ID: 1165547851

View in Genome Browser
Species Human (GRCh38)
Location 19:36556678-36556700
Sequence TGGCAGATGGGGCAGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1274
Summary {0: 1, 1: 1, 2: 13, 3: 117, 4: 1142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165547851_1165547858 7 Left 1165547851 19:36556678-36556700 CCTGGCTGCTGCCCCATCTGCCA 0: 1
1: 1
2: 13
3: 117
4: 1142
Right 1165547858 19:36556708-36556730 AGCACTCAGCTCCTAAAGCAGGG 0: 1
1: 1
2: 8
3: 24
4: 262
1165547851_1165547857 6 Left 1165547851 19:36556678-36556700 CCTGGCTGCTGCCCCATCTGCCA 0: 1
1: 1
2: 13
3: 117
4: 1142
Right 1165547857 19:36556707-36556729 AAGCACTCAGCTCCTAAAGCAGG 0: 3
1: 3
2: 7
3: 16
4: 144
1165547851_1165547859 8 Left 1165547851 19:36556678-36556700 CCTGGCTGCTGCCCCATCTGCCA 0: 1
1: 1
2: 13
3: 117
4: 1142
Right 1165547859 19:36556709-36556731 GCACTCAGCTCCTAAAGCAGGGG 0: 1
1: 2
2: 3
3: 25
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165547851 Original CRISPR TGGCAGATGGGGCAGCAGCC AGG (reversed) Intronic
900096940 1:943646-943668 TGGAGGATGGAGCAGCACCCGGG + Intronic
900381174 1:2384870-2384892 TGGCACATGGAGAAGCTGCCAGG + Intronic
900437653 1:2639247-2639269 TGGTAGAGGGGGCAGCCCCCTGG + Intronic
900503643 1:3018560-3018582 TGGAGGCTGGGGAAGCAGCCGGG + Intergenic
900562049 1:3312074-3312096 TGTCGCATGGGGGAGCAGCCGGG - Intronic
900668113 1:3829610-3829632 TGGCAGAAAGTGGAGCAGCCGGG + Intronic
900977403 1:6026143-6026165 GGCCAGATGGGGCAGGAGACAGG - Intronic
901308726 1:8252466-8252488 AGGCAGCGGGAGCAGCAGCCAGG + Intergenic
901512418 1:9724141-9724163 AGGCAGAGGGGCCAGCAGGCTGG - Intronic
901691503 1:10976295-10976317 AGGTAGATGAGGCAGCAGCTGGG - Intronic
901791496 1:11655548-11655570 GGGCAGAGGGGGAAGAAGCCCGG - Exonic
901807963 1:11749726-11749748 TGGCACAGGGGCCAGGAGCCTGG + Intronic
901970323 1:12902920-12902942 TCTCAGATGGGGCGGCTGCCAGG - Intronic
902027517 1:13394962-13394984 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
902141605 1:14361425-14361447 TGGAAGAGGGGGCTGAAGCCAGG - Intergenic
902412295 1:16218475-16218497 TGGCAGAAGTGGCAGCTGGCAGG - Intergenic
902510837 1:16966163-16966185 GGGCAGTTGAGGCAGGAGCCGGG + Intronic
902832920 1:19029295-19029317 CCGGAGATGGGGCAGCAGGCGGG + Intergenic
902983482 1:20141652-20141674 GGGCAGATGGGGAGGCAGCCAGG + Intronic
903100358 1:21024057-21024079 TCTCAGACGGGGCAGCTGCCGGG - Intronic
903148042 1:21387823-21387845 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
903359115 1:22765888-22765910 GGGCAGAGGGGACAGAAGCCAGG + Intronic
903526376 1:23994503-23994525 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
903633922 1:24799448-24799470 TCTCAGACGGGGCAGCTGCCGGG - Intronic
903775601 1:25791541-25791563 AAACAGAGGGGGCAGCAGCCTGG - Intergenic
903923541 1:26817909-26817931 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
904267008 1:29323923-29323945 TGGCTGGTTGGGCAGCATCCTGG - Intronic
904297743 1:29532656-29532678 TGGCAGAGGGAGCATCAGGCAGG - Intergenic
904479980 1:30787576-30787598 TGGCAGAGGGGTCAGGAGTCAGG - Intergenic
904689080 1:32280350-32280372 TGGGAGATGTGGCATCTGCCTGG - Intronic
904761088 1:32804818-32804840 TCCCAGATGGGGTGGCAGCCAGG + Intronic
904794943 1:33051779-33051801 TCTCAGACGGGGCAGCTGCCGGG - Intronic
904930384 1:34082429-34082451 TCTCAGATGGGGCGGCTGCCAGG - Intronic
905040003 1:34948066-34948088 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
905268114 1:36768962-36768984 TGGCACACCGGGCAGCTGCCAGG - Intergenic
905330048 1:37188263-37188285 TGGCAGGTGAGGGACCAGCCAGG - Intergenic
905599159 1:39234702-39234724 TCCCAGATGGGGCGGCTGCCGGG + Intronic
905673453 1:39808292-39808314 TGGCAGACGGGGTGGCTGCCGGG - Intergenic
905699334 1:39999842-39999864 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
906068971 1:43003631-43003653 TGGTGGAAGGGGCAGCAGCCAGG + Intergenic
906107810 1:43305202-43305224 TGGAAGGTGGGTCAGCGGCCTGG - Intronic
906247895 1:44289909-44289931 TGGCAGACAGGCCAACAGCCAGG + Intronic
906423976 1:45693942-45693964 TCCCAGACGGGGCAGCAGCTGGG - Exonic
906473829 1:46153504-46153526 CAGCAGAGGTGGCAGCAGCCAGG - Intronic
906486774 1:46240940-46240962 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
906486785 1:46240980-46241002 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
906738866 1:48161118-48161140 TGGGAGGTGGCGCAGGAGCCTGG + Intergenic
906946877 1:50301913-50301935 TGGCAGATAGGCCAGGAGCCAGG + Intergenic
907309722 1:53532299-53532321 TGGCAGATGGAGCACAGGCCAGG + Intronic
907373597 1:54018302-54018324 TGGCAGATGAGGGAATAGCCTGG - Intergenic
907402456 1:54233379-54233401 TCTCAGACGGGGCAGCTGCCGGG - Intronic
907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG + Intronic
907702443 1:56802145-56802167 TTCCAGATGGGGAAGAAGCCAGG - Intronic
908370314 1:63473540-63473562 TCCCAGATGGGGCAGCTGGCCGG - Intronic
909603729 1:77487752-77487774 TGGCAGAGGAGGGAGAAGCCTGG - Intronic
910343778 1:86215901-86215923 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
910815726 1:91289098-91289120 TCCCAGATGGGGCGGCTGCCAGG + Intronic
911533996 1:99078689-99078711 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
911598497 1:99823365-99823387 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
911737396 1:101353047-101353069 TGGCAGTGGAGGCAGCAGTCTGG - Intergenic
912298521 1:108490026-108490048 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
912316966 1:108675789-108675811 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
912474643 1:109927860-109927882 TAGAAGATGGGGCAGCAGGCTGG + Intronic
912825362 1:112898853-112898875 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
912844782 1:113069252-113069274 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
913114685 1:115685195-115685217 TGGCAGGTTGGGCCGCAGCAGGG + Intronic
913306217 1:117430406-117430428 TCTCAGACGGGGCAGCTGCCGGG + Intronic
913351142 1:117861030-117861052 TGGCAGATGGGAAAACAGCATGG - Intergenic
914374576 1:147061926-147061948 TCCCAGATGGGGTTGCAGCCAGG - Intergenic
914374617 1:147062083-147062105 TCCCAGACGGGGCAGCTGCCAGG - Intergenic
914392168 1:147233218-147233240 TCTCAGATGGGGCAGTTGCCAGG - Intronic
914775275 1:150729183-150729205 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
914893842 1:151651438-151651460 TCCCAGATGGGGCGGCTGCCGGG + Intronic
914965810 1:152256359-152256381 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
914987352 1:152472130-152472152 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
915221597 1:154379464-154379486 TGCCAGATGGGGCAGAAGCCTGG + Intergenic
915221615 1:154379543-154379565 TCCCAGATGGGGCAGCAGCCAGG + Intergenic
915221692 1:154379897-154379919 TCCCAGATGGGGCAGGAGCCAGG + Intergenic
915221709 1:154379976-154379998 TCCCAGATGGGGCAGGAGCCAGG + Intergenic
915221737 1:154380094-154380116 TCCCAGATGGGGCGGCAGCCAGG + Intergenic
915458436 1:156055057-156055079 CGGCAGAGGGGGCAGCGGCTGGG + Intronic
915604645 1:156942821-156942843 TGGCAGGTGTGACTGCAGCCTGG + Intronic
915861621 1:159450073-159450095 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
915981375 1:160422100-160422122 TGGGAGATGGGGCGGAGGCCAGG - Intronic
915992608 1:160532168-160532190 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
916087578 1:161281972-161281994 TCCCAGATGGGGTGGCAGCCAGG + Intronic
916106359 1:161435488-161435510 GAGCAGATTGCGCAGCAGCCTGG + Intergenic
916320497 1:163499002-163499024 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
916800016 1:168207844-168207866 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
917258574 1:173142279-173142301 TGGCAGAGGCTGCAGCAGCAAGG + Intergenic
917304617 1:173613390-173613412 TCCCAGACGGGGCAGCTGCCAGG - Intronic
917376094 1:174350287-174350309 TCTCAGACGGGGCAGCTGCCGGG + Intronic
917456769 1:175192682-175192704 TGTCAGACGGGGCAGCAACCAGG - Exonic
917553229 1:176057745-176057767 TCCCAGATGGGGTGGCAGCCGGG - Intronic
918812483 1:189139811-189139833 TCCCGGATGGGGCAGCTGCCGGG + Intergenic
918906217 1:190499105-190499127 AGGAAGATGGAGCAGCAGCAAGG + Intergenic
920065525 1:203266764-203266786 TCCCAGATGGGGCGGCTGCCGGG + Intronic
920143901 1:203841836-203841858 TCGCAGACGGGGCGGCTGCCGGG + Intronic
920226572 1:204443422-204443444 TTGCAGATGGGGCTGCCTCCCGG + Exonic
920997478 1:211009386-211009408 AGGAAAATGGGGCAGCAGCTGGG + Intronic
921043945 1:211460526-211460548 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
921050603 1:211508742-211508764 TGGCAGATGGGGCAGGCTCCTGG - Intergenic
921109090 1:212015021-212015043 TCCCAGATGGGGCGGCTGCCAGG - Intronic
921198294 1:212779625-212779647 TCCCAGATGGGGCAGCTGACCGG - Intronic
921414275 1:214869828-214869850 TCCCAGATGGGGCAGCTGGCCGG + Intergenic
921414324 1:214869959-214869981 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
922269324 1:224017178-224017200 GGGCAGGTGGAGCAGCAGCGAGG - Intergenic
922314884 1:224434159-224434181 CGGCGGGAGGGGCAGCAGCCGGG + Exonic
922503081 1:226110723-226110745 GGGCGGAGGAGGCAGCAGCCCGG + Intergenic
922919984 1:229293975-229293997 TGGCAGCAGGGACAGCAGCGTGG + Intronic
923128929 1:231057847-231057869 TGGCAAAAAGGGTAGCAGCCTGG - Intergenic
923137089 1:231128659-231128681 TCTCAGATGGGGCAGTTGCCAGG - Intergenic
923174893 1:231454312-231454334 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
923589791 1:235308885-235308907 TCCCAGATGGGGTGGCAGCCGGG - Intronic
923589890 1:235309274-235309296 TCTCAGATGGGGCGGCTGCCGGG - Intronic
923589902 1:235309314-235309336 TCTCAGATGGGGCGGCTGCCGGG - Intronic
923772106 1:236946581-236946603 GGGCAGATGGGGCAGGAGGCTGG + Intergenic
923819636 1:237423936-237423958 TGACAGAAGGGGAAGCAGGCAGG + Intronic
924091552 1:240507004-240507026 TGGATGATGGGGCTGGAGCCGGG + Intronic
924765980 1:247032324-247032346 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
924824142 1:247522139-247522161 TTCCAGATGGGGCGGCTGCCAGG - Intronic
1062875393 10:939267-939289 TGGCACAGGAGGGAGCAGCCAGG + Intergenic
1062970468 10:1644220-1644242 TCGCAAATGCGGCTGCAGCCTGG - Intronic
1062992917 10:1836804-1836826 TGGGAGAGGGGGCGGCAGGCGGG - Intergenic
1063343960 10:5294303-5294325 AGGCAGAGAGGGCAGCACCCAGG + Intergenic
1063776868 10:9273724-9273746 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1063895806 10:10680403-10680425 GGGCACATGGGGCAGGATCCAGG + Intergenic
1064017162 10:11781533-11781555 TGGCAGCGGAGGCAGCAGCTGGG + Intergenic
1064140772 10:12788381-12788403 AGTGAGATGGCGCAGCAGCCAGG - Intronic
1064663613 10:17629355-17629377 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1065335815 10:24656013-24656035 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1065594408 10:27296690-27296712 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1065662587 10:28021314-28021336 AGGCAGATGGGGGAGGAGGCTGG - Intergenic
1065738061 10:28771935-28771957 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
1065738103 10:28772061-28772083 TCCCAGATGGGGCAGCTGGCCGG - Intergenic
1066086797 10:31979245-31979267 TCGCAGACGGGGCAGTGGCCGGG + Intergenic
1066390923 10:34976715-34976737 TCCCAGATGGGGCAGCTGCTGGG - Intergenic
1067034162 10:42900536-42900558 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1067086627 10:43243586-43243608 TCCCAGATGGGGCAGCGGCCAGG - Intronic
1067120076 10:43465424-43465446 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1067128948 10:43544071-43544093 TGGAAGATTGCACAGCAGCCAGG - Intergenic
1067334057 10:45347126-45347148 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1067334278 10:45347924-45347946 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1067339762 10:45391814-45391836 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1067523869 10:47026931-47026953 TGGCAGGTGTGGCATCAGGCTGG - Intergenic
1067567068 10:47347081-47347103 TGGCTGAGCGGGCAGCAGGCAGG - Intergenic
1067685445 10:48464021-48464043 TAGGAGATGGGACAGCAGGCCGG - Intronic
1067744901 10:48928408-48928430 TGGCACAGGAGGCAGCAGCATGG + Intronic
1067872123 10:49970725-49970747 TCCCAGACGGGGCGGCAGCCGGG - Intronic
1067980641 10:51080502-51080524 TGGCAGAAAGAGCAGCAGCCTGG - Intronic
1069157843 10:65052393-65052415 TCCCAGACGGGGTAGCAGCCTGG - Intergenic
1069365642 10:67691651-67691673 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1069674654 10:70238940-70238962 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1069674792 10:70239434-70239456 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1069732980 10:70631225-70631247 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1069733002 10:70631305-70631327 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1069741451 10:70688064-70688086 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1070318131 10:75333734-75333756 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1070358687 10:75665314-75665336 TGACAGGTGGGGCTGAAGCCTGG + Intronic
1070409822 10:76129363-76129385 TGGCAATTTGGGCAACAGCCTGG - Intronic
1070652036 10:78244444-78244466 TGTAAGATGGGACAGGAGCCAGG + Intergenic
1071275760 10:84053563-84053585 AGGAAGAAGGGGCAGCAGGCTGG + Intergenic
1071365733 10:84898904-84898926 TTGCAGATGGCACAGAAGCCTGG + Intergenic
1071415060 10:85433495-85433517 TTGCAGACGGGACAACAGCCTGG - Intergenic
1071878174 10:89865390-89865412 TTGGGGATGGGGGAGCAGCCAGG + Intergenic
1072013449 10:91323486-91323508 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1072116526 10:92374994-92375016 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1072481033 10:95809820-95809842 TCCCAGACGGGGCAGCGGCCGGG + Intronic
1072481042 10:95809860-95809882 TCCCAGATGGGGCAGTGGCCAGG + Intronic
1072481052 10:95809900-95809922 TCCCAGACGGGGCAGCTGCCGGG + Intronic
1072648193 10:97275542-97275564 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1072730324 10:97841693-97841715 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1072950004 10:99839662-99839684 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1072980174 10:100092979-100093001 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1073386053 10:103128865-103128887 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1073439688 10:103545128-103545150 TGTGAGATGGGGCAGCTGCAGGG + Intronic
1073511596 10:104045985-104046007 TGGGAAATGGGGCAACAGCTTGG + Intronic
1073700833 10:105925197-105925219 TAGGAGGTGGGGCAGCAGGCGGG + Intergenic
1074118425 10:110475382-110475404 TGGCAGAAAGAGCAGCACCCTGG + Intergenic
1074163870 10:110857969-110857991 AGGCACATGGGGCAGGAGGCCGG - Intergenic
1074533579 10:114313109-114313131 TGGGAGAGGGGGCAGCAGGAAGG + Intronic
1074939725 10:118222968-118222990 AGGAAGATGGGCCAGGAGCCAGG + Intergenic
1074983208 10:118635973-118635995 TGGCAGATGGGGGAGCAGCAGGG - Intergenic
1075091485 10:119446410-119446432 TGCCAGGTGGGACGGCAGCCAGG - Intronic
1075108520 10:119559598-119559620 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1075128815 10:119722146-119722168 TCTCAGACGGGGCAGCTGCCCGG - Intergenic
1075282196 10:121148886-121148908 AGGCAGATAGGGAAGGAGCCTGG - Intergenic
1075300786 10:121322242-121322264 TGGGACGTGGGGCAGCACCCTGG - Intergenic
1075521907 10:123148291-123148313 TGGAAGGTGGTGCAGCAGGCAGG - Exonic
1075583078 10:123636781-123636803 TGGTGGAGTGGGCAGCAGCCAGG + Intergenic
1075652690 10:124139648-124139670 GAGGAGATGGGGCAGCTGCCTGG + Intergenic
1075877694 10:125822195-125822217 TGGCAGGTGGGGATGCAGCCTGG - Intronic
1075961238 10:126569014-126569036 TGAAAGCAGGGGCAGCAGCCCGG + Intronic
1076560423 10:131359731-131359753 AGGCAGATGGAGGAGCAGCTTGG + Intergenic
1076801897 10:132834859-132834881 TTGCAGAAGGGGCAGGAGCTCGG - Intronic
1076830562 10:132992322-132992344 AGGCAGAGGAGGCAGCAGCGGGG + Intergenic
1076978009 11:189948-189970 TGGCAGATGGGGACACTGCCAGG + Intronic
1077144358 11:1037959-1037981 GGGCAGGTGGGGCAGCTCCCGGG - Intergenic
1077216122 11:1395866-1395888 GGGCAGATGGTGGAGCAGGCGGG - Intronic
1077506439 11:2931879-2931901 TGACAGGTGGGGCAGGAGCTGGG + Intergenic
1077931209 11:6734905-6734927 TGGCAGAAGGGGAAACAGGCAGG - Intergenic
1078122420 11:8523554-8523576 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1078241738 11:9536333-9536355 CGGCAAATACGGCAGCAGCCTGG - Intergenic
1078427334 11:11262357-11262379 TGGTGGATGAGGCAGCATCCTGG + Intergenic
1079018326 11:16888113-16888135 TCTCAGATGGGGCGGCTGCCAGG - Intronic
1079154793 11:17935888-17935910 GGGGAGATGGGGCAGCAGAGTGG + Intronic
1080097938 11:28430156-28430178 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
1080860243 11:36145126-36145148 TCCCAGATGGGGCAGCTGGCCGG - Intronic
1081784835 11:45738711-45738733 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1081857091 11:46310815-46310837 TGTCAGATGAGGCAGCACCCAGG + Intronic
1082095228 11:48124549-48124571 TGGCTGGTGGGGCAGCTGCAGGG - Intronic
1082166419 11:48955643-48955665 TCCCAGAAGGGGCAGCTGCCGGG + Intergenic
1082166431 11:48955683-48955705 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1082166542 11:48956112-48956134 TCCCAGATGGGGTGGCAGCCAGG + Intergenic
1082249283 11:49961379-49961401 TGGCAGAAGCTGGAGCAGCCTGG - Intergenic
1082870967 11:57943789-57943811 TCCCAGATGGGGCAGTGGCCGGG + Intergenic
1083079200 11:60073249-60073271 TCCCAGATGGGGCGGCTGCCAGG + Intergenic
1083120815 11:60510402-60510424 TCCCAGACGGGGCAGCTGCCAGG - Intergenic
1083120823 11:60510442-60510464 TCCCAGATGGGGCAGCTGCCGGG - Intergenic
1083154599 11:60815269-60815291 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1083382288 11:62278719-62278741 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1083646200 11:64172654-64172676 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1083653630 11:64218828-64218850 TGGAACATGGGGAAGCAGTCAGG - Intronic
1083657390 11:64236051-64236073 GGGCAGGTGGGGCAGCGGGCAGG + Intronic
1083775755 11:64893699-64893721 GGACAGCTGGGGCAGCAGGCTGG - Intergenic
1083832046 11:65239417-65239439 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1084014254 11:66369333-66369355 CGGCAGAGGGCGCAGGAGCCAGG + Intronic
1084048918 11:66587785-66587807 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1084172502 11:67407223-67407245 AGGCAGATGGGGCAGGAGCAGGG + Intronic
1084552319 11:69852140-69852162 AGGGACATGGGGCAGCATCCTGG + Intergenic
1084924812 11:72502738-72502760 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1084989532 11:72909831-72909853 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1084989543 11:72909871-72909893 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1085073728 11:73572011-73572033 TCTCAGATGGGGCGGCTGCCAGG - Intronic
1085097797 11:73775140-73775162 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1085097808 11:73775180-73775202 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1085116621 11:73936635-73936657 TCCCAGATGGGGCAGCTGGCTGG + Intergenic
1085288350 11:75378961-75378983 TCCCAGACGGGGCGGCAGCCAGG + Intergenic
1085480866 11:76821569-76821591 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1085492498 11:76933884-76933906 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1085745095 11:79108384-79108406 TGTCAGCTAGGCCAGCAGCCTGG - Intronic
1086434856 11:86770818-86770840 TCTCAGATGGGGCGGCGGCCGGG + Intergenic
1086818683 11:91406579-91406601 TGTCCCATGGGGCAGCTGCCTGG + Intergenic
1087057373 11:93947443-93947465 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1087287471 11:96280697-96280719 TTGCAAATAGGGCAGCACCCTGG - Intronic
1087639437 11:100740709-100740731 AGGCAGAAGGAGCAGCTGCCAGG - Intronic
1087948541 11:104194410-104194432 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1089332558 11:117700092-117700114 TGGAAGATGGTTCAGAAGCCTGG + Intronic
1089421128 11:118331959-118331981 TCTCAGACGGGGCAGCTGCCAGG + Intergenic
1089585653 11:119508119-119508141 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1090316853 11:125798595-125798617 TGGCAGAAGGGGAAGCAAACAGG + Intergenic
1090322900 11:125863006-125863028 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1090331978 11:125939521-125939543 TGCCAGATGGGGCAGAACCCAGG + Intergenic
1090686660 11:129129226-129129248 TCCCAGACGGGGCAGCTGCCGGG - Intronic
1090686673 11:129129266-129129288 TCCCAGACGGGGCAGCTGCCGGG - Intronic
1090686687 11:129129306-129129328 TCCCAGACGGGGCAGCTGCCGGG - Intronic
1090791167 11:130091918-130091940 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1091727621 12:2856752-2856774 TGGGAGATGTGGCACTAGCCAGG + Intronic
1091776070 12:3185712-3185734 GGCCTGATGGGGCAGCCGCCTGG + Intronic
1091785424 12:3240324-3240346 GGCCAGGTGGGGGAGCAGCCCGG + Intronic
1092072088 12:5639683-5639705 TGGGAGATGGGCAGGCAGCCAGG + Intronic
1092185518 12:6475730-6475752 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1092373286 12:7934752-7934774 GGGCAGATTAGGCAGCAGGCTGG + Intronic
1092843814 12:12566128-12566150 TCGCAGACGGGGCGGCTGCCGGG - Intergenic
1093038506 12:14354792-14354814 TGTCAGACGGGGCGGCTGCCGGG - Intergenic
1093038560 12:14354920-14354942 TCCCGGATGGGGCGGCAGCCAGG - Intergenic
1093376107 12:18429827-18429849 TGGGAGTGGGTGCAGCAGCCAGG - Intronic
1093904457 12:24673943-24673965 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1093927819 12:24926269-24926291 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1094319669 12:29171403-29171425 TCCCAGATGGGGCAGCAGCCGGG - Intronic
1094319705 12:29171562-29171584 TGCCAGATGGGGCGGCAGCTGGG - Intronic
1094319732 12:29171680-29171702 TGCCAGATGGGGCAGCAGCTGGG - Intronic
1094319853 12:29172234-29172256 TCCCAGATGGGGCAGCGACCAGG - Intronic
1094579571 12:31721885-31721907 TGGCAGCAGTGGCAGCAGTCTGG - Intronic
1095068828 12:37815115-37815137 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1095281105 12:40353219-40353241 TCTCAGACGGGGCAGCTGCCAGG + Intronic
1095738818 12:45586053-45586075 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1095738835 12:45586132-45586154 TCCCAGATGGGGCAGCGGCCGGG + Intergenic
1095834667 12:46624677-46624699 TGGCAGATGGGGCAGAAACAGGG - Intergenic
1096041445 12:48520624-48520646 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1096093020 12:48915836-48915858 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1096600414 12:52724745-52724767 GGGCAGATTGGGCATGAGCCAGG + Intergenic
1097110073 12:56651818-56651840 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1097110166 12:56652167-56652189 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1097230566 12:57507937-57507959 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1097254814 12:57665303-57665325 TCCCAGATGGGGCGGCGGCCAGG - Intergenic
1097254934 12:57665760-57665782 TGGAAGATTGCACAGCAGCCAGG - Intergenic
1097779545 12:63686877-63686899 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1097877447 12:64656684-64656706 TGCCTGATGGGGCTTCAGCCTGG - Intronic
1098018955 12:66134721-66134743 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1098209911 12:68152641-68152663 AAGCAGCTGGGACAGCAGCCTGG - Intergenic
1098773860 12:74588127-74588149 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
1099971318 12:89503758-89503780 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1099971330 12:89503798-89503820 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1100225313 12:92550416-92550438 TTGCACATGGGGCAGGAGACTGG - Intergenic
1100325931 12:93539989-93540011 TGGCAGATGGGTCAGGAACAGGG - Intergenic
1100582015 12:95947414-95947436 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1100853413 12:98737143-98737165 TGGCAGCTGGGGCTGTTGCCAGG - Intronic
1101316849 12:103636599-103636621 TTACAGCAGGGGCAGCAGCCAGG - Intronic
1101504259 12:105331267-105331289 TGGGAGGTGGGGGAGCGGCCGGG - Intronic
1101584169 12:106070168-106070190 TGGCAGTTGGGGCTGCTGCTGGG - Intronic
1102175005 12:110867928-110867950 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1102294167 12:111723783-111723805 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1102323317 12:111957387-111957409 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1103234536 12:119360488-119360510 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1103299887 12:119918932-119918954 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1103600451 12:122051269-122051291 GGGCAGCTCGGGCAGCAGGCAGG - Intronic
1104169037 12:126261912-126261934 TGGGAGATTTTGCAGCAGCCTGG + Intergenic
1104776775 12:131393989-131394011 TTGCAGATGGGGAACCTGCCTGG + Intergenic
1104924694 12:132308129-132308151 AGGCAGAGGGTGCAGCAGCGTGG + Intronic
1104954021 12:132455021-132455043 TTGCAGATGGGGTGGGAGCCAGG + Intergenic
1104968686 12:132521411-132521433 TGGGAGATGGGGCAGAGGTCAGG - Intronic
1105015812 12:132786347-132786369 TGGCAGCAGTGACAGCAGCCTGG - Exonic
1105239501 13:18597564-18597586 TGGTAGCTGGGACAACAGCCAGG - Intergenic
1105267634 13:18836597-18836619 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1105367694 13:19779170-19779192 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1105514273 13:21076200-21076222 TGGCCTATGGGGAAGCCGCCCGG - Intergenic
1105640356 13:22256394-22256416 TGGCAGCTGGGGCAGCAGGCAGG + Intergenic
1105921799 13:24970501-24970523 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1105980571 13:25513154-25513176 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1106495214 13:30269793-30269815 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1107165834 13:37280412-37280434 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
1107251104 13:38363959-38363981 TCCCAGACGGGGCAGCGGCCGGG - Intergenic
1107692473 13:42966582-42966604 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1107923020 13:45229384-45229406 GGGAAGAGGGGGCAGCTGCCTGG - Intronic
1107953353 13:45485508-45485530 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1108351319 13:49592940-49592962 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1108370316 13:49761958-49761980 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1109266400 13:60205635-60205657 TCCCAGACAGGGCAGCAGCCAGG - Intergenic
1110269299 13:73574743-73574765 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1110626499 13:77660765-77660787 TCCCAGATGGGGCAGCGGCTGGG + Intergenic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1110922202 13:81102356-81102378 TCCCAGATGGGGCAGCTGGCCGG - Intergenic
1112558527 13:100491686-100491708 TGGCAGAAGGTGCTGCGGCCTGG + Intronic
1113453832 13:110433170-110433192 TGTCAGAGGGGACAGGAGCCTGG - Intronic
1113550058 13:111185801-111185823 AGGCAGATCAGGCAGCACCCAGG - Intronic
1113778610 13:112963074-112963096 TGACAGATCTGGCACCAGCCTGG - Intronic
1113785926 13:113002090-113002112 AGGCTGCTGGGGCAGAAGCCCGG + Intronic
1113927172 13:113947978-113948000 TGGGCGCTGGGGCAGCACCCTGG - Intergenic
1113950571 13:114069279-114069301 TGGCCGCTGGGTCTGCAGCCGGG - Intronic
1114182861 14:20380354-20380376 TGCCTGCTGGGGCAGGAGCCGGG + Exonic
1114428227 14:22639122-22639144 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1114491972 14:23108331-23108353 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
1114594311 14:23898475-23898497 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
1115324870 14:32127842-32127864 TCCCAGACGGGGCAGCTGCCGGG + Intronic
1115443766 14:33466018-33466040 TAGCAGATGGGGAGGCAGGCTGG + Intronic
1115622277 14:35152529-35152551 TCCCGGATGGGGCAGCGGCCGGG + Intronic
1115847684 14:37555787-37555809 TCTCAGATGGGGCAGTTGCCAGG + Intergenic
1116005370 14:39285718-39285740 TCCCAGACGGGGCAGCTGCCGGG + Intronic
1116409031 14:44601187-44601209 TGCCAGATGGGGTGGCGGCCGGG - Intergenic
1116480337 14:45389158-45389180 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1117411697 14:55456429-55456451 TCCCAGATGGGGCGGCTGCCGGG + Intronic
1117882828 14:60328566-60328588 TGGCAGTTGGGGAAGCTTCCTGG + Intergenic
1118159248 14:63272657-63272679 TGGCTCATGGGGCTGTAGCCAGG - Intronic
1118430920 14:65717701-65717723 TCCCAGACGGGGCAGCTGCCAGG + Intronic
1118584675 14:67341353-67341375 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1118955586 14:70477691-70477713 TCCCAGATGGGGCAGCTGCCGGG - Intergenic
1118955720 14:70477993-70478015 TCCCAGATGGGGCGGCAGCCGGG - Intergenic
1119051798 14:71377169-71377191 TCCCAGATGGGGCGGCGGCCGGG + Intronic
1119334455 14:73820833-73820855 TGGCAGCTGGTGCATGAGCCAGG + Intergenic
1119466072 14:74859807-74859829 GGGCTGATGGGGCAGCAGGGAGG - Intronic
1119698626 14:76734712-76734734 TCCCAGATGGGGTGGCAGCCAGG + Intergenic
1119742801 14:77025637-77025659 TGGCAAATGGTGCAGCAGAGGGG + Exonic
1120087098 14:80286792-80286814 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1120087112 14:80286832-80286854 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1120309963 14:82814873-82814895 TCCCAGATGGGGTGGCAGCCAGG + Intergenic
1120505748 14:85352635-85352657 TCCCAGATGGGGCAGCTGGCCGG + Intergenic
1120547594 14:85829889-85829911 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1120547606 14:85829929-85829951 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1120965502 14:90164029-90164051 TGGCATTTGGGGTAGCAGCCTGG + Intronic
1121306797 14:92911890-92911912 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1121411138 14:93748941-93748963 TGGAGGCTGGGGCAGGAGCCGGG + Intronic
1121730852 14:96186104-96186126 TGGCAGGCAGGGCAGCAGCCAGG - Intergenic
1121832660 14:97065606-97065628 TGCCATCTGGGGCAGCATCCAGG + Intergenic
1122026788 14:98883851-98883873 TGGCAGCTGTGGCAGCTCCCTGG - Intergenic
1122400731 14:101465785-101465807 GGGCAGGTCGGGCAGGAGCCTGG + Intergenic
1122415039 14:101545336-101545358 AGGCAGATGGGGCAGTAGGTGGG + Intergenic
1122543499 14:102510186-102510208 GTGCAGATGGGGTAGCAGCCTGG - Intergenic
1122569331 14:102683937-102683959 TGGCAGCTGGGGGAGGCGCCTGG + Intronic
1123429703 15:20204057-20204079 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1123682000 15:22770173-22770195 GGGCAGATGGGGGAGCAGGAGGG - Intergenic
1123999307 15:25741336-25741358 TGGGAGATGGTGCGGCAGGCAGG - Intronic
1124132703 15:27004224-27004246 TCTCAGATGGGGCAGTTGCCAGG + Intronic
1124221605 15:27854322-27854344 AGGCACATGGGTCAGCGGCCTGG - Intronic
1125066790 15:35496872-35496894 TGGCAGGTGGGAGAGCAGCTTGG - Intronic
1125659127 15:41382396-41382418 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1126517196 15:49550479-49550501 TCTCAGACGGGGCAGCTGCCAGG + Intronic
1126691869 15:51294472-51294494 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1126691882 15:51294512-51294534 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1127088777 15:55447055-55447077 TCCCAGATGGGGCAGCTGACGGG + Intronic
1128071355 15:64799241-64799263 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1128071366 15:64799281-64799303 TCTCAGATGGGGCGGCTGCCAGG + Intergenic
1128386704 15:67154212-67154234 TGGCATAGGGGGCTGCAGCCTGG + Intronic
1128847319 15:70911181-70911203 TGGCTGAAAGGTCAGCAGCCAGG + Intronic
1128970146 15:72100759-72100781 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1129056810 15:72826137-72826159 TGGCAGCTGGGGCAAGAGGCTGG + Intergenic
1129071753 15:72957203-72957225 TGGCAGAGGTGGCAGCATCCAGG + Intergenic
1129275932 15:74445311-74445333 AGGCAGATGGAGCAACAGCTTGG + Intergenic
1130340836 15:82998367-82998389 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1130942708 15:88524275-88524297 TCCCAGATGGGGCGGCTGCCAGG - Intronic
1130946731 15:88553676-88553698 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1131001438 15:88941985-88942007 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1131001449 15:88942025-88942047 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1131125205 15:89853908-89853930 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1131127168 15:89867811-89867833 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1131173966 15:90198645-90198667 TGCCAGGTGAGGGAGCAGCCAGG + Intronic
1132230687 15:100181645-100181667 AGGAAGATAGGGCACCAGCCAGG - Intronic
1132544076 16:525041-525063 TGGCACATGGCGCTCCAGCCTGG - Intergenic
1132660229 16:1057926-1057948 GGGCAGAAGGGACAGCAGCAGGG - Intergenic
1132776733 16:1599213-1599235 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1133129212 16:3665842-3665864 TGGCAGCAGCAGCAGCAGCCAGG + Intronic
1133166926 16:3954471-3954493 TCGCAGCTCGGGCAGCTGCCTGG + Intronic
1133916446 16:10113289-10113311 TGGCTGAGGGGGCAGCGGCCCGG - Intronic
1134012931 16:10868663-10868685 GGGCAGGAGGGGCTGCAGCCAGG - Intergenic
1134310621 16:13072346-13072368 TGGCCGGTGGGGCAGTAGCTTGG + Intronic
1135694384 16:24574411-24574433 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1135694395 16:24574451-24574473 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1135694419 16:24574531-24574553 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1135694430 16:24574571-24574593 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1136202539 16:28698669-28698691 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1136408522 16:30063747-30063769 TCGCAGAGTGGGCAGCAGCGGGG - Exonic
1136599487 16:31275320-31275342 CAGCAGATGGATCAGCAGCCGGG + Intronic
1136919049 16:34246102-34246124 TCTCAGATGGGGCAGCTGCTGGG + Intergenic
1137038908 16:35591813-35591835 TGGCGGCTGGGCCAGCAGCAGGG - Intergenic
1137388114 16:48059265-48059287 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1137439005 16:48483033-48483055 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
1137440783 16:48497167-48497189 CTGAAGCTGGGGCAGCAGCCGGG - Intergenic
1137703495 16:50517570-50517592 TGGCAGGTGGGGCTGGTGCCTGG + Intergenic
1137857075 16:51805483-51805505 TGGCACAAGGGGCAGCAGTGAGG - Intergenic
1138382051 16:56609259-56609281 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138383338 16:56618585-56618607 GGGCAGCAGGAGCAGCAGCCTGG - Intergenic
1138385600 16:56633747-56633769 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138386651 16:56639855-56639877 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138389408 16:56659069-56659091 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138390459 16:56666952-56666974 GGGCAGCAGGAGCAGCAGCCTGG + Exonic
1138392155 16:56677648-56677670 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138393059 16:56683954-56683976 GGGCAGCAGGAGCAGCAGCCTGG - Exonic
1138400569 16:56740222-56740244 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1138590595 16:57997643-57997665 TGGCAGATGGGGCAGCTGTAGGG + Exonic
1138699327 16:58846282-58846304 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1138743394 16:59335888-59335910 TGGCAGATGGGGAAGGCCCCTGG - Intergenic
1138998634 16:62481540-62481562 TGGCAGAGTGGGCAGCTTCCAGG - Intergenic
1139394739 16:66631017-66631039 TCTCAGATGGGGCGGCCGCCGGG - Intronic
1139623226 16:68163638-68163660 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1139766750 16:69237074-69237096 TGAAGGATGGGGCAGCACCCAGG + Intronic
1139885438 16:70204661-70204683 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1141003367 16:80329357-80329379 TGTCAGATGGGGCAACAGGATGG + Intergenic
1141110346 16:81266450-81266472 TGGGGGATGGGGGAGCAGCAAGG - Intronic
1141273101 16:82558579-82558601 TGCCAGCTGTGACAGCAGCCAGG + Intergenic
1141400018 16:83739405-83739427 AGGCACATGGGGCAACATCCTGG - Intronic
1141630704 16:85286387-85286409 GGGGAGATGAGGCACCAGCCGGG - Intergenic
1141866399 16:86752885-86752907 TGGCAGAGTGGGCAGCAGAGAGG + Intergenic
1142141420 16:88474365-88474387 TGGCAGATGCAGCAGCTGCCCGG + Intronic
1142164165 16:88576845-88576867 TGGCAGAAGGAGACGCAGCCTGG - Intronic
1142178513 16:88656070-88656092 GGGCGGGTGGAGCAGCAGCCCGG - Intronic
1142232891 16:88908002-88908024 AGGCAGATGAGGCTGCAGCCAGG - Intronic
1142286451 16:89173387-89173409 TGGCAGGTGGGGAGGCAGGCAGG + Intronic
1142465434 17:134413-134435 TGGCAGATGGGGACACTGCCAGG + Intergenic
1142759559 17:2034817-2034839 AGGGGGATGGGGCAGCAGCAGGG - Intronic
1143118351 17:4593007-4593029 TGGCTGGTGGGGCAGCCGCAAGG - Exonic
1143289441 17:5817885-5817907 TTTCAGATGGGGAAACAGCCAGG + Intronic
1143316284 17:6035831-6035853 TGGCAGGTGGTGCAGAAGGCTGG + Intronic
1143762417 17:9115032-9115054 TGGAAGATGGGGCAGGATGCTGG + Intronic
1143884795 17:10057513-10057535 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1144541400 17:16145769-16145791 TCCCAGACGGGGCAGCGGCCAGG - Intronic
1144559794 17:16312196-16312218 TCCCAGATGGGGCGGCTGCCGGG + Intronic
1144960206 17:19040402-19040424 CGGCATCTGGGGCGGCAGCCTGG - Intronic
1144974954 17:19134122-19134144 CGGCATCTGGGGCGGCAGCCTGG + Intronic
1145014444 17:19387327-19387349 TGGGAGGTGGGGCTGGAGCCAGG + Intergenic
1145047287 17:19628092-19628114 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1145064564 17:19753243-19753265 CTGCAGCTGGGGCTGCAGCCAGG - Intergenic
1145205786 17:20984479-20984501 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1145288225 17:21522280-21522302 TGGCAGTGGTGGCTGCAGCCTGG - Intergenic
1145389415 17:22444163-22444185 TGGCAGTGGTGGCTGCAGCCTGG + Intergenic
1145418137 17:22741349-22741371 TCCCAGATGGGGCAGCTGCCAGG - Intergenic
1145717190 17:27033912-27033934 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1145862818 17:28223865-28223887 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1145895728 17:28456289-28456311 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1145927617 17:28659519-28659541 TCCCAGATGGGGTGGCAGCCGGG + Intronic
1146731304 17:35195287-35195309 TCTCAGATGGGGCAGCTGCGGGG + Intergenic
1146951185 17:36907653-36907675 TGTCAGATGGGCCAGGAGGCTGG - Intergenic
1147018271 17:37510103-37510125 CCGCAGATGTGGCTGCAGCCAGG - Intronic
1147024149 17:37565803-37565825 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1147622318 17:41876133-41876155 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1147852048 17:43451069-43451091 TCTCAGATGGGGCAGTTGCCAGG - Intergenic
1147974162 17:44238132-44238154 TCTCAGATGGGGCAGTTGCCAGG - Intergenic
1148226335 17:45900308-45900330 TGGCAGAGGTGGCAGGAGCATGG - Intronic
1148299558 17:46534921-46534943 TCTCAGATGGGGCGGCTGCCAGG + Intronic
1148404269 17:47397810-47397832 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1148406455 17:47420706-47420728 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1148445395 17:47734129-47734151 TGGCTGTTGGTGCAACAGCCTGG - Intronic
1148469754 17:47885623-47885645 TGGCAGAGGGGGCAGGGGACAGG - Intergenic
1149908847 17:60551313-60551335 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1150380613 17:64716706-64716728 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1150477219 17:65484502-65484524 TCTCAGACGGGGCAGCTGCCAGG - Intergenic
1150518300 17:65837562-65837584 TCCCAGACGGGGCGGCAGCCGGG - Intronic
1150557718 17:66269109-66269131 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1151318129 17:73336492-73336514 TGGAAGATGGCTCAGCAGACAGG - Exonic
1151650969 17:75469261-75469283 GGGCAGCTGGGACAGCAGCAGGG - Intronic
1151725003 17:75878511-75878533 AGGCAGATGGGGCAGCTGAAGGG + Exonic
1151821311 17:76498356-76498378 GGGCAGATGGGGCAGCGCCGAGG + Intronic
1151878144 17:76878987-76879009 AGGGGGATGGGGCAGAAGCCTGG - Intronic
1151892036 17:76956655-76956677 AGGCAGCTGGGGCAGCTGCAGGG - Intergenic
1152224389 17:79085946-79085968 GGGCAGAGGGGCCAGCAGGCTGG - Exonic
1152402498 17:80076106-80076128 TGGTTGATGAGGCAGCAGCAGGG + Intronic
1152587222 17:81194478-81194500 AGGCGGATGGGGCAGGAGGCTGG - Intronic
1152723875 17:81935846-81935868 TGGCAGGTGGGGCCACAGCCTGG - Intronic
1152928427 17:83098422-83098444 TTGCAGATGGGGGACCAGCATGG - Intergenic
1203170048 17_GL000205v2_random:140426-140448 TGGCCGCTGGGCCAGCAGCGAGG - Intergenic
1153821701 18:8837629-8837651 AGGCAGATGGGGCAGGTCCCTGG - Intergenic
1154089615 18:11344756-11344778 TCCCAGATGGGGCAGCAGCCGGG - Intergenic
1154116134 18:11614192-11614214 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1154158189 18:11959927-11959949 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1154398343 18:14011087-14011109 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1154449293 18:14461057-14461079 TGGTAGCTGGGACAACAGCCAGG + Intergenic
1154943573 18:21138061-21138083 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1156326327 18:36077807-36077829 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1156326339 18:36077847-36077869 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1157561112 18:48647129-48647151 TGCCTGATGATGCAGCAGCCTGG + Intronic
1157639832 18:49202792-49202814 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1157710331 18:49845800-49845822 TGGCAGATGGGGCACAAGACTGG + Intronic
1157763710 18:50282539-50282561 TTCCAGATGGGGGAGCCGCCCGG - Exonic
1157885347 18:51361075-51361097 TGGAAGATTGCACAGCAGCCAGG + Intergenic
1158148560 18:54343260-54343282 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1158894605 18:61901179-61901201 TGGCAGCTGGAGCAGCAGGAGGG - Intergenic
1159614904 18:70569742-70569764 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1159614917 18:70569782-70569804 TCTCAGATGGGGCAGCTGCTGGG + Intergenic
1160475581 18:79182846-79182868 TGGCAGAAGGGCCGGCATCCAGG - Intronic
1160492768 18:79351830-79351852 TGGGGGATGGGGCAGCAGGAGGG + Intronic
1160516042 18:79479825-79479847 AGGGAGATGGGGCAGTCGCCTGG + Intronic
1160873720 19:1287910-1287932 TGGCAGGTGGGGCAGCAGGACGG - Intronic
1161008605 19:1949042-1949064 TGGCAGAGCGGGAAGGAGCCAGG + Intronic
1161234560 19:3191439-3191461 TGGCAGAAGGCTCAGCAGCTTGG - Intronic
1161248550 19:3268561-3268583 TGGCTGATGGGGATGGAGCCTGG + Intronic
1161447604 19:4327231-4327253 GGGCAGATGGGGGAGCGGTCAGG + Intronic
1162109612 19:8393065-8393087 TGGCACACGGGGCATCACCCGGG - Intronic
1162479489 19:10920333-10920355 TGGCAGAGGGGGCAGGTGCTTGG + Intronic
1162602091 19:11676957-11676979 TCCCAGACGGGGCAGCTGCCAGG + Intergenic
1162683157 19:12362130-12362152 TCCCAGATGGGGTGGCAGCCAGG - Intronic
1162886809 19:13703239-13703261 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1163542418 19:17918838-17918860 TCCCAGATGGGGCAGCTGGCCGG - Intergenic
1163630868 19:18417424-18417446 TGGCAGGAGGGGCATCTGCCGGG + Intergenic
1163865555 19:19770251-19770273 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
1163893692 19:20039156-20039178 TGCGAGGTGGGCCAGCAGCCGGG - Intronic
1163905970 19:20150245-20150267 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1163909422 19:20176062-20176084 TCCCAGATGGGGCGGCTGCCAGG + Intronic
1163945502 19:20530464-20530486 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1164012143 19:21212677-21212699 TCTCAGATGGGGCGGCTGCCAGG + Intergenic
1164016574 19:21260177-21260199 TCCCAGACGGGGCAGCAACCGGG + Intronic
1164017257 19:21264360-21264382 TCCCAGATGGGGCGGCGGCCAGG - Intronic
1164017268 19:21264400-21264422 TCCCAGATGGGGCAGCGGCCAGG - Intronic
1164017330 19:21264674-21264696 TCCCAGATGGGGCAGCAGCCGGG - Intronic
1164017400 19:21264990-21265012 TCCCAGATGGGGCGGCAGCTGGG - Intronic
1164017410 19:21265030-21265052 TCCCAGACAGGGCAGCAGCCAGG - Intronic
1164055016 19:21614969-21614991 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
1164071831 19:21775955-21775977 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
1164081833 19:21866104-21866126 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1164106106 19:22107920-22107942 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1164145950 19:22512696-22512718 TGGAAGGAGGGGCAGGAGCCAGG + Intronic
1164158254 19:22609743-22609765 GGGCAGATGTGGCTGCTGCCTGG + Intergenic
1164186192 19:22871635-22871657 TCCCAGATGGGGTGGCAGCCAGG + Intergenic
1164186204 19:22871675-22871697 TCTCAGATGGGGCAGTTGCCGGG + Intergenic
1164192026 19:22925985-22926007 TCTCAGACGGGGCAGCTGCCAGG - Intergenic
1164229297 19:23273911-23273933 TGGCGGCTGGGCCCGCAGCCGGG - Intergenic
1164244685 19:23419413-23419435 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
1164256660 19:23533650-23533672 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1164261186 19:23569857-23569879 TGGCAGGTGGGCCTGCAGCCAGG - Intronic
1164263918 19:23594878-23594900 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1164309531 19:24033761-24033783 TGGCGGCTGGGCCCGCAGCCGGG + Intronic
1164400284 19:27897380-27897402 TGGAGGCTGGGGCAGCAGCTTGG + Intergenic
1164490621 19:28709887-28709909 TGGCAGATGGGACAGCATAAGGG - Intergenic
1164653221 19:29901238-29901260 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1164659285 19:29949105-29949127 TCCCAGACGGGGCAGCTGCCGGG + Intronic
1164659314 19:29949186-29949208 TCCCAGATGGGGCGGCTGCCGGG + Intronic
1164792864 19:31002871-31002893 TGTCAGATGGCGCAGAAGCGGGG + Intergenic
1164982947 19:32627961-32627983 TGGCAGTTGGGGCTGCATCGTGG - Intronic
1165145225 19:33726179-33726201 TGGTAGATGGGGCAGGGGACAGG + Intronic
1165193088 19:34079789-34079811 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1165266735 19:34667457-34667479 TGGGAGGAGGGGCAGCAGCAGGG - Intronic
1165356105 19:35305138-35305160 TGGCAGGTGGGGCAGGGGACAGG - Intronic
1165481898 19:36069227-36069249 TCCCAGACGGGGCAGCTGCCGGG + Intronic
1165547851 19:36556678-36556700 TGGCAGATGGGGCAGCAGCCAGG - Intronic
1165727710 19:38124198-38124220 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1165939636 19:39408570-39408592 TGCCAGCAGCGGCAGCAGCCTGG + Exonic
1166028633 19:40108913-40108935 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1166261555 19:41644709-41644731 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1166349724 19:42190539-42190561 TGGCAAATGAGGCAGAAGGCTGG + Intronic
1166611697 19:44204088-44204110 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
1166863978 19:45825315-45825337 TGTCAGAGGTGGCAGCACCCTGG - Exonic
1167323091 19:48808109-48808131 TGGGAGATGGGCCTGCAGCGTGG + Intronic
1167492932 19:49802278-49802300 GGGCAGGGGAGGCAGCAGCCAGG - Intronic
1167514125 19:49913092-49913114 TTGCAGATGCAGCATCAGCCAGG + Intronic
925184596 2:1838419-1838441 TGGCATATAGGGCAGCAGAAAGG + Intronic
925749543 2:7075243-7075265 TGGCAGCTGGGGCCTCAGCTGGG + Intergenic
925910349 2:8569709-8569731 TGGCAGATGTGGCAGGTGCATGG - Intergenic
925911667 2:8577780-8577802 TTCAAGATGGGGCACCAGCCAGG - Intergenic
926150812 2:10424739-10424761 AGGAAGGTGGGGCTGCAGCCAGG + Intronic
926215523 2:10903028-10903050 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
926322756 2:11760267-11760289 TCCCAGATGGGGTGGCAGCCGGG + Intronic
926393748 2:12420577-12420599 TGGCAGATCATGCAACAGCCCGG + Intergenic
926638796 2:15212798-15212820 TGGCAGAAGGGGAAGCAAACAGG - Intronic
926915282 2:17885507-17885529 TGCCGGATGGGCCAGCAGGCTGG + Intronic
928009459 2:27594287-27594309 TCGCAGACGGGGTGGCAGCCGGG + Intronic
928585575 2:32755014-32755036 TCTCAGATGGGGCGGCTGCCGGG + Intronic
928596899 2:32868586-32868608 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
929240600 2:39649611-39649633 TGGCAGATAGAGCAGCACCTTGG + Intergenic
929415998 2:41746877-41746899 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
929447906 2:42014879-42014901 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
929516284 2:42606336-42606358 TCTCAGACGGGGCAGCTGCCGGG + Intronic
929561255 2:42957882-42957904 TGCCAGATGAGCCAGCAGCTGGG - Intergenic
929577779 2:43063251-43063273 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
929587915 2:43127602-43127624 AGGCAGAAGGGGCAGCAGCAGGG + Intergenic
929614492 2:43297338-43297360 TCTCAGACGGGGCAGCTGCCGGG - Intronic
929652206 2:43691598-43691620 AGGCAGATGGGGCAGGTCCCTGG - Intronic
930037906 2:47099345-47099367 TCACACCTGGGGCAGCAGCCTGG - Intronic
930202301 2:48557171-48557193 TCTCAGACGGGGCAGCTGCCGGG + Intronic
930727793 2:54698807-54698829 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
930727863 2:54699079-54699101 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
931419904 2:62117217-62117239 AGTGTGATGGGGCAGCAGCCCGG - Intronic
931499864 2:62854575-62854597 TGGTAGATGGGGGAACAACCGGG + Intronic
931656310 2:64512416-64512438 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
932336279 2:70933047-70933069 TGGCAGAGGGGGCGGCAGTGGGG - Exonic
932365969 2:71153828-71153850 TGGCAGCTGCGGCAGCAGCTGGG + Intergenic
932410191 2:71542893-71542915 TCGCAGATGGGGTGGCGGCCGGG + Intronic
932589945 2:73059254-73059276 GGGCAGAAGGCCCAGCAGCCGGG - Intronic
932710838 2:74061694-74061716 TCTCAGACGGGGCAGCTGCCGGG + Intronic
932718946 2:74124058-74124080 TCGCAGATGGGGCGGCTGCCGGG - Intergenic
933891768 2:86778591-86778613 GGCGAGAGGGGGCAGCAGCCTGG - Intergenic
934309690 2:91851962-91851984 TCCCAGATGGGGCGGCTGCCCGG - Intergenic
934646679 2:96063120-96063142 TGTCAAGTGGGGCAGCAGCAGGG - Intergenic
934703497 2:96461722-96461744 TCCCAGATGGGGCAGCTGGCCGG - Intergenic
934840081 2:97619202-97619224 TGTCAAGTGGGGCAGCAGCAGGG - Intergenic
934998566 2:98989043-98989065 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
935179205 2:100675175-100675197 TGGCAGTTGGGGGTGCAGGCTGG - Intergenic
935248427 2:101239351-101239373 TGGCAGAGGGGGCAACAGCTTGG - Intronic
936012818 2:108936073-108936095 TGGCAGATGGTCCAGCCTCCGGG + Intronic
936087540 2:109479559-109479581 GGGCAGAGGAAGCAGCAGCCAGG + Intronic
937168756 2:119844449-119844471 TCTCAGACGGGGCAGCTGCCGGG + Intronic
937251640 2:120527693-120527715 TGGGAGCTGGGGCAGGAGGCTGG - Intergenic
937437601 2:121892864-121892886 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
937734879 2:125277136-125277158 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
937919574 2:127120035-127120057 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
938006172 2:127788897-127788919 TCTCAGACGGGGCAGCTGCCGGG + Intronic
938055130 2:128208842-128208864 TCCCAGATGGGGCGGCAGCCGGG - Intergenic
938055259 2:128209432-128209454 TCCCAGATGGGGCGGCAGCCGGG - Intergenic
938079549 2:128362483-128362505 CGGTAGATGGGACAGCAGACAGG - Intergenic
938689694 2:133776224-133776246 TGGCAGTTGTGGCAGTAGCAAGG + Intergenic
938836224 2:135105991-135106013 TCTCAGACGGGGCAGCTGCCGGG - Intronic
938836237 2:135106031-135106053 TCCCAGATGGGGCGGCTGCCGGG - Intronic
939873741 2:147553513-147553535 TTGCATATGGGGCAGGAGCAGGG + Intergenic
941005185 2:160240348-160240370 TGGCAGACGGTGAAGCAGCCAGG + Intronic
941025109 2:160449053-160449075 TCCCAGACGGGGCAGCTGCCGGG - Intronic
941612412 2:167677831-167677853 TGGCAGAAGGGGAAGCAAACAGG + Intergenic
941814809 2:169786568-169786590 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
942096077 2:172537582-172537604 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
942338875 2:174921684-174921706 TGGCAGAAGGGGAAGCAAACAGG + Intronic
942355622 2:175108212-175108234 TCTCAGATGGGGCGGCTGCCGGG - Intronic
942611981 2:177751540-177751562 TGGGAGCTGGGGAAGAAGCCTGG + Intronic
942946944 2:181682660-181682682 TGCCAGTCGGGGCAGCTGCCGGG - Intergenic
943005787 2:182386644-182386666 TCTCAGATGGGGCGGCTGCCGGG - Intronic
943005801 2:182386684-182386706 TCCCAGACGGGGCAGCTGCCGGG - Intronic
943125756 2:183792284-183792306 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
943411718 2:187556659-187556681 TCTCAGATGGGGCGGCTGCCGGG - Intronic
943578045 2:189653656-189653678 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
944060696 2:195567942-195567964 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
944581554 2:201137086-201137108 TGCCTGAGGGGGCAGCGGCCTGG + Intronic
944591718 2:201223926-201223948 TGGCAGCTGGGGCTACAGGCAGG + Intronic
945061794 2:205915805-205915827 TGGAGGAAGGGGCAGGAGCCAGG - Intergenic
945115163 2:206401464-206401486 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
945316670 2:208377649-208377671 TCTCAGACGGGGCAGCTGCCGGG + Intronic
945530807 2:210950860-210950882 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
945803279 2:214461112-214461134 TGCCAGATGGGCCAGTAGTCAGG + Intronic
945864921 2:215163845-215163867 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
946280983 2:218665294-218665316 TGGCTGATGGGTCAGCACCAGGG - Intronic
946304192 2:218846699-218846721 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
946742586 2:222816355-222816377 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
947613471 2:231538762-231538784 TGGAAGATTGCACAGCAGCCAGG + Intergenic
948127251 2:235573371-235573393 TTAAAGATGGAGCAGCAGCCGGG - Intronic
948253581 2:236550326-236550348 TGGCAGATGTGTGCGCAGCCGGG - Intergenic
948258214 2:236583973-236583995 AGGCAGCTGGGGCAGCCCCCAGG - Intergenic
948279068 2:236732505-236732527 TGGCAGATGGACCATGAGCCTGG - Intergenic
948436694 2:237958539-237958561 TGGCGGCTGGGGCTGCAGCCTGG - Intergenic
948684949 2:239664516-239664538 TGGCAGAGGGGTCTCCAGCCTGG - Intergenic
949045079 2:241869000-241869022 TGGCAGAGGTGCCACCAGCCTGG - Intergenic
1169075415 20:2757105-2757127 GGGCAGGTGGGGCAGCCTCCAGG + Intronic
1169136982 20:3203468-3203490 TGGCAGGAGGAGCGGCAGCCCGG + Intronic
1169168244 20:3441764-3441786 TCCCAGATGGGGTAGCGGCCGGG + Intergenic
1169370814 20:5027605-5027627 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1169991936 20:11513540-11513562 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1170202525 20:13760554-13760576 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1170425053 20:16227945-16227967 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1170630384 20:18059476-18059498 AGGCTGATGGGGCAGCTTCCGGG + Intergenic
1171330087 20:24329785-24329807 TGGCAGATGGGGATGCTGCAAGG - Intergenic
1171366130 20:24626272-24626294 TCCCAGATGGGGTGGCAGCCGGG + Intronic
1171366224 20:24626661-24626683 TCCCAGATGGGGTAGCGGCCGGG + Intronic
1171463659 20:25312901-25312923 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1171848494 20:30291888-30291910 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1171899914 20:30847215-30847237 TCTCAGATGGGGCGGCTGCCAGG + Intergenic
1171951635 20:31427099-31427121 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1171957504 20:31471639-31471661 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1172059052 20:32176131-32176153 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1172128211 20:32638059-32638081 TGGCAGGAGGGGCAGAGGCCAGG + Intergenic
1172141182 20:32723933-32723955 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1172337889 20:34132564-34132586 TCTCAGATGGGGCACCTGCCGGG - Intergenic
1172349944 20:34230869-34230891 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1172506422 20:35466187-35466209 TGGCAGATGGAGCAGGAGGTAGG + Exonic
1172910741 20:38407443-38407465 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
1172999179 20:39093252-39093274 TGGCAGCTGTGGCAGCTGCATGG - Intergenic
1173437211 20:43044075-43044097 AGGCAGATGGAGCAGGACCCTGG + Intronic
1174541662 20:51294558-51294580 TTGCAGGTGGAGCAGGAGCCTGG + Intergenic
1175074729 20:56362945-56362967 CTGCAGAGGGGACAGCAGCCAGG - Intronic
1175188480 20:57195673-57195695 TGGCAGCTGAGGAAGGAGCCAGG - Intronic
1175419118 20:58820287-58820309 TGGCAGCTGGGCCAGGAGGCAGG - Intergenic
1175507491 20:59496117-59496139 TGGCAGAAGCTGGAGCAGCCAGG - Intergenic
1175642763 20:60644740-60644762 TGGCTTAAGGGGCATCAGCCAGG - Intergenic
1175904042 20:62371186-62371208 TGGCAGAGGGGCCAGGGGCCAGG - Intergenic
1176034236 20:63028555-63028577 GGGCGGGTGGGGCAGCGGCCGGG + Intergenic
1176104806 20:63380918-63380940 TGCCACAGGGGGCAGCACCCAGG - Intergenic
1176143413 20:63554835-63554857 TGGGAGCCGGGGCAGCAACCAGG + Exonic
1176265114 20:64205203-64205225 TCGCAGAAGGGTCAGCAGCCTGG - Intronic
1176303036 21:5107798-5107820 TGGAAGATGGCGCAGCTGCAGGG + Intergenic
1176326043 21:5502222-5502244 TGGCCGCTGGGCCAGCAGCGAGG - Intergenic
1176401714 21:6318729-6318751 TGGCCGCTGGGCCAGCAGCGAGG + Intergenic
1176435443 21:6670375-6670397 TGGCCGCTGGGCCAGCAGCGAGG - Intergenic
1176459705 21:6997445-6997467 TGGCCGCTGGGCCAGCAGCGAGG - Intergenic
1176483266 21:7379223-7379245 TGGCCGCTGGGCCAGCAGCGAGG - Intergenic
1176514632 21:7774748-7774770 TGGAAGATGGCCCAACAGCCCGG - Intergenic
1176722835 21:10405625-10405647 CGGCAGGTGGGGCTCCAGCCCGG + Intergenic
1177134188 21:17292289-17292311 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1177178530 21:17720686-17720708 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1177788312 21:25695704-25695726 TTCCAGATGGGGCGGCTGCCAGG + Intronic
1177912412 21:27049337-27049359 TGGGAGATGGAGCCCCAGCCAGG - Intergenic
1178391053 21:32198658-32198680 TGCCACTTGGGGCAGCAGCCAGG - Intergenic
1178396954 21:32251074-32251096 TGGCAGAAGGGGAAGCAAACAGG - Intergenic
1178648745 21:34405272-34405294 TGGAAGATGGCCCAACAGCCCGG - Intronic
1178782757 21:35620954-35620976 TGGCAGAAGGGGAAGCAAACAGG - Intronic
1179803347 21:43822345-43822367 TCCCAGACGGGGCAGCTGCCAGG - Intergenic
1179853989 21:44154126-44154148 TGGAAGATGGCGCAGCTGCAGGG - Intergenic
1180010931 21:45050725-45050747 TGGGAGCTGGGTCTGCAGCCTGG - Intergenic
1180135881 21:45861406-45861428 AGCCAGCTGGGGCAACAGCCTGG + Intronic
1180205125 21:46255144-46255166 TGCCAGGTGGGGCTGGAGCCAGG + Intronic
1180707222 22:17817294-17817316 GGGCAGGTGCGTCAGCAGCCGGG - Exonic
1180711423 22:17842089-17842111 TGGCAGGAGGGCCTGCAGCCTGG - Intronic
1180830045 22:18900470-18900492 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1181046716 22:20218096-20218118 AGGCAGGTGAGACAGCAGCCAGG - Intergenic
1181054384 22:20253161-20253183 TGGAAGAGGGGGCAGCAGCCAGG + Intronic
1181185805 22:21102893-21102915 TGGGCGATGGGGCCGCAGCCTGG + Intergenic
1181273898 22:21676879-21676901 TCCCAGATGGGGTGGCAGCCGGG + Intronic
1181274009 22:21677203-21677225 TCCCAGATGGGGTTGCAGCCAGG + Intronic
1181466246 22:23112227-23112249 TGGCAGCTGGGGAAGCAGAAGGG - Intronic
1182277661 22:29200705-29200727 TGGCAGAGGGGGCAGGACCGGGG - Intergenic
1182399806 22:30066778-30066800 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1182616839 22:31593192-31593214 TCCCAGATGGGGCGGCTGCCGGG + Intronic
1183590624 22:38777418-38777440 TGGCGGATGGGGCAGCTTCTTGG - Intronic
1183595218 22:38807094-38807116 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1184231126 22:43159020-43159042 AGGCAGCTGGGGCAGGAGCAAGG + Intronic
1184309782 22:43633789-43633811 AGGCAGGTGAGGCAGAAGCCAGG - Intronic
1184550197 22:45200271-45200293 TGCCATTTGCGGCAGCAGCCTGG - Intronic
1184554419 22:45225483-45225505 TGGCAGATGCGGGGGCTGCCTGG - Intronic
1184658284 22:45952954-45952976 ACGGAGAAGGGGCAGCAGCCAGG - Intronic
1184722332 22:46322266-46322288 TGTCTGTGGGGGCAGCAGCCTGG + Intronic
1185029348 22:48433446-48433468 TTACAGATGGGGAAACAGCCTGG - Intergenic
1185171294 22:49296094-49296116 GGGGAGATGGGGGAGCAGGCGGG + Intergenic
1185231700 22:49687522-49687544 TGGGAGGAGGGGCAGCATCCAGG + Intergenic
1185411278 22:50684216-50684238 TGGCAGCTTGGGCAGCTGCGGGG + Intergenic
1203280136 22_KI270734v1_random:125741-125763 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
950060820 3:10070221-10070243 TCTCAGATGGGGCGGCTGCCGGG - Intronic
950110672 3:10416898-10416920 TCCCAGATGGGGCGGCAGCCGGG + Intronic
950110701 3:10417016-10417038 TCCCAGATAGGGCGGCAGCCAGG + Intronic
950110795 3:10417340-10417362 TCCCAGATGGTGCAGCAGCCGGG + Intronic
950235750 3:11318831-11318853 AGGTAGGTGAGGCAGCAGCCAGG - Intronic
950831597 3:15879973-15879995 TGGCTGAGGGGGCAGCGGCCCGG - Intergenic
951264178 3:20547929-20547951 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
951290375 3:20866757-20866779 TCCCAGATGGGGCAGCTGGCCGG + Intergenic
951290574 3:20867377-20867399 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
952896565 3:38081992-38082014 TCTCAGACGGGGCAGCTGCCGGG + Intronic
953037789 3:39227816-39227838 TCTCAGATGGGGCAGTTGCCAGG - Intergenic
953230979 3:41064848-41064870 TGGCAGACAGAGCAGCAGCCTGG - Intergenic
953322275 3:41983242-41983264 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
953426009 3:42797747-42797769 TCTCAGACGGGGCAGCTGCCGGG - Intronic
953922817 3:46964215-46964237 TCTCAGACGGGGCAGCTGCCGGG - Intronic
953966213 3:47309330-47309352 TCCCAGAAGGGGCAGCTGCCGGG + Intronic
954048347 3:47952109-47952131 TCTCAGACGGGGCAGCTGCCGGG - Intronic
954059298 3:48056003-48056025 TCTCAGACGGGGCAGCTGCCGGG - Intronic
954080639 3:48211327-48211349 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
954481337 3:50803936-50803958 TCCCAGATGGGGCGGCTGCCGGG + Intronic
954566982 3:51607858-51607880 TCCCAGATGGGGCGGCGGCCGGG + Intronic
954662969 3:52235954-52235976 AGGCAGTTGGGGCAGCTTCCAGG + Intronic
954753754 3:52827951-52827973 GGGCAGGAGGGGGAGCAGCCAGG + Intronic
954895625 3:53972680-53972702 TGGCAGATGGGAAAGGAGCCAGG - Intergenic
955297338 3:57747421-57747443 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
955394911 3:58550328-58550350 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
956270326 3:67443850-67443872 TCTCAGACGGGGCAGCTGCCGGG - Intronic
956766117 3:72485954-72485976 TGGAAGATGGACCAGCAGCTGGG + Intergenic
956803816 3:72788316-72788338 TCCCAGATGGGGTCGCAGCCGGG - Intronic
958406306 3:93761441-93761463 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
958406637 3:93762603-93762625 TCCCAGACGGGGCAGCAGCTGGG + Intergenic
958421121 3:93932888-93932910 TGGCAGATGGAGGAGCATCCAGG + Intronic
958560866 3:95745219-95745241 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
958808920 3:98838243-98838265 TCTCAGACGGGGCAGCTGCCGGG + Intronic
959221925 3:103531559-103531581 TGCCAGACGGGGCAGCTGGCCGG + Intergenic
959419476 3:106112171-106112193 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
959468725 3:106721874-106721896 AGGCAGATGGGACAGGTGCCTGG - Intergenic
960344923 3:116519432-116519454 TCCCAGATGGGGTGGCAGCCGGG - Intronic
960625010 3:119674010-119674032 TCCCAGACGGGGCAGCAGCCGGG - Intronic
960625019 3:119674050-119674072 TCCCAGACGGGGCAGCAGCTGGG - Intronic
960770763 3:121190736-121190758 TCCCGGATGGGGCAGCTGCCGGG + Intronic
960817538 3:121688905-121688927 TCTCAGATGGGGCAGTTGCCAGG - Intronic
960862007 3:122164491-122164513 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
960866160 3:122202004-122202026 TCCCAGATGGGGTGGCAGCCGGG + Intronic
960918845 3:122725364-122725386 TCCCAGACGGGGCAGCGGCCGGG + Intronic
960924101 3:122780029-122780051 TCCCAGATGGGGTGGCAGCCGGG + Intronic
961459972 3:127043986-127044008 TGACAGATGAGGCAGCAGAAGGG - Intergenic
961498092 3:127309012-127309034 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
961704391 3:128773235-128773257 TCTCAGATGGGGCGGCTGCCGGG - Intronic
961704414 3:128773315-128773337 TCTCAGATGGGGCGGCTGCCGGG - Intronic
961729212 3:128954404-128954426 TCTCAGACGGGGCAGCTGCCGGG - Intronic
961762311 3:129180603-129180625 TGTCAGATGCTGCAGCAGCAAGG - Intronic
961784512 3:129340035-129340057 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
962102438 3:132356750-132356772 GGACAGCTGGGGCTGCAGCCAGG - Exonic
962113067 3:132471442-132471464 TCTCAGACGGGGCAGCTGCCAGG + Intronic
962688808 3:137872794-137872816 TCCCAGATGGGGCGGCTGCCAGG - Intergenic
963044563 3:141093126-141093148 TGGAAGATGGGGCAGCTGCAGGG + Intronic
965136959 3:164784655-164784677 TCCCAGATGGGGCAGCTGCTGGG - Intergenic
965302362 3:167018903-167018925 TCCCAGATGGGGCAGCTGCCAGG - Intergenic
965357530 3:167694715-167694737 TGGGAGGAGTGGCAGCAGCCAGG - Intronic
965650033 3:170923639-170923661 TCCCAGATGGGGTCGCAGCCGGG - Intergenic
965650076 3:170923796-170923818 TGTCAGATGGGGCGGCTGCCAGG - Intergenic
966015514 3:175132881-175132903 TCTCAGATGGGGCGGCTGCCGGG + Intronic
966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG + Intergenic
966255722 3:177914549-177914571 TCCCAGACAGGGCAGCAGCCAGG + Intergenic
966359567 3:179119956-179119978 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
966973937 3:185069090-185069112 TTCCAGGTGGGGCAGAAGCCTGG - Intergenic
967529212 3:190529900-190529922 TCCTAGATGGGGCAGCAGCCAGG - Intronic
968201833 3:196761933-196761955 TCTCAGACGGGGCAGCTGCCGGG + Intronic
968373026 4:12304-12326 TGGCAGCTGGGGACGCTGCCGGG + Intergenic
968411649 4:395753-395775 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
968842419 4:3017206-3017228 TGGCAGAGGCTGCAGGAGCCAGG - Intronic
969319877 4:6405305-6405327 AGGCAGAGGTGGGAGCAGCCAGG - Intronic
969340044 4:6534958-6534980 AGGCAGCTGGGGCAGGAGCCAGG - Intronic
969384726 4:6837105-6837127 TCCCAGACGGGGCAGCGGCCGGG + Intronic
969570709 4:8006621-8006643 GGGCAGATGGGCCATGAGCCAGG + Intronic
969572790 4:8019870-8019892 CAGGAGATGGGGCAGCAGCCAGG + Intronic
970420555 4:15901992-15902014 TGGCAAATATGGCAGCTGCCAGG - Intergenic
970785011 4:19784814-19784836 TGGCAGAAGGGGAAGCAAACAGG + Intergenic
971282069 4:25249534-25249556 TCCCAGATGGGGCGGCTGCCGGG + Intronic
972304714 4:37820509-37820531 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
972939721 4:44181892-44181914 TCTCAGATGGGGCGGCTGCCAGG - Intronic
972939745 4:44181972-44181994 TCTCAGATGGGGCGGCTGCCGGG - Intronic
973281509 4:48364072-48364094 TCTCAGACGGGGCAGCTGCCGGG + Intronic
973593417 4:52464903-52464925 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
973664099 4:53139522-53139544 TCCCAGACGGGGCAGCTGCCGGG - Intronic
973664132 4:53139603-53139625 TCCCAGACGGGGCAGCAGCCGGG - Intronic
973673165 4:53238557-53238579 TCCCAGATGGGGCGGCTGCCGGG + Intronic
973846143 4:54915047-54915069 TGGTGGAAGGGGCAGCAGTCAGG + Intergenic
974597869 4:64037359-64037381 TCCCAGATGGGGTCGCAGCCGGG - Intergenic
975063792 4:70037595-70037617 TCCCAGATGGGGTCGCAGCCGGG - Intergenic
975063823 4:70037712-70037734 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
975063869 4:70037839-70037861 TCCCAGATGGGGCGGCTGCCCGG - Intergenic
975633455 4:76423497-76423519 TCTCAGATGGGGCGGCTGCCAGG - Intergenic
976729175 4:88245008-88245030 TGTCACATGGGACAGCTGCCTGG - Intergenic
977465981 4:97383259-97383281 TGGCAGATGGGGATGCGGCTTGG + Intronic
977820819 4:101471145-101471167 TGGCAAATTGGGCAGCAAGCAGG - Intronic
978156980 4:105500643-105500665 TCCCAGATGGGGTGGCAGCCAGG + Intergenic
978376162 4:108077401-108077423 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376187 4:108077481-108077503 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376200 4:108077521-108077543 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376213 4:108077561-108077583 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376226 4:108077601-108077623 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376239 4:108077641-108077663 TCCCAGACGGGGCGGCAGCCGGG - Intronic
978376261 4:108077721-108077743 TCCCAGATGGGGCAGCAGCCGGG - Intronic
978519780 4:109603742-109603764 TCCCAGACGGGGCAGCTGCCGGG - Intronic
978947527 4:114516661-114516683 TCTCAGATGGGGCAGTTGCCAGG - Intergenic
979702555 4:123685153-123685175 TCCCAGATGGGGCAGCTGCCAGG - Intergenic
980106400 4:128592492-128592514 AGGCACATGTGGAAGCAGCCTGG + Intergenic
981524100 4:145693980-145694002 TCTCAGACGGGGCAGCTGCCGGG + Intronic
981970425 4:150659516-150659538 TCTCAGACGGGGCAGCTGCCGGG - Intronic
982017308 4:151167798-151167820 TCCCAGATGGGGCGGCAGCCAGG - Intronic
982053632 4:151526760-151526782 TCTCAGATGGGGCGGCTGCCGGG + Intronic
982075294 4:151731834-151731856 TCTCAGATGGGGCGGCTGCCGGG - Intronic
982723462 4:158882144-158882166 TCTCAGATGGGGCGGCTGCCGGG - Intronic
982723509 4:158882304-158882326 TCCCAGATGGGGCAGCTGCCGGG - Intronic
982784185 4:159523211-159523233 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
983613739 4:169679087-169679109 TCCCAGATGGGGCGGCTGCCGGG + Intronic
983628738 4:169828445-169828467 TCGCAGACGGGGCGGCTGCCGGG - Intergenic
984060547 4:174984435-174984457 TGGAAGATTGCACAGCAGCCAGG + Intergenic
984728130 4:183040846-183040868 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
985216375 4:187658175-187658197 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
985462369 4:190120263-190120285 TGGCAGCTGGGGATGCTGCCGGG - Intergenic
985471692 5:50781-50803 AAGCGGGTGGGGCAGCAGCCGGG - Intergenic
985493628 5:193000-193022 AGGCAGAGAGGGCAGCAGCTAGG + Intronic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
987469284 5:18309725-18309747 TCTCAGATGGGGCGGCTGCCAGG - Intergenic
988532775 5:32040658-32040680 TCCCAGATGGGGTGGCAGCCAGG - Intronic
988532845 5:32040926-32040948 TCCCAGATGGGGTGGCAGCCGGG - Intronic
988551982 5:32208038-32208060 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
988760671 5:34306906-34306928 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
989300163 5:39881704-39881726 TGGCAGAAGGGGAAGCAAACAGG + Intergenic
989634842 5:43522220-43522242 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
989655910 5:43746211-43746233 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
989663460 5:43824562-43824584 TCCCAGATGGGGCAGCTGCTGGG + Intergenic
990293885 5:54381461-54381483 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
990302283 5:54460764-54460786 TGGCAAAAGTGGCAGCAGCATGG + Intergenic
990709219 5:58563674-58563696 TCCCAGACGGGGCGGCAGCCAGG + Intergenic
990871021 5:60431269-60431291 TCTCAGACGGGGCAGCTGCCGGG + Intronic
991127391 5:63083940-63083962 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
992289619 5:75270339-75270361 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
992463811 5:76985174-76985196 TCTCAGATGGGGCAGTTGCCAGG + Intergenic
992506394 5:77391367-77391389 CGGCAGATGCTGCTGCAGCCAGG + Intronic
992540724 5:77761028-77761050 TCCCAGACGGGGCGGCAGCCGGG - Intronic
993934768 5:93986378-93986400 TCCCAGAGGGGGCAGCTGCCGGG - Intronic
994517175 5:100785771-100785793 TCCCAGATGGGGCGGCTGCCAGG - Intergenic
995140372 5:108728422-108728444 TGGGAGGTGGGGCAGGAGCACGG + Intergenic
995193298 5:109341439-109341461 TCTCAGACGGGGCAGCTGCCGGG - Intronic
995421087 5:111967666-111967688 TCCCAGATGGGGCGGCAGCTGGG - Intronic
996070072 5:119122539-119122561 TCTCAGATGGGGCGGCTGCCGGG + Intronic
996386340 5:122913578-122913600 TCTCAGATGGGGCGGCTGCCGGG + Intronic
996716175 5:126589833-126589855 TCCCAGATGGGGCGGCAGCTGGG - Intronic
996716199 5:126589951-126589973 TTCCAGATGGGGCAGCAGCTGGG - Intronic
997321726 5:132983516-132983538 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
997875062 5:137538664-137538686 TCCCAGACGGGGTAGCAGCCGGG + Intronic
998025289 5:138811113-138811135 TCTCAGATGGGGCGGCTGCCGGG + Intronic
998432198 5:142076539-142076561 TCTCAGACGGGGCAGCTGCCCGG + Intergenic
998475881 5:142421456-142421478 ATGGAGATGGGACAGCAGCCAGG + Intergenic
999120679 5:149207143-149207165 AGGCAGCTGGGGCAGGAGCAGGG - Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999322245 5:150622737-150622759 GGGCAGATGGAGCAGGAGCCTGG + Intronic
999455583 5:151713921-151713943 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
999771543 5:154779874-154779896 CTGCAGGTGGGGCAGCACCCTGG + Intronic
1000630232 5:163583782-163583804 TCGCAGACGGGGCGGCTGCCGGG + Intergenic
1000985350 5:167859269-167859291 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1001001170 5:168008515-168008537 TGGGAGATGGGACAGGAGACAGG + Intronic
1001077908 5:168643629-168643651 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1001394249 5:171404332-171404354 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1001399426 5:171437749-171437771 TGCCAGAAGGGGCAGCTGGCTGG + Intronic
1001515122 5:172350245-172350267 TGGAGGATGGGGGAGCAGCTGGG + Intronic
1001556569 5:172641256-172641278 CGGCAGCTGGGGCGGGAGCCGGG - Exonic
1001779687 5:174357296-174357318 TGGCAGATGGGGAAAGAGCAAGG + Intergenic
1002013641 5:176304985-176305007 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1002115763 5:176961430-176961452 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1002722775 5:181273542-181273564 CGGCAGGTGGGGCTGCAGCCCGG + Intergenic
1002848378 6:968858-968880 TGGCAGAGGGGGAAGCACCGGGG + Intergenic
1003707166 6:8545752-8545774 TGGTAGAGTAGGCAGCAGCCTGG - Intergenic
1004388062 6:15188926-15188948 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1004731776 6:18366307-18366329 TGGCTGAGGGGGCAGCAGCCTGG + Intergenic
1005715528 6:28543839-28543861 TGGTAGAGGGGGCAGGAGCCAGG + Intergenic
1005901701 6:30222134-30222156 TCCCAGACGGGGCAGCTGCCAGG + Intergenic
1006232462 6:32596150-32596172 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1006452185 6:34111692-34111714 GGTCAGAATGGGCAGCAGCCAGG + Intronic
1006492244 6:34397459-34397481 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1006617565 6:35340534-35340556 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1006623561 6:35383828-35383850 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1006800367 6:36756074-36756096 GGGCAGATGGAGCAACAGCCAGG - Intronic
1006830174 6:36963729-36963751 AAGGAGGTGGGGCAGCAGCCAGG - Intronic
1006922059 6:37633646-37633668 GGGCAGAAGGGTCTGCAGCCTGG + Exonic
1007654838 6:43445762-43445784 CGGCAGCAGGAGCAGCAGCCAGG - Exonic
1007663521 6:43501047-43501069 TGGCAGCTGGTACAGGAGCCAGG - Intronic
1007674317 6:43581090-43581112 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1008106359 6:47444126-47444148 TCCCAGATGGGGCGGCTGCCAGG + Intergenic
1008112205 6:47505998-47506020 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1008370093 6:50722114-50722136 TGAAAGAGGGGGCAGCAGCTAGG + Intronic
1008572047 6:52825587-52825609 TCCCAGATGGGGCAGCTGCCAGG - Intergenic
1008909929 6:56721160-56721182 TCCCAGATGGGGCGGCTGCCGGG + Intronic
1008909946 6:56721202-56721224 TCCCAGATGGGGCAGCTGCCAGG + Intronic
1008919231 6:56824765-56824787 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1009392780 6:63164103-63164125 TCTCAGATGGGGTGGCAGCCGGG - Intergenic
1010272028 6:73925896-73925918 TCCCAGACGGGGCAGCGGCCGGG + Intergenic
1010300713 6:74255550-74255572 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
1010513175 6:76744533-76744555 TCCCAGATGGGGCGGCTGCCAGG - Intergenic
1010874692 6:81087870-81087892 TGGCAGATGGGGCAGTTGTATGG - Intergenic
1012321685 6:97855306-97855328 TGGAAGGTGAGGCAGCAACCAGG + Intergenic
1012428690 6:99142136-99142158 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1013253046 6:108354047-108354069 TGGGAGATGGGGAAGCAGGGAGG + Intronic
1013530797 6:111017489-111017511 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1014165837 6:118223656-118223678 TGGGAGATGGGAGAGCAGACGGG + Intronic
1014463669 6:121729755-121729777 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1014557136 6:122849504-122849526 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1015059887 6:128950419-128950441 TGGAAGATGGGTGAGGAGCCAGG + Intronic
1015070619 6:129088626-129088648 TCCCAGATGGGGTAGCTGCCGGG + Intronic
1015070645 6:129088706-129088728 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1015476652 6:133664769-133664791 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1015843037 6:137493437-137493459 TGGCAGATGGTGCAGGGGCAGGG + Exonic
1016123628 6:140373905-140373927 TCCCAGATGGGGCGGCTGCCAGG + Intergenic
1016476448 6:144433539-144433561 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1016967124 6:149729357-149729379 TGGCAGATGGCAAAGCAGCCTGG - Intronic
1017434818 6:154406307-154406329 AGGCACTTGGGGCAGGAGCCAGG + Exonic
1017498350 6:155001220-155001242 TGTCATATGGGTGAGCAGCCTGG - Intronic
1017501077 6:155023542-155023564 TGACAGGTTGGGTAGCAGCCTGG + Intronic
1017805401 6:157941332-157941354 TGGCAGCTGGAACAGGAGCCTGG + Intronic
1017851531 6:158309127-158309149 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1017855797 6:158349391-158349413 TCCCAGATGGGGTGGCAGCCGGG + Intronic
1018064435 6:160115622-160115644 GTGCAGAGGGGGCAGCTGCCTGG - Intergenic
1018215036 6:161518429-161518451 TGGGAGGCTGGGCAGCAGCCTGG + Intronic
1018529549 6:164748150-164748172 AGGCAGATAGGGCAGGTGCCTGG - Intergenic
1018906617 6:168079530-168079552 GGGAAGATGGAGCAGCAGCAGGG + Intronic
1019445744 7:1070147-1070169 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1019534568 7:1522120-1522142 TGGAAGATGGGAAGGCAGCCTGG + Intergenic
1019715005 7:2534482-2534504 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1019759928 7:2803388-2803410 TGGCAGGTGGGACAGGAGGCAGG + Intronic
1020023969 7:4885485-4885507 TGGGAGATGGGCCAGGAGCAGGG - Intergenic
1020157260 7:5736762-5736784 TCCCAGATGGGGTCGCAGCCTGG - Intronic
1021120501 7:16790626-16790648 TCACAGATGGGGTAGCGGCCGGG + Intergenic
1021995579 7:26176421-26176443 TGGAAGATTGCACAGCAGCCAGG + Intronic
1022187973 7:27987665-27987687 TCCCAGATGGGGTGGCAGCCGGG - Intronic
1022230808 7:28410309-28410331 TGTCATTTGGGGCAGCGGCCGGG - Intronic
1022265863 7:28754284-28754306 AGGCAAGTGGGGCTGCAGCCCGG - Intronic
1022318104 7:29263863-29263885 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1022700348 7:32754009-32754031 TCCCAGATGGGGCGGCTGCCAGG - Intergenic
1022757174 7:33304571-33304593 TGGAAGATTGCACAGCAGCCAGG - Intronic
1023505046 7:40890473-40890495 CCTCAGATGGGGCAGAAGCCTGG - Intergenic
1023648398 7:42343164-42343186 TGGGAAGTGGGGAAGCAGCCTGG + Intergenic
1023720750 7:43091362-43091384 TGGAAGATGGGGAATCAGGCTGG - Intergenic
1023888680 7:44377751-44377773 TGCTAGCTGGGGAAGCAGCCAGG + Intergenic
1023889348 7:44381454-44381476 CTGCAGATGGGGCAGGATCCTGG + Exonic
1023935662 7:44738099-44738121 TGTCAGCTGGGGCCACAGCCAGG + Intergenic
1024101304 7:46035530-46035552 TGGCAGGAGGGGCAGCAGGGAGG + Intergenic
1024215389 7:47244167-47244189 TGGAAGAAGGGGGAGCATCCTGG - Intergenic
1024305138 7:47922670-47922692 TCCCAGACGGGGCAGCTGCCGGG - Intronic
1024563301 7:50662198-50662220 TGGCAGGAGGGGCAGCTTCCTGG + Intronic
1024676209 7:51640027-51640049 TGGAAGAAGGGGCGGCAGCTAGG + Intergenic
1024989198 7:55220386-55220408 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1025102876 7:56150558-56150580 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1025775202 7:64554427-64554449 TCCCAGACGGGGCAGCGGCCGGG - Intronic
1025796061 7:64738994-64739016 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1025803663 7:64809654-64809676 TCCCAGATGGGGCTGCTGCCGGG + Intronic
1025808276 7:64856310-64856332 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1026163567 7:67890503-67890525 TCCCAGATGGGGCGGCGGCCGGG - Intergenic
1026186189 7:68083485-68083507 TCCCAGATGGGGCAGCTGCCGGG - Intergenic
1026186238 7:68083677-68083699 TGGAAGATTGCACAGCAGCCAGG - Intergenic
1026479250 7:70764220-70764242 CGGCCGAGGGGGCAGAAGCCGGG - Intronic
1026783447 7:73284520-73284542 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1026873114 7:73865220-73865242 TGGCATGTGGGGCAGCACCAAGG + Exonic
1027052321 7:75028061-75028083 TGGCGGATGGGGCAGGTGCCTGG + Intronic
1027058243 7:75065045-75065067 TCCCAGATGGGGCAGTGGCCAGG - Intronic
1027187245 7:75979835-75979857 TGGGAGATGTGGCGGCCGCCAGG - Intronic
1027628586 7:80574946-80574968 TGGCAGCTGCAGCAGCAGCAGGG + Intronic
1027826782 7:83125323-83125345 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1028399132 7:90405643-90405665 TGGCAGATGTGGTAGCAGGAGGG - Intronic
1028535741 7:91888019-91888041 TTCCAGACGGGGCAGCTGCCGGG - Intergenic
1028595661 7:92545050-92545072 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1029405849 7:100373667-100373689 GGGCAGTAGGGGCAGCAGCAGGG - Exonic
1029468965 7:100742063-100742085 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1029724120 7:102390925-102390947 TGGCAGAAGGGACATCACCCTGG + Intronic
1029813171 7:103069267-103069289 TTCCAGATGGGGCGGCAACCAGG - Intronic
1029960692 7:104686843-104686865 TGGCAGAAGGGGAAGCAAACAGG + Intronic
1029972070 7:104799649-104799671 AGGCAGAGAGGGCAGAAGCCAGG - Intronic
1030209698 7:106984174-106984196 TGGCAGATCAGACAGGAGCCAGG - Intergenic
1030288304 7:107848272-107848294 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1032028660 7:128463619-128463641 TGCCAGACGGGGCGGCTGCCGGG - Intergenic
1032156924 7:129476453-129476475 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1032418292 7:131755980-131756002 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
1032418304 7:131756020-131756042 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
1032418326 7:131756097-131756119 TCCCAGATGGGGCGGCGGCCGGG + Intergenic
1032466305 7:132147782-132147804 GGGGAGATGGGGCATCAGACAGG - Intronic
1033499455 7:141933350-141933372 AGGCAGGTGGGGAAGCAGCCTGG + Intronic
1033676289 7:143542720-143542742 TGGCAAAAGTGTCAGCAGCCTGG - Intergenic
1033695544 7:143786719-143786741 TGGCAAAAGTGTCAGCAGCCTGG + Intergenic
1034274952 7:149819941-149819963 TGGCCCATGAGGTAGCAGCCAGG - Intergenic
1034322511 7:150198643-150198665 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1034322869 7:150201230-150201252 TGGCAGGTGGGGCAGCACCTGGG - Intergenic
1034770316 7:153767893-153767915 TGGCAGGTGGGGCAGCACCTGGG + Intergenic
1035507993 8:150126-150148 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1035825181 8:2637346-2637368 TGGCAGAAGGGGCAGAAGGAAGG + Intergenic
1035869345 8:3120190-3120212 GGGCAGAGGGGCCAGCAGACAGG + Intronic
1036269618 8:7293931-7293953 GGGCAGGTGCTGCAGCAGCCCGG - Intergenic
1036298276 8:7553126-7553148 GGGCAGGTGCTGCAGCAGCCCGG + Intergenic
1036299581 8:7560776-7560798 GGGCAGGTGCTGCAGCAGCCCGG + Intergenic
1036300886 8:7568422-7568444 GGGCAGGTGCTGCAGCAGCCCGG + Intergenic
1036302192 8:7576070-7576092 GGGCAGGTGCTGCAGCAGCCCGG + Intergenic
1036303483 8:7583714-7583736 GGGCAGGTGCTGCAGCAGCCCGG + Intergenic
1036324298 8:7767894-7767916 GGGCAGGTGCTGCAGCAGCCCGG - Intergenic
1036353042 8:8024059-8024081 GGGCAGGTGCTGCAGCAGCCCGG + Intergenic
1036354337 8:8031706-8031728 GGGCAGGTGCTGCAGCAGCCCGG + Intergenic
1036445835 8:8821146-8821168 TGTCAGAGGGAGCAGCTGCCAGG + Intronic
1036536757 8:9657837-9657859 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1036624969 8:10462886-10462908 TGGCAGAAGGGGAAGCAAACAGG + Intergenic
1036664437 8:10729894-10729916 GGGGAGACGGGGCAGCGGCCAGG - Intronic
1036695947 8:10975261-10975283 TGGGTGATGGGGGAGCAGCCTGG - Intronic
1036737185 8:11329996-11330018 TCCCAGACGGGGCAGCTGCCAGG - Intergenic
1036868340 8:12419136-12419158 GGGCAGGTGCTGCAGCAGCCCGG + Intergenic
1037134576 8:15445963-15445985 TCGCGGATGGGGCAGCTGCCCGG + Intronic
1038428454 8:27480762-27480784 TGGCAGCGGTGGCAGCAGCAGGG - Intergenic
1039153376 8:34529359-34529381 TCTCAGATGGGGCGGCTGCCGGG + Intergenic
1039445770 8:37630654-37630676 TTGCAGAGGGAGCAGCAGGCAGG - Intergenic
1039488213 8:37927920-37927942 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1039612484 8:38930743-38930765 TGGCTGCTGGTGCAGCAGCCAGG + Intronic
1039650908 8:39339252-39339274 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1040043526 8:42939759-42939781 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1040121172 8:43687472-43687494 TCCCAGATGGGGCAGCTGGCCGG + Intergenic
1040616231 8:49041491-49041513 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1040728159 8:50408711-50408733 TGGCAGATGGGTCAAAACCCAGG + Intronic
1040916993 8:52573603-52573625 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1040917002 8:52573643-52573665 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
1041070747 8:54125324-54125346 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1041192580 8:55368451-55368473 TCCTTGATGGGGCAGCAGCCAGG - Intronic
1041362919 8:57071477-57071499 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1041728031 8:61036383-61036405 CTGCAGGTGGGGCAGCAACCTGG + Intergenic
1041796658 8:61753279-61753301 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1042134028 8:65616932-65616954 TCCCAGACGGGGCAGCTGCCGGG - Intronic
1042196041 8:66232345-66232367 TCTCAGATGGGGCAGTTGCCAGG - Intergenic
1042290726 8:67167493-67167515 TCCCAGACGGGGCAGCTGCCGGG + Intronic
1042290750 8:67167573-67167595 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1042303534 8:67310856-67310878 TCTCAGACGGGGCAGCTGCCAGG - Intronic
1042710726 8:71714034-71714056 TGGCAGAAGGGGAAGCAAACAGG - Intergenic
1042951441 8:74204227-74204249 TGGCAGCAGCTGCAGCAGCCAGG + Intergenic
1043951221 8:86311356-86311378 AGGCAGATGGGGCAGGTCCCTGG + Intronic
1043961615 8:86424081-86424103 TCTCAGATGGGGCGGCTGCCAGG + Intronic
1043986017 8:86694496-86694518 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1044436538 8:92170922-92170944 TGGCTGTTGGGGCAGCAGCAGGG + Intergenic
1044582211 8:93834426-93834448 TCCCAGATGGGGTGGCAGCCAGG + Intergenic
1044582224 8:93834466-93834488 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1044660582 8:94590694-94590716 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1044996263 8:97840901-97840923 TCCCAGATGGGGTGGCAGCCGGG + Intronic
1044996310 8:97841097-97841119 TCCCAGATGGGGCAGCAGCCGGG + Intronic
1045021904 8:98051790-98051812 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
1045195652 8:99927342-99927364 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
1045485936 8:102631233-102631255 TTGCTGCTGGGGCAGCAGCAGGG + Intergenic
1047687230 8:127316320-127316342 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1047848165 8:128826703-128826725 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1048088879 8:131217319-131217341 TGGCAGGTGGGGCACCTGTCTGG + Intergenic
1048368289 8:133757314-133757336 TCACAGATGGGGTAGCGGCCGGG - Intergenic
1048368379 8:133757663-133757685 TCTCAGATGGGGCAGTTGCCAGG - Intergenic
1048491362 8:134896725-134896747 TGGTAGAAGGGGAAGCAGGCAGG + Intergenic
1048848285 8:138620263-138620285 GGGCAGAAGGGGCAGCAAGCTGG + Intronic
1049103670 8:140597882-140597904 TGGCAGATGACGCAACAGCCCGG - Intronic
1049299975 8:141864379-141864401 TGGGAGATGTGTCATCAGCCTGG - Intergenic
1049361834 8:142215675-142215697 AGGCCAAGGGGGCAGCAGCCTGG + Intronic
1049473648 8:142787182-142787204 GGGCAGCTGGGGCAGCAGTGAGG + Intergenic
1049481617 8:142827049-142827071 TCCCAGACGGGGCAGCTGCCGGG + Intergenic
1049775264 8:144401080-144401102 GGGCAGAGGGGGCATCAGCCAGG + Intronic
1049812389 8:144581348-144581370 TCGCAGCTGGGGCTGGAGCCGGG - Intronic
1049975941 9:861623-861645 TCCCAGAAGGGGCAGCGGCCGGG + Intronic
1050160974 9:2718325-2718347 AAGCAGATGCGGCAGCAGCGTGG - Exonic
1050558170 9:6807681-6807703 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1051258064 9:15234152-15234174 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1051258129 9:15234327-15234349 TGCCAGATGGGGCGGCTGGCTGG - Intronic
1051276870 9:15406625-15406647 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1051615096 9:18999444-18999466 TGCCAGATGGTGGGGCAGCCGGG - Intronic
1052274842 9:26664451-26664473 TCCCAGATGGGGCTGCTGCCGGG - Intergenic
1052274865 9:26664528-26664550 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1052887983 9:33667752-33667774 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1053457187 9:38242030-38242052 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1054359726 9:64101144-64101166 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1054806007 9:69396285-69396307 TGGCAGATGGTTCACCATCCTGG + Intergenic
1055137550 9:72841608-72841630 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1055214916 9:73847674-73847696 TGCTAGATGTGGCAGCAACCAGG - Intergenic
1055414352 9:76064607-76064629 TCTCAGACGGGGCAGCTGCCAGG + Intronic
1055580464 9:77702780-77702802 TCCCAGATGGGGCGGCAGCCGGG + Intergenic
1055586052 9:77761006-77761028 TCTCAGATGGGGCGGCTGCCGGG - Intronic
1055903974 9:81271393-81271415 GGGCAGCTTGGACAGCAGCCTGG + Intergenic
1056084113 9:83128253-83128275 AGGCAGATGGGGCAGATCCCTGG + Intergenic
1056097911 9:83273105-83273127 TCCCAGATGGGGTGGCAGCCGGG - Intronic
1056120476 9:83482985-83483007 TGGCAGATGTGGCAGCACTTTGG + Intronic
1056318360 9:85413795-85413817 TGGAAGATGGGGAAGCAGCAGGG - Intergenic
1056336447 9:85573903-85573925 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1057071784 9:92105555-92105577 TCCCAGATGGTGGAGCAGCCGGG - Intronic
1057630477 9:96715716-96715738 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1057716181 9:97498129-97498151 TCCCAGATGGGGCGGCTGCCAGG + Intergenic
1058425902 9:104874963-104874985 TCCCAGATGGGGCGGCGGCCGGG - Intronic
1058569478 9:106325045-106325067 TCACAGATGTGGCTGCAGCCTGG - Intergenic
1058659954 9:107257704-107257726 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1058722519 9:107776155-107776177 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1059120782 9:111640725-111640747 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1059210977 9:112514190-112514212 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1059239638 9:112793199-112793221 TGTCAGATGGGAAAGAAGCCTGG + Intronic
1059512949 9:114866037-114866059 TGGGAGATGCGACAGCATCCAGG + Intergenic
1059879923 9:118678205-118678227 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1060041440 9:120304749-120304771 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1060041517 9:120305058-120305080 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1060052375 9:120386592-120386614 TGGGAGGTGGAGGAGCAGCCTGG - Intergenic
1060064897 9:120495543-120495565 TCTCAGATGGGGCAGCTGCCGGG - Intronic
1060230943 9:121824828-121824850 TGGCACTGGGGGCAGCAGCCTGG + Intronic
1060283508 9:122228918-122228940 AGGCAGCGGCGGCAGCAGCCAGG - Intronic
1060297823 9:122355190-122355212 GGGCAGATGGGGCAGAAATCAGG + Intergenic
1060584429 9:124777293-124777315 CGGCAGAAGGAGCAGCGGCCGGG - Exonic
1060625543 9:125108514-125108536 TCCCAGATGGGGTCGCAGCCGGG - Intronic
1060687052 9:125623595-125623617 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1061061290 9:128251573-128251595 GAGCAGCTGGGGAAGCAGCCTGG + Intronic
1061241792 9:129378706-129378728 TGGGAGATGGGTGAGCATCCAGG + Intergenic
1061495836 9:130973737-130973759 TGACAGCTGGGGCAGGAGGCCGG - Intergenic
1061533065 9:131229891-131229913 TGGGAGAAGGGGCAGCACCTGGG - Intronic
1061969209 9:134034866-134034888 AGACCGATGGGGCAGGAGCCAGG + Intronic
1061977299 9:134075878-134075900 TCCCAGAAGGGGCGGCAGCCAGG - Intergenic
1061983974 9:134118576-134118598 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1061994990 9:134178673-134178695 TGCCAGGTGGGGCAACTGCCTGG + Intergenic
1062005772 9:134237763-134237785 TGGCAGAGGGGGCAGATGTCAGG - Intergenic
1062032383 9:134367568-134367590 TGGCCGAGGGGCCAGGAGCCGGG - Intronic
1062096485 9:134706491-134706513 AGGCGGATGGGAGAGCAGCCAGG + Intronic
1062208251 9:135349011-135349033 TGGCAGATGAGGCCTGAGCCTGG - Intergenic
1203436085 Un_GL000195v1:138265-138287 TGGCCGCTGGGCCAGCAGCGAGG + Intergenic
1203562645 Un_KI270744v1:71614-71636 TCTCAGATGGGGCGGCTGCCGGG - Intergenic
1185584535 X:1235175-1235197 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1185633541 X:1535089-1535111 TGGGAAAAGGGGCAGCATCCTGG + Intronic
1186922978 X:14302774-14302796 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1187183574 X:16965059-16965081 TCCCAGATGGGGCAGCTGGCCGG + Intronic
1187183741 X:16965462-16965484 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1187447971 X:19374441-19374463 GGACAGCTGGGGCAGCACCCTGG - Intronic
1187518093 X:19990799-19990821 TGGCGGATGGGGCAGCGGGGAGG - Intergenic
1187976577 X:24709586-24709608 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1188214314 X:27458595-27458617 TCCCAGATGGGGTGGCAGCCAGG - Intergenic
1188477090 X:30602290-30602312 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1189056950 X:37707791-37707813 TCCCAGATGGGGTGGCAGCCGGG + Intronic
1189361720 X:40358758-40358780 TGGCTGAGGGGGCAGCAGCCTGG + Intergenic
1189416447 X:40818452-40818474 TGGCAGATCTGTCAGAAGCCTGG + Intergenic
1189587246 X:42474140-42474162 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1189587257 X:42474180-42474202 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1190159045 X:48017063-48017085 TCCCAGATGGGGCGGCTGCCGGG - Intronic
1190465130 X:50718461-50718483 GGGCAGCTGGGGCAGCAGGAGGG + Intronic
1190505247 X:51119650-51119672 TCCCAGACGGGGCAGCTGCCAGG + Intergenic
1190618076 X:52258731-52258753 TTGCAGGTAGGCCAGCAGCCTGG - Intergenic
1190680948 X:52827064-52827086 TCTCAGACGGGGCAGCTGCCAGG + Intergenic
1190712748 X:53081766-53081788 TGGGAGAAGGGGCAGAAGCGGGG + Intergenic
1190712757 X:53081790-53081812 TGGGAGAAGGGGCAGGAGCTGGG + Intergenic
1190820311 X:53967031-53967053 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1190820334 X:53967111-53967133 TCCCGGATGGGGCAGCTGCCAGG - Intronic
1190887288 X:54541161-54541183 TGGCAGAGGTGGCAGGAGCAGGG - Intronic
1190891522 X:54572782-54572804 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1190906907 X:54736786-54736808 TCCCAGATGGGGCAGCGGCCGGG - Intergenic
1190973096 X:55371762-55371784 TGGAAGATTGTACAGCAGCCAGG + Intergenic
1191069004 X:56380362-56380384 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1191069014 X:56380402-56380424 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1191637359 X:63393197-63393219 TCTCAGATGGGGCAGTTGCCAGG - Intergenic
1191717901 X:64205621-64205643 TGGCAGCCGAGGCTGCAGCCCGG - Exonic
1192352880 X:70371800-70371822 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1192352892 X:70371840-70371862 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1192370201 X:70506706-70506728 AGCAAGATGGGGCAGCAGCAAGG - Intergenic
1192530246 X:71877021-71877043 TCCCAGATGGGGCGGCTGCCAGG + Intergenic
1192610305 X:72559959-72559981 TCCCAGACGGGGCAGCGGCCGGG - Intronic
1192621197 X:72681324-72681346 TCTCAGACGGGGCAGCTGCCGGG - Intronic
1192658988 X:73022218-73022240 TCCCAGATGGGGTGGCAGCCGGG + Intergenic
1192664065 X:73069509-73069531 TCCCAGATGGGGCAGTGGCCGGG - Intergenic
1192739966 X:73882570-73882592 TCCCAGATGGGGCAGTGGCCAGG - Intergenic
1192761308 X:74098529-74098551 TCCCAGATGGGGCAGCTGCCGGG - Intergenic
1192794186 X:74412742-74412764 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1192969896 X:76218417-76218439 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1193047231 X:77066153-77066175 TGGAAGATTGAACAGCAGCCAGG - Intergenic
1193068051 X:77279420-77279442 TCTCAGACGGGGCAGCTGCCGGG - Intergenic
1193068142 X:77279649-77279671 TCCCAGATGGGGCAGCTGGCCGG - Intergenic
1193132421 X:77932141-77932163 TCTCAGATGGGGCAGTTGCCGGG + Intronic
1193362107 X:80590799-80590821 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1193362215 X:80591228-80591250 TCCCAGACGGGGCAGCTGCCGGG - Intergenic
1193924369 X:87466112-87466134 TCCCAGATGGGGCGGCTGCCGGG - Intergenic
1194241811 X:91458338-91458360 TGGCAGAAGGGGAAGCAAACAGG - Intergenic
1194714667 X:97275474-97275496 TCCCAGATGGGGCGGCTGCCGGG + Intronic
1194732776 X:97475115-97475137 TGTCAGATAAGGCAGCAGCCAGG - Intronic
1195036205 X:100972910-100972932 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1195100526 X:101550897-101550919 TGGTAGATGGGCCAGCACACAGG - Intronic
1195257578 X:103104672-103104694 TCTCAGACGGGGCAGCTGCCAGG + Intergenic
1195978987 X:110558498-110558520 TGCTAGATGGGGCAGTGGCCGGG + Intergenic
1195979023 X:110558655-110558677 TTCCAGATGGGGCGGCCGCCGGG + Intergenic
1196142355 X:112277712-112277734 AGGTAGAGGGGGCAGCTGCCTGG - Intergenic
1196172326 X:112603424-112603446 TTGCAGATGGCTCAGGAGCCAGG - Intergenic
1196404497 X:115347786-115347808 TCTCAGACGGGGCAGCTGCCGGG + Intergenic
1196973833 X:121137673-121137695 TGCCAGCTGGGGAAACAGCCAGG - Intergenic
1198108637 X:133483887-133483909 TCCCAGATGGGGCGGCTGCCGGG + Intergenic
1198121534 X:133597428-133597450 TGGGTGATGGGGAAGAAGCCAGG - Intronic
1198189132 X:134286023-134286045 TCCCAGATGGGGCAGCTGCCGGG + Intergenic
1199026512 X:142945257-142945279 TGGCGGAAGGGGAAGCAGGCAGG - Intergenic
1199452707 X:147992613-147992635 TCTCAGACGGGGCAGCTGCCGGG + Intronic
1199586346 X:149420538-149420560 TCCCAGATGGGGTGGCAGCCGGG - Intergenic
1199586400 X:149420772-149420794 TCCCAGATGGGGTCGCAGCCGGG - Intergenic
1199782321 X:151073880-151073902 TCCCAGACGGGGCAGCAGCTGGG + Intergenic
1199782339 X:151073956-151073978 TCCCAGATGGTGCAGCGGCCGGG + Intergenic
1199836700 X:151599342-151599364 TCCCAGATGGGGCAGCGGCCGGG + Intronic
1200167375 X:154046220-154046242 TGGGGGACGGGGCAGGAGCCTGG - Intronic
1200324588 X:155223878-155223900 TCTCAGATGGGGCGGCTGCCGGG + Intronic
1200387431 X:155907835-155907857 TCGCAGACGGGGCGGCTGCCGGG + Intronic
1200909495 Y:8517396-8517418 TGGCACATGGGCCATCAGCCAGG - Intergenic
1200952919 Y:8918208-8918230 TCTCAGATGGGGCGGCTGCCAGG + Intergenic
1200985825 Y:9303190-9303212 TGGCACAGGGGCCATCAGCCAGG + Intergenic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic
1201963805 Y:19709697-19709719 TTGGAGAGGGGGCAGCAGCTGGG - Exonic
1202124751 Y:21557705-21557727 TGGCACAGGGGCCATCAGCCAGG - Intergenic
1202154257 Y:21871675-21871697 TGGCACAGGGGCCATCAGCCAGG + Intergenic