788 CTCAGGAAGAAGTAAGTCATGGG - Intergenic
985037364 4:185854153-185854175 CTCTGGAGGTGGTGAGTGATGGG + Intronic
986212096 5:5683520-5683542 CTCATGATTTTGTAAGTGATCGG - Intergenic
991206678 5:64057974-64057996 GTCAGGAGTTTCTAACTCATAGG - Intergenic
994336887 5:98577156-98577178 GTCGGGAGGTTGTGAGTCACTGG - Intergenic
998500842 5:142631281-142631303 CTCAGGAGGATGTTGGTGATAGG - Intronic
999517770 5:152318253-152318275 CTCAGAAGTTTGAAAGTCAAGGG + Intergenic
1005909345 6:30294497-30294519 CCCAGCAGGTTGCCAGTCATGGG - Intergenic
1006409382 6:33863498-33863520 CACAGGAGGATGTAAGTCCACGG - Intergenic
1008206660 6:48668296-48668318 CTAAGGAAATTGAAAGTCATGGG + Intergenic
1011809778 6:91117714-91117736 CTCAGGAAGTTGTGAGTAAATGG - Intergenic
1012307036 6:97671592-97671614 CTCAGGAATATGTAAGTAATAGG + Intergenic
1018390046 6:163335290-163335312 GTCTGGAGGCTGGAAGTCATAGG - Intergenic
1021873242 7:25024637-25024659 ATCAGTTGGTTGTAAGTAATTGG + Intergenic
1026160855 7:67867600-67867622 CTCAGGAGGTGGAACCTCATGGG - Intergenic
1028703929 7:93815790-93815812 CTCAGGAGGCTGAAAGGCAGGGG + Intronic
1029922776 7:104283314-104283336 ATGAGGAGGTTGTCAGTGATAGG - Intergenic
1030597585 7:111558572-111558594 CTCTGGAGGTTGTCATTCTTAGG - Intronic
1032210197 7:129906750-129906772 GTCAGGAGGGTGTATCTCATTGG - Intronic
1036038238 8:5043597-5043619 CTCAGGTTGTTGCAAGTCTTTGG - Intergenic
1038177739 8:25196279-25196301 TTTAGGAGGTTCTGAGTCATTGG + Intronic
1038708229 8:29916492-29916514 CTCAGGAGGTTGTATGTTTCCGG - Intergenic
1039130188 8:34255023-34255045 CCCAGGAGGTTCTCATTCATAGG + Intergenic
1040675598 8:49745743-49745765 CTCTGGAAGTTGAAAGACATGGG - Intergenic
1044329431 8:90899150-90899172 CTAAGGATGGTGTAAGTCAGGGG - Intronic
1048448473 8:134510834-134510856 CTTAGGAGGTTGTGAGCCCTGGG - Intronic
1049029472 8:140023730-140023752 CTCAGGTGGTCGTAAGTGAATGG - Intronic
1051853407 9:21535515-21535537 GTCAGGAGACTGTAAGTCCTGGG + Intergenic
1051960530 9:22756508-22756530 CTCAAGAGGTGGAAAGTCAAGGG + Intergenic
1053507035 9:38651869-38651891 CCCAGGAGATTCTAAGTCAGTGG + Intergenic
1055009394 9:71547803-71547825 ATCAGCAGGTTTTAAGTCATTGG - Intergenic
1056614211 9:88149128-88149150 CTCAGGAAGTTTACAGTCATGGG - Intergenic
1058360152 9:104136093-104136115 TTCAGGAGGTTTTAATTAATTGG - Intronic
1059061202 9:111037553-111037575 AACAGGAGGTTGTAAGGCAAGGG - Intronic
1203735305 Un_GL000216v2:133022-133044 GTCGGGAGGTTGTGAGTCACTGG + Intergenic
1188426957 X:30059759-30059781 CTGATGAGGTTGAATGTCATTGG - Intergenic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1192951999 X:76026792-76026814 CTCACCAGGTTGGATGTCATGGG - Intergenic
1194091618 X:89585706-89585728 CTCAGATGGTGGTAAGTCAGAGG - Intergenic
1194341285 X:92709233-92709255 TTCATGAGGTTGTAAGACATAGG - Intergenic
1194569039 X:95530577-95530599 CTTAGGAGGGTGTAGGTCATCGG + Intergenic
1196381251 X:115092190-115092212 CTCAGGAGGCTCATAGTCATTGG - Intergenic
1197120467 X:122884980-122885002 ATCAGTTGGTTGTAAGTCTTTGG - Intergenic
1197346697 X:125332885-125332907 CTCTGGAGGTTGTAAGTTCCTGG - Intergenic
1199329677 X:146544048-146544070 CTCAGGAAGCTGTCAATCATGGG + Intergenic
1200444254 Y:3241768-3241790 CTCAGATGGTGGTAAGTCAGAGG - Intergenic
1200649636 Y:5825946-5825968 TTCATGAGGTTGTAAGACATAGG - Intergenic
1201892338 Y:18956236-18956258 CTCAGGAGATGGTAAATCAAGGG + Intergenic
1202625712 Y:56855385-56855407 GTCGGGAGGTTGTGAGTCACTGG - Intergenic