ID: 1165548167

View in Genome Browser
Species Human (GRCh38)
Location 19:36559961-36559983
Sequence AAAAACAAAGAGAAGTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5081
Summary {0: 1, 1: 2, 2: 26, 3: 382, 4: 4670}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165548163_1165548167 4 Left 1165548163 19:36559934-36559956 CCCAGGCAGTAATACAAATCCAT 0: 1
1: 0
2: 0
3: 14
4: 196
Right 1165548167 19:36559961-36559983 AAAAACAAAGAGAAGTGGCCTGG 0: 1
1: 2
2: 26
3: 382
4: 4670
1165548164_1165548167 3 Left 1165548164 19:36559935-36559957 CCAGGCAGTAATACAAATCCATA 0: 1
1: 0
2: 2
3: 14
4: 155
Right 1165548167 19:36559961-36559983 AAAAACAAAGAGAAGTGGCCTGG 0: 1
1: 2
2: 26
3: 382
4: 4670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165548167 Original CRISPR AAAAACAAAGAGAAGTGGCC TGG Intronic
Too many off-targets to display for this crispr