ID: 1165554300

View in Genome Browser
Species Human (GRCh38)
Location 19:36616901-36616923
Sequence CAGGGTGGACAGAGGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1035
Summary {0: 1, 1: 0, 2: 9, 3: 105, 4: 920}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165554285_1165554300 26 Left 1165554285 19:36616852-36616874 CCTAAAGTTCAAGTGACTGTAGG 0: 3
1: 1
2: 6
3: 15
4: 131
Right 1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG 0: 1
1: 0
2: 9
3: 105
4: 920

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165554300 Original CRISPR CAGGGTGGACAGAGGGATGG AGG Intronic
900204721 1:1427076-1427098 CAGGGCGGGAAGAGGGAGGGGGG - Intronic
900470243 1:2850137-2850159 AGGGCGGGACAGAGGGATGGCGG - Intergenic
900485707 1:2921692-2921714 CTGGATGGACAGATGGACGGAGG - Intergenic
900485716 1:2921734-2921756 CTGGATGGACAGATGGACGGAGG - Intergenic
900485725 1:2921776-2921798 CTGGATGGACAGATGGACGGAGG - Intergenic
900485735 1:2921818-2921840 CTGGATGGACAGATGGACGGAGG - Intergenic
900485744 1:2921860-2921882 CTGGATGGACAGATGGACGGAGG - Intergenic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
900679472 1:3908755-3908777 CAGGCTGTACAGGGGCATGGTGG + Intergenic
900863105 1:5246579-5246601 GAGGGAGGAGAGAGGGAGGGAGG - Intergenic
901032584 1:6316262-6316284 GAGGGAGGACAGAGACATGGGGG + Intronic
901037279 1:6343900-6343922 CTGGGTGTACAGAGGGGTGTGGG + Intronic
901078428 1:6569996-6570018 CAGGGAGGAGAGAGGGAGGGAGG + Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901192306 1:7419936-7419958 CAGGATGGAGGGCGGGATGGTGG - Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901757102 1:11448084-11448106 CAGGGCGGCCTGAGGGCTGGGGG + Intergenic
902074809 1:13775860-13775882 CAGGGTGGGTGAAGGGATGGGGG - Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902398294 1:16144135-16144157 CAGGAGGGAGAGAGGGAGGGAGG + Intronic
902408272 1:16198434-16198456 CAGGCTGGACACAGGAATGGGGG - Exonic
902490625 1:16778250-16778272 GAGAGTGGACTGAGGGATGAGGG + Intronic
902525431 1:17054165-17054187 CCGGGTGGGCGGAGGGAAGGCGG + Exonic
902799085 1:18818385-18818407 TAGGGTGGAGGGAGGGCTGGAGG + Intergenic
902810459 1:18885221-18885243 GAGCGAGGACAGAGGGATGGAGG + Intronic
902833108 1:19030192-19030214 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903179606 1:21598510-21598532 GGGGGTGGAAAGAGGGAGGGAGG + Intronic
903295967 1:22343188-22343210 CAGGGTGGACAGGGAGACGATGG + Intergenic
903341664 1:22658752-22658774 ATAGATGGACAGAGGGATGGAGG + Intronic
903341745 1:22659071-22659093 ATGGATGGACAGGGGGATGGAGG + Intronic
903800269 1:25961992-25962014 CAGGCTGGACAGATGGTGGGGGG + Exonic
904054036 1:27658691-27658713 CAACGTGGGCAGAGGGAAGGAGG + Intergenic
904335413 1:29794107-29794129 CAGGAGGGAGAGAGGGAGGGAGG - Intergenic
904416134 1:30362097-30362119 CAGTGTAGACAGGGGTATGGAGG - Intergenic
904424667 1:30415662-30415684 CAGGGTGGAATCAGGGCTGGAGG + Intergenic
904625611 1:31800225-31800247 CAGGGTGGACTGGAGGAGGGAGG - Intronic
905033396 1:34902408-34902430 CAGAGTGGACAGAGGGATCCTGG + Intronic
905170385 1:36106487-36106509 GTGGGTGGACAGGGGGATGGGGG + Intronic
905282677 1:36859290-36859312 CAGGGTGGGCTGAGGACTGGAGG - Intronic
905314407 1:37072597-37072619 CTGGCTGGGCAGAGGGTTGGGGG - Intergenic
905481892 1:38267669-38267691 GAGGGAGGAAAGAGGGAGGGAGG - Intergenic
905797509 1:40823934-40823956 CAGGGTGGACAGTGGGAGACTGG - Intronic
906224032 1:44106266-44106288 GAGGATGGACAGAGGGACAGAGG - Intergenic
906484820 1:46226160-46226182 CAGGGTGGAAAGTGGGCAGGAGG + Intergenic
906646128 1:47476509-47476531 AAGGGCGGACAGGTGGATGGAGG - Intergenic
906776708 1:48536313-48536335 CAGGGTGCTCACAGGGGTGGAGG + Intronic
907437537 1:54459108-54459130 AAGGAAGGACAGAGGGAGGGAGG + Intergenic
907550226 1:55298820-55298842 TAGGGTGTAGAGAGGGATGCTGG + Intergenic
907878415 1:58518443-58518465 CAGGGTGGAGAATGGAATGGAGG + Intronic
907919049 1:58895994-58896016 CAGGATGGGCACAGGGCTGGGGG + Intergenic
908495275 1:64688634-64688656 GAGGCTGGACAGAAGGAAGGTGG - Intronic
908565434 1:65351017-65351039 CAGTGTGGACATAGGGATTAGGG - Intronic
909019097 1:70411531-70411553 CGTGGTGGACAGTGAGATGGGGG - Exonic
909958349 1:81803440-81803462 CAGAGTGAACAGAGGATTGGAGG - Intronic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
911090598 1:94014202-94014224 AAGGATGGAGGGAGGGATGGAGG + Intronic
911167163 1:94734653-94734675 AAAGGTGGGGAGAGGGATGGGGG - Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
911596271 1:99801739-99801761 CAGCTTGAACTGAGGGATGGAGG - Intergenic
911771416 1:101747317-101747339 CACTGTGGAGAGAGGTATGGAGG + Intergenic
911829262 1:102530111-102530133 CAGGGAGGGCAGCAGGATGGAGG - Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
912848907 1:113104252-113104274 GTGGGTGGACAGATGGATGGAGG - Intronic
915081326 1:153354660-153354682 GAGGTTGGACTGAGGGATGGTGG - Intergenic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
915444431 1:155966788-155966810 CAGGGAGGGCAGAGGGCTGGGGG - Intronic
915581689 1:156816608-156816630 GAGGGAGGGCAGGGGGATGGGGG + Intronic
915615336 1:157033461-157033483 AAGGGTGGAGAGAGGGAAGATGG - Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
915835757 1:159173346-159173368 CACGATGGAGACAGGGATGGGGG - Intronic
915972178 1:160362671-160362693 CAGGGAAGACAGATGGATGGGGG + Intergenic
916403608 1:164475118-164475140 GACAGTGGGCAGAGGGATGGCGG + Intergenic
916621893 1:166507318-166507340 GAGGGTGGAGAGTGGGATGAGGG - Intergenic
916742443 1:167658181-167658203 GAGGCTGGACACAGGGAGGGGGG - Intronic
917484959 1:175447383-175447405 GAGGGTGGGCAGCGGGAAGGAGG + Intronic
917517692 1:175721845-175721867 CAGGCTGGTCAGTGGGGTGGGGG - Intronic
917856163 1:179101778-179101800 CAGGCTGGACTGAGTCATGGGGG + Exonic
917987875 1:180339531-180339553 TAGGGTGGAAGGAGGGAGGGAGG + Intronic
918112074 1:181464839-181464861 CAGGATGGTCAGAGGTAAGGTGG - Intronic
918251160 1:182704642-182704664 CATGGTGGAAAGAGGAATCGGGG + Intergenic
918259207 1:182779546-182779568 CAGGTTGGACAGATGGACAGTGG - Intergenic
918987426 1:191651105-191651127 CAGGGTGGTGCGAGGGATAGTGG - Intergenic
919847235 1:201649676-201649698 GAGGCTGGACAATGGGATGGGGG + Intronic
919866745 1:201788445-201788467 CTGGAAGGACAGAGGGAAGGGGG - Intronic
920434310 1:205938310-205938332 CAGGGTGGGTGGAGGTATGGAGG - Intronic
920496872 1:206461179-206461201 CTGGGTGTGCAGAGGGCTGGAGG - Exonic
920687964 1:208124217-208124239 GAGGGTGGAGGGAGGGAAGGGGG + Intronic
921095299 1:211882069-211882091 GAGTGGGGAGAGAGGGATGGGGG - Intergenic
921955988 1:220983751-220983773 CAGGCTCGGCTGAGGGATGGGGG - Intergenic
922130293 1:222771019-222771041 CAAGGTGGACAGATGGCTTGAGG + Intergenic
922384338 1:225067108-225067130 GAGGGTGGAGAGTGGGATGAGGG - Intronic
922468188 1:225859235-225859257 CATGGTGGACAGGATGATGGAGG + Exonic
922778673 1:228232078-228232100 CAGGGTGGCCAGATGGTGGGGGG - Intronic
922994912 1:229948430-229948452 CAGGACGGAGAGTGGGATGGGGG - Intergenic
923482233 1:234396456-234396478 CAGGGTGAAGAGAGGGACGGAGG - Intronic
923529818 1:234804285-234804307 GAGAGTGGACTGAGGGATGAGGG - Intergenic
923803145 1:237229853-237229875 CAGAGTGGACGCAGGGTTGGTGG - Intronic
923835762 1:237609335-237609357 AAGGGGGGAGGGAGGGATGGAGG - Intronic
924119913 1:240785661-240785683 CATGGTGGAGAGAGGGATGGGGG + Intronic
924189778 1:241538349-241538371 CAAGGTAGAAAGAGGGTTGGTGG + Intronic
924633439 1:245763373-245763395 CAGGGTGGGCAGAGAGCTGTAGG + Intronic
1062818438 10:516832-516854 GAGGGGGGACAGGGGGATGGGGG + Intronic
1062928761 10:1338723-1338745 CATGGTGGATAGAGAGGTGGAGG + Intronic
1063371511 10:5525607-5525629 CAGGGGAGGCAGGGGGATGGGGG - Exonic
1063434341 10:6018304-6018326 CAGGGAGGACAGGGTGAGGGTGG + Intronic
1063899752 10:10720086-10720108 AAGGGCAGACAGTGGGATGGTGG + Intergenic
1064346863 10:14540527-14540549 GGGGGAGGACAGAGGGAGGGTGG - Intronic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1066236517 10:33490154-33490176 CAGGGTGGAGGGAGGGACGGAGG + Intergenic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1069560736 10:69427582-69427604 TAGAGTGGAGAGAGGGAAGGAGG - Intergenic
1069604578 10:69731486-69731508 CAGGATGGAGGGAGGGAGGGAGG - Intergenic
1069629826 10:69890625-69890647 GTGGGTGGAAAGGGGGATGGTGG + Intronic
1069692634 10:70363946-70363968 CAGGGAGGAGAGGGGGCTGGAGG - Intronic
1069720079 10:70544327-70544349 CAGGCAGGACTGAGGGGTGGGGG + Intronic
1069740659 10:70685121-70685143 CAGGCTGGTGAGAGTGATGGGGG + Intronic
1069813773 10:71180651-71180673 CTGGCTGGACAGATGGATGTAGG - Intergenic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070242006 10:74691501-74691523 AAGGGTGGGGTGAGGGATGGAGG + Intronic
1070331629 10:75421665-75421687 CAGGGTGGACAGGGTGATTAGGG + Intergenic
1070545238 10:77446872-77446894 CAGTGTGAACAAAGGTATGGAGG - Intronic
1070739467 10:78893139-78893161 AGGGATGGACAGAGGGAGGGAGG + Intergenic
1070760945 10:79024098-79024120 AAGGGTAGACAGAGGGGGGGGGG + Intergenic
1071221010 10:83464375-83464397 CAAGGAGGACAGAGGAATGTAGG - Intergenic
1071849379 10:89552984-89553006 CAAAGTGGACAGAGGGACGGAGG - Intronic
1072609791 10:97010617-97010639 GTGGGTGGCCAGAGGGAGGGTGG + Intronic
1072635822 10:97177175-97177197 CAGGTTGGAGAGAGAGATGGGGG - Intronic
1073250267 10:102117000-102117022 CAGGGTGGGCTGGGGGGTGGGGG + Intronic
1073462870 10:103676642-103676664 GTGGGTGGACAGAGGGGTGCTGG + Intronic
1074690767 10:116002158-116002180 CAGGGCCGGCAGGGGGATGGTGG + Intergenic
1074699930 10:116083890-116083912 CAGAGTGGCAGGAGGGATGGAGG - Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1074896342 10:117780711-117780733 ATGGGTGGATAGATGGATGGAGG - Intergenic
1074909990 10:117899718-117899740 AAGGAGGGACAGAGGGAGGGAGG + Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075518199 10:123126484-123126506 AAGGCTGGACAGAGGGCAGGAGG - Intergenic
1075666424 10:124234001-124234023 CCTGGTGGACAGAGGGCTGGGGG - Intergenic
1076201197 10:128559611-128559633 CATGGTGGACATTGGGATGGAGG - Intergenic
1076383821 10:130043535-130043557 CAGGGCTGACAGAGGGGTTGGGG - Intergenic
1076437904 10:130459256-130459278 CAGGGAAGTCAGAGGGGTGGAGG + Intergenic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076504788 10:130964467-130964489 CAGGAAGGACAGATGGATGGTGG - Intergenic
1076563492 10:131382471-131382493 CAGGATGGTGAGAGGGAGGGAGG - Intergenic
1076607032 10:131695790-131695812 CTGGGGGGACAGAGAGATGCAGG + Intergenic
1077206934 11:1349309-1349331 CAGGGAGGACAAAGGGACAGAGG - Intergenic
1077280506 11:1742910-1742932 GAGGATGGATAGATGGATGGAGG + Intronic
1077483929 11:2830313-2830335 AAGGGTTGACAGAGGGATCTGGG + Intronic
1077491637 11:2863335-2863357 CAGGCTGGGCAGAGTGAGGGAGG + Intergenic
1077913417 11:6594350-6594372 CAGGGTGGAATGTGGCATGGAGG + Intergenic
1077917516 11:6621242-6621264 CAGGAGGCACAGAGGGGTGGTGG - Intergenic
1078068001 11:8090371-8090393 TAGGGAGGGCAGAGGGAAGGTGG + Intronic
1078147187 11:8730131-8730153 CAGGGTTCACAGCGGGATCGAGG + Exonic
1078536921 11:12182768-12182790 CAAGGTGGACAGTGGGAGGAGGG - Intronic
1078539371 11:12200866-12200888 CCTGGTGGACAGAAGGATGCAGG + Intronic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1079243584 11:18737748-18737770 GAGGTGGGACAGAGGGCTGGGGG - Intronic
1080255381 11:30284487-30284509 AAAGGTGGAGAGAGGGAGGGAGG + Intergenic
1080557401 11:33430079-33430101 GAGGGAGGAGAGAGGGAGGGAGG - Intergenic
1080765149 11:35289164-35289186 CAGGGAGGACAGAGGGAGTGGGG - Intronic
1081015188 11:37869380-37869402 CAGAGTGGAAGGAGTGATGGTGG - Intergenic
1081615438 11:44587969-44587991 CTGGGTGGATGCAGGGATGGAGG - Intronic
1081826749 11:46061676-46061698 TAGGTTGGACAGGAGGATGGAGG - Intronic
1081862472 11:46341200-46341222 AAGGCTGGGCAGAGGGAGGGAGG - Intronic
1081997640 11:47375589-47375611 CAGGCTGGGCTGGGGGATGGGGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083146068 11:60759863-60759885 CAGGGTGAACAGGGTGATGGTGG - Intronic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1083879561 11:65541331-65541353 CAGGGTGGACAGGGCCAAGGGGG - Intronic
1084006568 11:66326429-66326451 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1084153549 11:67302183-67302205 CTGGGTGGACCGGGGGCTGGGGG - Exonic
1084435121 11:69135031-69135053 CAGGCTGGACAGAGAGGAGGAGG - Intergenic
1084461909 11:69300906-69300928 AAGGGTGGAAGGATGGATGGAGG + Intronic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1085298336 11:75443434-75443456 CAGGGAAGACAGTGGGCTGGTGG + Intronic
1085387409 11:76164967-76164989 CAGGGGGGACACAGGCACGGGGG + Intergenic
1085387436 11:76165099-76165121 CAGGGAGGACACAGGCACGGAGG + Intergenic
1085787598 11:79468762-79468784 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1087439885 11:98170018-98170040 CAGTGGGGTGAGAGGGATGGGGG + Intergenic
1087831140 11:102820880-102820902 CAGAGAAGGCAGAGGGATGGGGG - Intergenic
1087963945 11:104389362-104389384 CAGGGTGAACAGAGCAATAGAGG + Intergenic
1088550730 11:111009958-111009980 CAGGGTGGATTGAGGGATGGGGG + Intergenic
1088811917 11:113397891-113397913 AAGGTTGGAGAGAGGGAAGGAGG + Intronic
1088828143 11:113513087-113513109 CAGGGAGGACAGGGAGGTGGAGG + Intergenic
1088840366 11:113622532-113622554 CAGGGAGGACAGAGGCCTGTTGG + Intergenic
1089209834 11:116792352-116792374 CAGCTGGGGCAGAGGGATGGGGG - Intronic
1089603706 11:119629570-119629592 ATGGGTGGACAGAGGCAGGGTGG + Intronic
1089819924 11:121215562-121215584 AAGGGTGGAGGGTGGGATGGGGG + Intergenic
1089954311 11:122556146-122556168 GAGGGTGGCCAGAGGCATGGGGG - Intergenic
1090541152 11:127707621-127707643 CTTGGTGGATAGATGGATGGAGG + Intergenic
1091162652 11:133439124-133439146 CAGGTTGGTCAGAAGTATGGTGG + Intronic
1091453966 12:591507-591529 TAGGTTGGTCAGAGGGTTGGGGG + Intronic
1091618408 12:2067191-2067213 CAAGGTGGCCAGTGGGATGCAGG + Intronic
1092867771 12:12779068-12779090 CAGAATGGACAAAGGAATGGAGG - Intronic
1095413044 12:41945471-41945493 CATGGTGGCAGGAGGGATGGGGG + Intergenic
1095665106 12:44788567-44788589 GAGGGTGCCCAGAGGCATGGGGG + Intronic
1095688566 12:45063027-45063049 CAGGGTGGGAAGTGGGAGGGTGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096800127 12:54105055-54105077 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1097224345 12:57468249-57468271 CAGGGTGGGCTGGGGTATGGAGG - Intronic
1097263306 12:57731764-57731786 CATGGGGGACAGGAGGATGGGGG + Intronic
1098382597 12:69884492-69884514 GAGGGTGGACAGGGGCAGGGAGG - Intronic
1099141392 12:78980914-78980936 CAGGGGGGAGAGGGAGATGGAGG + Intronic
1099224177 12:79949407-79949429 GAAGGAGGACAGAGGGAAGGAGG - Intergenic
1100221217 12:92506233-92506255 GAGGGTGGAGTGGGGGATGGGGG + Intergenic
1100569886 12:95837519-95837541 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
1100679644 12:96905662-96905684 CAGTGAGGACAGAGGAATGGAGG + Intergenic
1101250514 12:102929634-102929656 CAAGGTGGAGAGTGGAATGGAGG + Intronic
1101591760 12:106131137-106131159 CAGGGTGGAGAGTGGGAAAGGGG - Intronic
1101946726 12:109143000-109143022 CAGGAGGGACAGAGGGATCTTGG + Intronic
1101968149 12:109294760-109294782 CAGTGTGGGCAGGGGGTTGGGGG - Intronic
1102095936 12:110241460-110241482 AAGAGAGCACAGAGGGATGGAGG - Intergenic
1102452193 12:113050191-113050213 CAGGGAGGTCAGTGGGCTGGAGG - Intergenic
1102513242 12:113429480-113429502 CAGGGTGGGCAGAGGAAAGTTGG - Intronic
1102520778 12:113476552-113476574 CAGGGATGCGAGAGGGATGGCGG + Intergenic
1102534534 12:113570653-113570675 CAGGGTGGGCAGGGGGGCGGGGG + Intergenic
1103073573 12:117964538-117964560 CAGATTGGACAGAGAGAAGGAGG - Intronic
1103737758 12:123071158-123071180 TAGGGTGGGCAGAGGGCTGCAGG + Intronic
1103905447 12:124325258-124325280 CTGGACGGACAGATGGATGGAGG + Exonic
1104053188 12:125210055-125210077 CAGGGTGGACAGTCAGATCGGGG + Intronic
1104189101 12:126460705-126460727 AAGGATGGACAGATGGATGGAGG + Intergenic
1104191073 12:126482430-126482452 GAGGGAGGAGAGAGGGAGGGAGG - Intergenic
1104254442 12:127124886-127124908 AGGGGGGGACAGAGGGAGGGGGG + Intergenic
1104428535 12:128697484-128697506 CAGGGTGGAGTGAGAAATGGGGG + Intronic
1104547265 12:129723594-129723616 CAGTGAGGACAGAGCCATGGAGG - Intronic
1104736530 12:131138851-131138873 CAGCGTGGACAGATGCATGGGGG + Intronic
1104772588 12:131372866-131372888 AGGGATGGACAGATGGATGGAGG - Intergenic
1104833060 12:131767832-131767854 GAGGGTGGAGGGAGGGAGGGAGG + Intronic
1104972742 12:132539366-132539388 CTGGGTGGACATGGGGCTGGAGG - Intronic
1104972752 12:132539395-132539417 CTGGGTGGACATGGGGCTGGAGG - Intronic
1105299430 13:19118906-19118928 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1105432760 13:20352157-20352179 CACGGTGGACAGACGGGAGGTGG - Intergenic
1105543350 13:21333872-21333894 CAGGGTGTTAACAGGGATGGGGG - Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1107675441 13:42791813-42791835 CAGAGAGGAGAGAGGGATGGGGG - Intergenic
1107939653 13:45372498-45372520 CAGAGAGGTCTGAGGGATGGGGG + Intergenic
1107982220 13:45744614-45744636 CAGGGAGGAAAGAAGGAAGGAGG + Intergenic
1107994053 13:45843308-45843330 CAGGGTAGAGACAGAGATGGAGG - Intronic
1108433225 13:50375670-50375692 GAGGGAGAAAAGAGGGATGGAGG - Intronic
1108799128 13:54071023-54071045 TAGGGTGTACTGAGGGGTGGGGG + Intergenic
1108955986 13:56157425-56157447 CAGGGAGGATGGAGGGAGGGGGG + Intergenic
1110515732 13:76410541-76410563 CAGTGTAGACAGATAGATGGTGG + Intergenic
1111448326 13:88379948-88379970 AAGGGTGGATAGAGGGTGGGAGG - Intergenic
1112203497 13:97301530-97301552 AAGGGAGGACAGCGGGTTGGTGG + Intronic
1112331050 13:98477283-98477305 CTGGGTGGACAGTGGGGAGGAGG + Intronic
1112690260 13:101885342-101885364 CAGGGTGGAGGGTGGGAGGGAGG + Intronic
1112967377 13:105213116-105213138 CAGGGGAGAGAGACGGATGGGGG - Intergenic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113574720 13:111387111-111387133 CAGGGTGTCCACAGTGATGGTGG + Intergenic
1113674115 13:112196354-112196376 CAGGGAGGAGGGAGGGAGGGAGG - Intergenic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1113804533 13:113105746-113105768 CAAGGGTGACAGAGGGATGGGGG - Intergenic
1113876662 13:113598772-113598794 CCGAGCGGACAGAGGGACGGCGG - Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1113959676 13:114119690-114119712 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1113959689 13:114119727-114119749 CTGGCTGGAGAGAGGGAGGGGGG - Intronic
1114050937 14:18919470-18919492 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1114111622 14:19482452-19482474 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1114270329 14:21097226-21097248 GAGTGAGGACAGAGGGAAGGAGG - Intronic
1114559466 14:23579668-23579690 CAGACAGGACAGAGGGGTGGTGG - Intergenic
1114663985 14:24368021-24368043 AAGAGAGGACAGAGGGAGGGAGG + Intronic
1116085294 14:40229594-40229616 GAGGGAGGAGAGAGGGAGGGAGG - Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116969613 14:51050743-51050765 AGGGGTGGAGAGGGGGATGGAGG - Intronic
1117210763 14:53496496-53496518 CAGGTTTGACAGAGGAATGGAGG - Intergenic
1117497822 14:56323300-56323322 CAGCGAGCAGAGAGGGATGGCGG - Intergenic
1117542289 14:56760002-56760024 CAGTGTCGACAGAGTGAAGGTGG + Intergenic
1118613973 14:67562696-67562718 CAGGAAGGCCAGAGGGGTGGAGG - Exonic
1119399088 14:74349641-74349663 CTGGGTGGGCCAAGGGATGGAGG - Intronic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1120253287 14:82086839-82086861 GAGGGTGGACTGTGGGGTGGGGG + Intergenic
1120733456 14:88027891-88027913 CAGGGTGGCCCCAGGGAAGGAGG + Intergenic
1120954674 14:90071495-90071517 CAGGGAGCACAGAGAGATGTGGG - Intronic
1120976582 14:90254224-90254246 TAGGGTGGACAGAGGGGGCGGGG - Intergenic
1121096573 14:91221537-91221559 GTGGGTGGATGGAGGGATGGAGG + Intronic
1121325407 14:93016856-93016878 CAGGGTGGACAAGAGGATGGGGG - Intronic
1121760638 14:96441898-96441920 CAGTGGGGACAGAGGGGTGATGG - Intronic
1121764912 14:96478167-96478189 AAGGAAGGACAGAGGGAGGGCGG + Intronic
1121823948 14:96995129-96995151 CAGGCTGGGCAGTGGGATGGAGG + Intergenic
1121835559 14:97088952-97088974 CAAGGTGGAAGGAGTGATGGAGG + Intergenic
1122199477 14:100113790-100113812 CAGGGAGGAGAGAGGTTTGGTGG + Intronic
1122233714 14:100320401-100320423 ATGGATGGACAGAGGGATGGAGG - Intergenic
1122600692 14:102920247-102920269 AATGGTGGATAGATGGATGGTGG - Intergenic
1122886398 14:104712327-104712349 CAGGGTGCACAGTGGGGTGCCGG + Intronic
1122886919 14:104714323-104714345 CAGGGTGGGCTGAGGGCCGGGGG - Exonic
1122983680 14:105202687-105202709 CAAGGTGAACAGACGGCTGGAGG - Intergenic
1124193792 15:27602937-27602959 CACTGTGGTCAGGGGGATGGAGG - Intergenic
1124661713 15:31555138-31555160 CAGGATGGACAGCTGGATGGTGG + Intronic
1125164495 15:36686750-36686772 AGGGAGGGACAGAGGGATGGAGG + Intronic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125277472 15:38008380-38008402 CAGGGATGATAGAGGGAAGGGGG + Intergenic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1126613044 15:50549102-50549124 GAGGGTGGAGAGTGGGGTGGGGG - Intergenic
1126923535 15:53555290-53555312 CACGGAGGACAGAGGCAGGGCGG + Intronic
1127846767 15:62877279-62877301 CGGGCTGGACAGAGAGCTGGTGG + Intergenic
1128072473 15:64806508-64806530 CAGGCTGGACTGGGGGCTGGGGG - Intergenic
1128157784 15:65402523-65402545 CAGGGGGGCCACAGGGAGGGTGG + Intronic
1128226050 15:66001956-66001978 CAGGGCTGGCAGGGGGATGGGGG + Intronic
1128612319 15:69084064-69084086 CAGGGAGGACATAAGGCTGGAGG + Intergenic
1128624854 15:69189964-69189986 GAGGGTGGAGAGTGGGATGAGGG - Intronic
1128763656 15:70237148-70237170 CAGGGAGGACTGAAGGATTGTGG + Intergenic
1128793557 15:70449691-70449713 ATGGGTGGTTAGAGGGATGGAGG + Intergenic
1128793579 15:70449755-70449777 ATGGGTGGATACAGGGATGGAGG + Intergenic
1128793626 15:70449903-70449925 ATGGGTGGATAGAGGGATGGAGG + Intergenic
1128793636 15:70449927-70449949 ATGGGTGGATAGGGGGATGGAGG + Intergenic
1128793679 15:70450087-70450109 ATGGGTGGACAGAGGGATGAGGG + Intergenic
1128793715 15:70450250-70450272 GTAAGTGGACAGAGGGATGGAGG + Intergenic
1128827683 15:70735193-70735215 GAGGGCAGACAGAGGGATGGGGG + Intronic
1128904025 15:71451598-71451620 CTTGGTAGACAGAGGCATGGGGG + Intronic
1129069616 15:72939748-72939770 CAGGGTGGGGAGAGGGCTTGGGG + Intergenic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130088347 15:80797392-80797414 CAGGGAGGACAGAGGCGTGCAGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130667259 15:85880184-85880206 CAGGGTGGAAAGAGAGATCACGG - Intergenic
1130751206 15:86715024-86715046 CAGGGAGTACAGAGGCATGGTGG - Intronic
1130923080 15:88365385-88365407 GAGGGAGGGCAGAGGGGTGGGGG + Intergenic
1131330633 15:91496020-91496042 AGGGATGGAGAGAGGGATGGAGG - Intergenic
1131926248 15:97387067-97387089 GTGCGTGGACAGAGGCATGGAGG + Intergenic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1132231080 15:100184731-100184753 CATGATGGACGGAGGGAAGGTGG - Intronic
1132408573 15:101560188-101560210 TAGGCAGGACAGGGGGATGGGGG - Intergenic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132465957 16:77599-77621 CTGGGCGGAAAGAGGGATGGGGG + Intronic
1132514840 16:361448-361470 CATGGCGGACAGCGGGACGGTGG - Intergenic
1132888259 16:2191946-2191968 GAGGTTGGACCGAGGGATGTGGG - Intronic
1133002386 16:2857941-2857963 CAGGAGGGAGAGAGGGAGGGAGG + Intronic
1133363886 16:5195915-5195937 CAGGGTTGATACAGGGATAGGGG + Intergenic
1133629281 16:7603911-7603933 CAGAATGGACAGGGGGAAGGAGG + Intronic
1134052531 16:11146708-11146730 CTGGGTGGATAGATGGATAGAGG + Intronic
1134239390 16:12494250-12494272 CAGGGAGGACGCAGAGATGGTGG - Intronic
1134691142 16:16191722-16191744 GAGGAAGGACAGAGGGAAGGAGG - Intronic
1135738627 16:24954510-24954532 AGGGGTGGACAGGGGGCTGGCGG + Intronic
1135940317 16:26816731-26816753 CAGGATGGACAGAGGGAGAGGGG - Intergenic
1135975573 16:27107191-27107213 CAGGAAGGAGAGAGGGGTGGTGG - Intergenic
1135975941 16:27109168-27109190 AAGGGAGGAAAGAGGGATGGAGG + Intergenic
1136186377 16:28591098-28591120 CAGGGCTGGCAAAGGGATGGTGG - Intronic
1136295223 16:29297796-29297818 CAGGGTGGGTGGATGGATGGTGG + Intergenic
1136363939 16:29799874-29799896 TGGGGTGGAGAGAGGGATTGGGG - Intronic
1137385912 16:48042470-48042492 CTGGGTGGAAAGAAGGAAGGAGG - Intergenic
1137516282 16:49147375-49147397 CAGGGAGTAATGAGGGATGGAGG + Intergenic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1137574660 16:49590849-49590871 CAGAGTGGCCAGAGTGGTGGTGG - Intronic
1137736235 16:50725940-50725962 TAGGAAGGACAGAGGGTTGGTGG - Intronic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138276085 16:55736056-55736078 CAGGAAGGGGAGAGGGATGGGGG + Intergenic
1138350803 16:56345342-56345364 CAGGGAGAACAGAGGGCTTGAGG - Exonic
1138421549 16:56902505-56902527 CAAGGTGCAGAGAGGGGTGGGGG + Exonic
1138496560 16:57412567-57412589 CAGGGTGGACTGTGAGAGGGTGG + Intronic
1138505335 16:57475697-57475719 GAGGGGGGAGAGAGGGAGGGAGG - Intronic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1138946154 16:61852775-61852797 CAGGGAGGATAAAGGGAAGGAGG - Intronic
1139853099 16:69962309-69962331 GGGGATGGACAGATGGATGGAGG - Intronic
1139882070 16:70185217-70185239 GGGGATGGACAGATGGATGGAGG - Intronic
1140370439 16:74410288-74410310 GGGGATGGACAGATGGATGGAGG + Intronic
1140541546 16:75760507-75760529 AAGGGAGGAAAGAGGGAGGGAGG - Intronic
1140914615 16:79482953-79482975 AAGGAGGGACAGAGGGAGGGAGG - Intergenic
1140937489 16:79687661-79687683 CAGGTTGGACAGAATGAAGGTGG + Intergenic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141193626 16:81842880-81842902 CAGGGAGGGCTGAGGGAGGGTGG + Intronic
1141233958 16:82198028-82198050 CAGGGAGGTCAGCGGGACGGTGG + Intergenic
1141697669 16:85627867-85627889 CGTGGGGGACACAGGGATGGCGG - Intronic
1141927429 16:87178643-87178665 AAGGGGGGAGAGAGAGATGGAGG - Intronic
1141998625 16:87650368-87650390 CAGAGGAGAGAGAGGGATGGGGG - Intronic
1142141886 16:88476222-88476244 GAGGCTGTGCAGAGGGATGGAGG - Intronic
1142280921 16:89147167-89147189 GAGGGTCCACAGAGGGAGGGAGG + Intronic
1142425344 16:89999594-89999616 CAGGGTGGGCAGAGCGTAGGTGG + Intergenic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142541242 17:661070-661092 CCGGGAGGAGGGAGGGATGGAGG - Intronic
1142805550 17:2369484-2369506 CAGGCTGGACGGGGGGAGGGGGG - Intronic
1143021336 17:3918356-3918378 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
1143174249 17:4947545-4947567 CAGTGTGGACAGGGAGATGGTGG + Intronic
1143186173 17:5011827-5011849 CAGCCTGGACAGAAGCATGGAGG - Intronic
1143410244 17:6704246-6704268 CAGGAGGGAGAGAGGAATGGAGG - Intronic
1143492694 17:7293555-7293577 CAGTGGGGACAGTGAGATGGGGG + Intronic
1143910634 17:10245917-10245939 CATGGTGGAGAGAGGGATGGAGG + Intergenic
1143915180 17:10286426-10286448 TAGGGAGAAAAGAGGGATGGAGG - Intergenic
1144142219 17:12360713-12360735 GAGACTGGACAGATGGATGGAGG + Intergenic
1144247757 17:13384356-13384378 AAGGGGGGAGAGAGGGAAGGAGG + Intergenic
1144409899 17:14990652-14990674 AAGGATGGAGATAGGGATGGGGG + Intergenic
1144727036 17:17507207-17507229 CAGGGAGGAGGGAGGGAGGGAGG + Intronic
1144738630 17:17568895-17568917 CAGGGTGGCCAGACGGTAGGTGG - Intronic
1145001779 17:19310343-19310365 CAGGGTGGGCGCAGGGATGCAGG + Intronic
1145291377 17:21549277-21549299 CAGGGTTTACACAGGGGTGGGGG + Intronic
1145388698 17:22437776-22437798 CAGGGTTTACACAGGGGTGGGGG - Intergenic
1146285487 17:31571652-31571674 TGGGGTGGACAGAAGGAGGGCGG + Intronic
1146307836 17:31744146-31744168 GAGGGTGGAGGGAGGGAGGGAGG + Intergenic
1146626877 17:34441706-34441728 CTGGATGGACAGATGGATGGAGG + Intergenic
1146734900 17:35230356-35230378 CAGGATGAATAGAGGGAAGGGGG + Intergenic
1146793312 17:35765011-35765033 CAGGTTTGTCAGAGGGATGAGGG - Exonic
1146925030 17:36738563-36738585 CAGGGAGGAAGGAGGGAGGGAGG + Intergenic
1146939193 17:36832296-36832318 ATGGATGGACAGATGGATGGTGG - Intergenic
1146962880 17:36999877-36999899 CAGGGAGGCCAGAGTCATGGGGG + Intronic
1147575128 17:41594593-41594615 GAAGGAGGACAGAGGGAGGGAGG + Intergenic
1147656739 17:42095431-42095453 AAGGGCAGCCAGAGGGATGGTGG + Intergenic
1147874553 17:43611867-43611889 CAAGGAGGACAGAGGAAGGGAGG - Intergenic
1148215263 17:45830650-45830672 CTGGGGGGCCTGAGGGATGGAGG + Intronic
1148217416 17:45840565-45840587 GGGGGTGGGCACAGGGATGGGGG + Intergenic
1148439265 17:47703208-47703230 GTGGGTGGAGAGAGGGGTGGGGG - Intronic
1148479300 17:47949666-47949688 CTGGGTGGCCAGATGGATGTGGG - Intergenic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148745483 17:49915817-49915839 CAGGATGGACAGAGGAATGCTGG - Intergenic
1148747360 17:49926159-49926181 CAGGGTGGCCAGTGGGGTTGTGG + Intergenic
1148987130 17:51632748-51632770 CAGTGTGGAAAGAAAGATGGAGG - Intronic
1149422864 17:56527926-56527948 CTGGGGGGAGGGAGGGATGGAGG + Intergenic
1149549882 17:57532333-57532355 GAGGGAGGGCAGTGGGATGGCGG - Intronic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1150062252 17:62078525-62078547 AAGGGCAAACAGAGGGATGGTGG - Intergenic
1150136285 17:62697055-62697077 CAGGCTGGAGGGAGGGAGGGCGG + Intergenic
1150137236 17:62702825-62702847 CAGGATGGACGAGGGGATGGGGG - Intronic
1150431342 17:65120224-65120246 CAGGGTGGTCAGTGGGATGGAGG + Intergenic
1150634541 17:66903799-66903821 TAGGGTGGATAGATGGATGGTGG + Intergenic
1151007520 17:70455047-70455069 AGGGAGGGACAGAGGGATGGAGG + Intergenic
1151037054 17:70812753-70812775 CAGTGTGTACTAAGGGATGGGGG - Intergenic
1151188175 17:72379022-72379044 CAGGGGGGAGTGAGGGCTGGGGG + Intergenic
1151696728 17:75721709-75721731 CAGCGTGGACAGAGGGACCGGGG - Intronic
1151719735 17:75848164-75848186 GAGGGTGGACAGAGGCCGGGAGG + Intronic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1151908701 17:77066896-77066918 CATGGTGGGCAGAGGCAGGGCGG - Intergenic
1152018491 17:77767924-77767946 GAGGGTGGTCAGTGGGCTGGAGG - Intergenic
1152238374 17:79149948-79149970 CAGGGTGGGGATGGGGATGGGGG + Intronic
1152362970 17:79840840-79840862 GAGAGTGGAGCGAGGGATGGGGG + Intergenic
1152473569 17:80503539-80503561 ATGGGTGGATAGGGGGATGGAGG + Intergenic
1153272265 18:3334256-3334278 AGGGGCAGACAGAGGGATGGAGG - Intergenic
1153813519 18:8773234-8773256 CAGGGGGTGCAGGGGGATGGTGG - Intronic
1154493681 18:14940366-14940388 CAGAGTGGCCACAGGGATAGAGG + Intergenic
1155008146 18:21748360-21748382 GAGGGGGGAGAGAGGGAGGGAGG - Intronic
1155008151 18:21748375-21748397 GAGGGGGGAGAGAGGGAGGGGGG - Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1156411243 18:36829497-36829519 CAGGGTGGGCAGAGGGACCTCGG - Intronic
1156497937 18:37538113-37538135 CCGGGAGGCCAGAGGGATGGCGG + Intronic
1157324222 18:46657396-46657418 TAGGGAGGAGAGAGGGCTGGTGG - Intergenic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1160190440 18:76710514-76710536 CATGCTGGACAGAGGTGTGGAGG - Intergenic
1160415017 18:78703692-78703714 GAGGCAGGACAGAGGCATGGCGG + Intergenic
1160508876 18:79442294-79442316 GAGGGTGGACAGAGGTGGGGAGG - Intronic
1160526261 18:79540209-79540231 CACTGTGGACAGCGGGATGAGGG + Intergenic
1160756627 19:760708-760730 CAGGAGGGAGGGAGGGATGGAGG + Intronic
1161053186 19:2176214-2176236 CTGTGTGGACCGAGGGCTGGGGG - Intronic
1161153941 19:2722680-2722702 CAGAGTGGAAGGAGGGCTGGAGG - Intronic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161236660 19:3201635-3201657 CGGGGTGGGCAGGGGGATGGGGG + Intronic
1161256002 19:3310067-3310089 AAGGGAGGAGAGAGAGATGGAGG - Intergenic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161313486 19:3607340-3607362 GTGGGAGGACAGAGGGATGGGGG + Intergenic
1161329314 19:3678740-3678762 AGGGAGGGACAGAGGGATGGCGG + Intronic
1161329324 19:3678768-3678790 CAGGACGGAGGGAGGGATGGAGG + Intronic
1161329357 19:3678870-3678892 CAGGATGGAGGGAGGGATGGCGG + Intronic
1161329390 19:3678976-3678998 CAAGATGGAGGGAGGGATGGAGG + Intronic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1161666166 19:5578317-5578339 CTGGGCGGGCAGAGAGATGGGGG + Intergenic
1161678333 19:5665984-5666006 CAGGGTGAAGGGAGAGATGGCGG - Intronic
1161770848 19:6230027-6230049 CAGGGTGGGCGCAGGGCTGGTGG - Intronic
1161975108 19:7604273-7604295 CCAGGTGGACAGTGGGCTGGGGG - Intronic
1161982882 19:7638988-7639010 ATGGATGGACAGATGGATGGAGG - Intronic
1162085816 19:8248562-8248584 ATGGGTGGACAGATGGATGATGG + Intronic
1162168134 19:8768310-8768332 AAGGATGGAAAGAGGGAGGGAGG - Intergenic
1162169754 19:8779910-8779932 AAGGATGGAAAGAGGGAGGGAGG - Intergenic
1162170820 19:8787369-8787391 AAGGATGGAAAGAGGGAGGGAGG - Intergenic
1162179639 19:8859283-8859305 CAAGCTGGACAGATGGATGGAGG - Intronic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1162467028 19:10848579-10848601 CAAGGTGGACAGAGGATGGGGGG - Intronic
1162569266 19:11461523-11461545 GAGGGAGGAAAGAGGGAGGGAGG - Intronic
1162832163 19:13292136-13292158 CAGGGTGGACAAAATGAGGGTGG - Intronic
1162926449 19:13932736-13932758 CAGGGCAGGCAGGGGGATGGAGG + Exonic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1164158726 19:22612481-22612503 CAGGCTGGTCAGAGGGCTGCAGG - Intergenic
1164441814 19:28284865-28284887 GAGGGTGGAGAGAAGGAGGGTGG + Intergenic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1164681005 19:30133745-30133767 CAGGGTGCAGAGAGGTATGCTGG + Intergenic
1164706487 19:30323924-30323946 AGGGATGGACAGATGGATGGAGG - Intronic
1165156867 19:33794599-33794621 GAGGGTGGAATGAGGGAAGGTGG - Intergenic
1165257565 19:34588950-34588972 TGGGGTGTACAGAGGGAGGGTGG + Intergenic
1165311851 19:35033342-35033364 CAGGGAGGGCACAGGGGTGGGGG - Intronic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1166231651 19:41428292-41428314 CCGGGTGCCGAGAGGGATGGAGG - Intronic
1166381481 19:42357390-42357412 CTGGGGGGCCTGAGGGATGGAGG - Exonic
1166567886 19:43776251-43776273 CAGAGTGGACAGAGGCCTGGGGG + Intronic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1166748954 19:45155679-45155701 CAGGCTGGCCACAGGGGTGGGGG + Intronic
1166872410 19:45878915-45878937 GACGGTGGACAGAGAGAAGGTGG - Intergenic
1166872412 19:45878930-45878952 CAGAGTAGACAGAGAGACGGTGG - Intergenic
1166880934 19:45929520-45929542 GAGAGGGGACAGAGAGATGGGGG + Intergenic
1166892537 19:46002288-46002310 CAAGCTGGAAAGAGGGACGGGGG - Intronic
1166985718 19:46659276-46659298 CCGGGAGGACAGAGGGCTGAGGG + Intronic
1167153415 19:47723131-47723153 CAGGGTGGGCAGGGGGATCCAGG - Intronic
1167381835 19:49142759-49142781 CAGAGGGGACAGAGGGACAGAGG - Intronic
1167483865 19:49748695-49748717 CAGGAGGGAAAGGGGGATGGAGG + Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1167576540 19:50320512-50320534 GAGGGAGGAGAGGGGGATGGGGG - Intronic
1168099550 19:54133953-54133975 GAAGGTGGAGAGAGGGAGGGAGG - Intergenic
1168099566 19:54133996-54134018 GAAGGTGGAGAGAGGGAGGGAGG - Intergenic
1168099622 19:54134145-54134167 GAAGGTGGAGAGAGGGAGGGAGG - Intergenic
1168099671 19:54134282-54134304 GAAGGTGGAGAGAGGGAGGGAGG - Intergenic
1168135580 19:54349184-54349206 GAGGGTGGATGGATGGATGGAGG + Intergenic
1168135655 19:54349492-54349514 GAGGGTGGACGGATGGAGGGAGG + Intergenic
1168287575 19:55342208-55342230 CAGGGGGGGCACAGGGCTGGGGG - Exonic
1168310278 19:55456492-55456514 GGGGGTGGGCAGAGGGACGGTGG + Intronic
1168322337 19:55517839-55517861 CATGGTGGAGTGAGTGATGGTGG - Exonic
1168322351 19:55517896-55517918 CATGGTGGAGTGAGTGATGGTGG - Exonic
1168322386 19:55518019-55518041 CATGGTGGAGTGAGTGATGGTGG - Exonic
1168414288 19:56158942-56158964 GATGGATGACAGAGGGATGGTGG - Intronic
1168721574 19:58557563-58557585 CAGTGAGGACTGAGGGTTGGTGG - Intronic
925121294 2:1420729-1420751 CAGGAGGGACAGAAGGATGGTGG + Intronic
925333650 2:3077544-3077566 CAGGGAGGTCGCAGGGATGGCGG - Intergenic
925685061 2:6462669-6462691 AAATGTGGACAGAAGGATGGTGG - Intergenic
926059244 2:9794895-9794917 GAGGGTGGAGGGAGGGAGGGAGG - Intergenic
926395141 2:12433728-12433750 CATGGTTGACGGAGGGAAGGAGG - Intergenic
926606484 2:14903832-14903854 CAGGTGTGACAGGGGGATGGGGG - Intergenic
927128231 2:20033475-20033497 GAGGGTGGAGAGAGGGAGGTGGG + Intronic
927140216 2:20125062-20125084 CACGGTGTACAGAGAGGTGGGGG + Intergenic
927969421 2:27295666-27295688 AAGGGTGCAGTGAGGGATGGAGG + Intronic
928249208 2:29660157-29660179 CATGCTGGACAGAGGGACTGTGG - Intronic
928436407 2:31257327-31257349 AAGGATGGACAGAGGGATGTAGG + Intronic
928600648 2:32900766-32900788 CAGGGTGAGCCGAGGCATGGAGG + Intergenic
928629654 2:33177961-33177983 CAGGGGGTACAGAGGGGTGCAGG - Intronic
929127412 2:38534461-38534483 GAGGTGGGACAGAGGAATGGTGG - Intergenic
929450659 2:42034923-42034945 CTGGGAGGACAGAAGGGTGGTGG + Intergenic
929544986 2:42849840-42849862 CAGGGTGCACAGTGGAAGGGAGG - Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929814865 2:45222648-45222670 CAGGGGAGAAGGAGGGATGGGGG + Intergenic
930208202 2:48609300-48609322 AAGGGTGGACTGGAGGATGGAGG - Intronic
932216608 2:69970187-69970209 CAGGGTGTGAAGAGGCATGGAGG - Intergenic
932411728 2:71551557-71551579 CAGGGGAGACAGAGGGGAGGAGG - Intronic
932430823 2:71672714-71672736 CAAGCTGGCCAGAGGAATGGAGG + Intronic
932667766 2:73710723-73710745 CAGGGTGGAGAGTGGGAGGAGGG + Intergenic
933763084 2:85687480-85687502 CTGGGTGGCCAGGGAGATGGTGG - Intronic
933943704 2:87266461-87266483 CTGTGTGGACAGTGGGCTGGAGG + Intergenic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
935194266 2:100802701-100802723 GAGGGGGGACAGAGGGGTGGGGG + Intergenic
935303896 2:101718544-101718566 CAGGGCTGACAGTGGGAAGGTGG + Intronic
935611374 2:105029314-105029336 GAGGGAGGAAAGAGGGAAGGGGG + Intergenic
936060577 2:109293234-109293256 GAGGGAGGACAGAGGGATGGTGG + Intronic
936096370 2:109533152-109533174 AAGGGAGGAAAGAGGGAGGGAGG + Intergenic
936336516 2:111595118-111595140 CTGTGTGGACAGTGGGCTGGAGG - Intergenic
936376547 2:111946065-111946087 CAGGGAGCACAGATGGAAGGAGG + Intronic
936462263 2:112722336-112722358 GGGGGAGGACAGAGGGAGGGAGG + Intronic
936947271 2:117941962-117941984 TATGGTGGACAAAGGGATGCAGG - Intronic
937072207 2:119073116-119073138 CAGGCAGGAAGGAGGGATGGAGG + Intergenic
937082641 2:119151402-119151424 ATGGATGGATAGAGGGATGGAGG - Intergenic
937216425 2:120316361-120316383 CAGGGTGGCCAGAGCCAGGGAGG + Intergenic
937818170 2:126276297-126276319 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937818181 2:126276329-126276351 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937818192 2:126276361-126276383 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937818203 2:126276393-126276415 AAGGAGGGACAGAGGGAAGGAGG + Intergenic
937970744 2:127546889-127546911 GTGGGTGGATAGATGGATGGTGG - Intronic
937973086 2:127565175-127565197 CAGGCTGGCCATGGGGATGGAGG + Intronic
937975371 2:127579115-127579137 CAGCATGGAGAGAGGAATGGCGG + Intronic
938436226 2:131285154-131285176 CAGGGTGGGCAGTGGGGTGCAGG + Intronic
938579782 2:132635598-132635620 CAGCGTGTGCAGAGGCATGGAGG + Intronic
939195948 2:138972394-138972416 CAGGGTGGAGAGAAGGCAGGAGG + Intergenic
939456324 2:142441564-142441586 CACGGGAGACAGAGCGATGGGGG - Intergenic
939696328 2:145329254-145329276 CCTGGAGGACAGAGGGATGGAGG + Intergenic
941882510 2:170495858-170495880 CATGGAGCACATAGGGATGGTGG - Intronic
942176038 2:173335532-173335554 AAGGGTGGAGAGAGGGAGAGAGG - Intergenic
942465680 2:176205107-176205129 GGGGGTGGACTGAGGTATGGAGG + Intergenic
943334243 2:186594521-186594543 AATGATGGGCAGAGGGATGGGGG - Intronic
945546878 2:211165740-211165762 CAGGATGGAAGGAGGGAGGGAGG + Intergenic
946037348 2:216754707-216754729 GTGGGTGGGCAGAGGGATGTAGG + Intergenic
946154159 2:217796284-217796306 CAGGAGGGGCAGAGGGATGGCGG - Intergenic
947611754 2:231528984-231529006 CAGGGAGGACAGAGCAATTGAGG + Exonic
948122322 2:235540053-235540075 CAGGATGGACAGATGGACAGTGG + Intronic
948230942 2:236348990-236349012 CAGGATGGAGGGAGGGAAGGTGG - Intronic
948453457 2:238093013-238093035 CAGGGTGGGAAGAGGGTTGGAGG - Intronic
948742115 2:240054969-240054991 CAGGGTGGGCTGGGGGGTGGTGG + Intergenic
948901069 2:240957170-240957192 CAGGGAGGGCAGAGAGCTGGGGG - Intronic
949065949 2:241990396-241990418 GATGGTGGATAGATGGATGGTGG - Intergenic
1168955072 20:1828943-1828965 GAGGGAGGAAAGAGAGATGGGGG - Intergenic
1169090746 20:2860126-2860148 CAGGCTGGCCAGAGGCATGCCGG - Exonic
1169932861 20:10852975-10852997 CAGTGTGGAGAGTAGGATGGAGG + Intergenic
1170098676 20:12674919-12674941 AAGAGTGGACAGAGGCTTGGTGG - Intergenic
1170361182 20:15548107-15548129 ATAGGTGGACAGATGGATGGTGG - Intronic
1170796629 20:19553007-19553029 AAGGGAGGAGGGAGGGATGGAGG - Intronic
1170857880 20:20074220-20074242 CAGGGTGGAAAGAGGGTTTCGGG - Intronic
1171405152 20:24907488-24907510 CAGGGTGGACTGACTGCTGGGGG + Intergenic
1171774076 20:29349586-29349608 CAGGGGGCAGAGAGGGGTGGTGG + Intergenic
1171816077 20:29787140-29787162 CAGGGGGCAGAGAGGGGTGGTGG + Intergenic
1171851916 20:30314881-30314903 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1172230813 20:33334338-33334360 GAGGGTGGGTAGATGGATGGTGG + Intergenic
1172230850 20:33334499-33334521 GAGGGTGGGCAGATGGATGGTGG + Intergenic
1172273877 20:33669507-33669529 CAGGGTGGGTAGATGGGTGGGGG - Intronic
1172630590 20:36375760-36375782 CAGGAGGGAGTGAGGGATGGTGG + Intronic
1172763692 20:37339510-37339532 CAGGGTGGAAAGAGGGGTGGGGG - Intergenic
1172778923 20:37424223-37424245 CAGGGAGGAGAGAGAGAGGGAGG + Intergenic
1172890565 20:38260876-38260898 GGGGGTGGACGGAGGGAAGGGGG - Intronic
1173294023 20:41739799-41739821 CTGGGTGGAGAGAGGCAAGGAGG - Intergenic
1173418041 20:42876034-42876056 GAGGATGGAGAGAGGGAAGGAGG - Intronic
1173527686 20:43745397-43745419 CAGGGTGGAAAGATGGGTGGAGG + Intergenic
1173564618 20:44029965-44029987 AAGGGTGGCCTGAGGGGTGGAGG - Intronic
1173902152 20:46598784-46598806 CGGGGGGGAGAGAGTGATGGTGG - Intronic
1174136386 20:48382862-48382884 CCAGGTGGTCAGAGTGATGGGGG + Intergenic
1174172865 20:48627975-48627997 GAGGGAGGACAGCGGGTTGGCGG + Intronic
1174221545 20:48959530-48959552 AAGGAGGGACAGAGGGAGGGAGG - Intronic
1174299180 20:49569127-49569149 CAGGGTGGGAATGGGGATGGTGG - Intergenic
1175131302 20:56791744-56791766 ATGGGTGGACAGATGGATAGAGG - Intergenic
1175224923 20:57439326-57439348 CAGAGGGGTCAGGGGGATGGGGG - Intergenic
1175273885 20:57754419-57754441 AAGGAAGGAAAGAGGGATGGAGG - Intergenic
1175422480 20:58843235-58843257 CAGGGTGTAAAGAGGGAAGCTGG - Intronic
1175438042 20:58968384-58968406 CAGGAAGGACAGAGTCATGGTGG + Intergenic
1175692224 20:61073780-61073802 CAGAGGTGACAGAGAGATGGTGG - Intergenic
1175717140 20:61262770-61262792 GAGGGAGGAGAGAGGGAAGGAGG - Intronic
1175724813 20:61310587-61310609 CAGGCTGGACAGCAGGAAGGGGG - Intronic
1175753656 20:61515924-61515946 CAGGATAGACTGCGGGATGGGGG - Intronic
1175817896 20:61893148-61893170 GTGGGTGAATAGAGGGATGGTGG + Intronic
1175817959 20:61893385-61893407 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818037 20:61893706-61893728 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818051 20:61893757-61893779 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175818064 20:61893804-61893826 ATGGGTGAATAGAGGGATGGTGG + Intronic
1175824527 20:61929861-61929883 CAGGGTGGGCAGGGGCATTGTGG + Intronic
1175825400 20:61933991-61934013 CAGGGTGGAAGGGGGGCTGGCGG + Intronic
1175882706 20:62270116-62270138 CAGGGTGGACGGAGGGTGGGCGG - Intronic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175984037 20:62755364-62755386 GAGGGTGGATGGAGGGATGAAGG - Intronic
1177244249 21:18502219-18502241 CAGAGGAGATAGAGGGATGGAGG + Intergenic
1178007243 21:28235179-28235201 CAGGGTGGTCACAGGGGTGTAGG + Intergenic
1178323283 21:31622527-31622549 CAGGGAGGAAAGAGGGGTCGGGG - Intergenic
1179055434 21:37927712-37927734 AAGGAAGGACAGACGGATGGAGG + Intergenic
1179068106 21:38045320-38045342 CAGGGGGCACACTGGGATGGTGG + Intronic
1179226070 21:39454565-39454587 CAGGGGGGACAAAGGGAGAGAGG + Intronic
1179343407 21:40533630-40533652 ATGGATGGACAGATGGATGGAGG - Intronic
1179750818 21:43466534-43466556 CAGGGTGGTCGGAGGGGGGGGGG - Intergenic
1180086052 21:45508377-45508399 GATGGTGGGCAGATGGATGGTGG + Intronic
1180319530 22:11307704-11307726 CAGGGTGCAGAGAGGGGTGGTGG + Intergenic
1180469414 22:15641845-15641867 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181503817 22:23337493-23337515 CAGGAAGGCAAGAGGGATGGGGG + Intergenic
1181510360 22:23386208-23386230 CTGGGTTGAGAGAGAGATGGGGG - Intergenic
1181528501 22:23502916-23502938 AATGGTGGATGGAGGGATGGGGG - Intergenic
1181537090 22:23552007-23552029 GAGGGTGGACAGAGAAATAGAGG - Intergenic
1181582730 22:23837026-23837048 GAGGGTGGGGAGAGGGAGGGAGG + Intronic
1181646310 22:24233264-24233286 CAGGCTGGACAAAGGCCTGGAGG - Intronic
1181708813 22:24667713-24667735 CAGGAAGGCAAGAGGGATGGGGG + Intergenic
1181770126 22:25119181-25119203 CAGGGTGGACACAAGAATGAAGG - Intronic
1182485615 22:30636872-30636894 CAGGGTGAACAGAGGTGTGGTGG - Exonic
1182864563 22:33592102-33592124 GAAGGGGGACAGAGGGAGGGAGG + Intronic
1182875982 22:33691262-33691284 GAGGGAGGAGAGAGGGAGGGAGG + Intronic
1183058212 22:35319837-35319859 CACGGTGGGGAAAGGGATGGTGG - Intronic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1183509561 22:38226986-38227008 CGGAGAGGACGGAGGGATGGAGG + Intronic
1183584486 22:38744933-38744955 CAGGGAGGAGTGAGGGATGGTGG - Intronic
1183730913 22:39617866-39617888 GAGGGAGGAAAGAGGGAGGGGGG - Intronic
1184094590 22:42309610-42309632 CAGTGTGGGCAGAGGTGTGGAGG - Intronic
1184172955 22:42770053-42770075 CAGCACGGACAGACGGATGGCGG - Intergenic
1184217140 22:43075279-43075301 CAGGGTGAACACAGTGATGTGGG + Intronic
1184248157 22:43246011-43246033 CAGGGAGGCCTGAGGGCTGGTGG + Intronic
1184274183 22:43400731-43400753 CAGGGGCGACAGAGGAGTGGGGG + Intergenic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184290994 22:43498168-43498190 CAGGGTGGTCAGAGGGAATGCGG - Intronic
1184301748 22:43564970-43564992 CAGGGTGAACAGAAGCAGGGGGG - Intronic
1184410463 22:44323195-44323217 ATGGGTGGACAGATGGATGGTGG - Intergenic
1184586637 22:45452519-45452541 CATAGTGGACAGAAGGAAGGGGG - Intergenic
1184868842 22:47220221-47220243 GAGGGGTGACAGAGGGATGGGGG - Intergenic
1184889322 22:47369845-47369867 AAGGGTGGACAGGGAGAAGGAGG - Intergenic
1184979081 22:48083509-48083531 CGTGGTGCACGGAGGGATGGAGG + Intergenic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185398244 22:50603467-50603489 CAGTGTGGTCAGACGGAGGGTGG - Exonic
950102838 3:10368684-10368706 GTGGATGGACAGATGGATGGCGG - Intronic
950121958 3:10488002-10488024 ATGGGTGGACAAAAGGATGGAGG - Intronic
950447328 3:13045797-13045819 CAGGGTGGCCCCAGGGAAGGAGG - Intronic
950565329 3:13766597-13766619 CATGGTGTGCAGAGAGATGGTGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
951097828 3:18652401-18652423 CATGGTAGACAGAGAGAAGGTGG + Intergenic
952905166 3:38135207-38135229 CGGGGTGAACAGGGTGATGGTGG - Intronic
953256621 3:41296916-41296938 CAGGAAGAAGAGAGGGATGGAGG + Intronic
953557185 3:43955598-43955620 CAGGATGGAGGGATGGATGGAGG + Intergenic
953920675 3:46949261-46949283 CAGTGGGGACAGAGGGACGGAGG + Intronic
954137670 3:48589546-48589568 CAGGGTGGAATGGGGGCTGGGGG - Intronic
954713132 3:52514682-52514704 CAGGCTGGGGAGAGGGATGGAGG - Exonic
954936516 3:54331926-54331948 CAGGGTAGATTGAGGGAGGGAGG - Intronic
955039218 3:55298649-55298671 CAGGGTGGACGGAGGCATAATGG - Intergenic
955353779 3:58213728-58213750 CAGGGTGCAGGGAGGGATGCAGG + Intronic
955591948 3:60546522-60546544 AAGTGGGGAGAGAGGGATGGTGG - Intronic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
958085363 3:88798739-88798761 CATGGTGGGTAGAGGGATGCTGG - Intergenic
958630097 3:96673209-96673231 GATGGAGGACAGAGAGATGGAGG - Intergenic
958630111 3:96673323-96673345 GATGGAGGACAGAGAGATGGAGG - Intergenic
960547169 3:118928682-118928704 CAGGGTGGACAGATGTTTGATGG - Exonic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
960891456 3:122452628-122452650 GAGGGAGGAGAGAGGGAGGGAGG + Intronic
961208313 3:125105214-125105236 GAGGGGGGATGGAGGGATGGGGG + Intronic
961564607 3:127754570-127754592 CAGAGAGGAGAGAGGGCTGGCGG + Intronic
961577230 3:127847435-127847457 CATGCTTGACAGAGGGAAGGAGG + Intergenic
961958123 3:130825385-130825407 CAGGGAGGAGGGAGGGAGGGAGG + Intergenic
962384487 3:134921885-134921907 GAGGGAGGGCAGAGGGACGGGGG + Intronic
963127186 3:141827151-141827173 CAGGGTGGGAAGAGAGCTGGTGG + Intergenic
964116283 3:153139526-153139548 CAGGGTGGACTGAGGACTGAAGG - Intergenic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
964904752 3:161706934-161706956 GAGGGTGGACAGAAGCAGGGTGG + Intergenic
965017582 3:163177705-163177727 CAGGGTGGAGAGTGGGATGAGGG + Intergenic
965125936 3:164628955-164628977 AGGTGTGGACAGAGAGATGGGGG - Intergenic
965173081 3:165293879-165293901 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
967257592 3:187609416-187609438 GAGGGTGGCCAGAGGCATGGGGG - Intergenic
967979687 3:195058484-195058506 CAGGGCAGACTGAGGGGTGGAGG - Intergenic
968443033 4:634096-634118 CTGGGAGGCCAGAGGGGTGGAGG + Intronic
968581503 4:1397388-1397410 CAGGGAGGTCCTAGGGATGGGGG + Intergenic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
969278240 4:6151442-6151464 CAGCTTGGGCAGAGGCATGGAGG - Intronic
969326025 4:6444310-6444332 CCTGGTGGAGACAGGGATGGAGG + Intronic
969501586 4:7556727-7556749 ATGGGTGGACACATGGATGGTGG - Intronic
969510541 4:7615061-7615083 ATGGGTAGACAGAGAGATGGTGG - Intronic
969599351 4:8166817-8166839 GTGGATGGACAGATGGATGGAGG - Intergenic
969669590 4:8582386-8582408 TGAGGAGGACAGAGGGATGGGGG - Intronic
969686258 4:8675982-8676004 CAGGGGAGACAGAGAGGTGGGGG + Intergenic
969696895 4:8740075-8740097 CAGGCTGGGCAGGGGGAGGGTGG + Intergenic
969720907 4:8892683-8892705 CGGGGTGGGCCGAGGGGTGGCGG - Intergenic
969967088 4:11008068-11008090 GAGGCTGGACAGAGGGAGTGAGG + Intergenic
970016630 4:11519439-11519461 CAGGCTTGTCAGAGGGTTGGGGG - Intergenic
970093646 4:12437480-12437502 AAAGGTGGACAGAGGGAGCGGGG + Intergenic
970322967 4:14893730-14893752 CAGGGTGAAGAGAGACATGGTGG - Intergenic
970538585 4:17055211-17055233 CAGTGTTGAGAGAGGGCTGGGGG - Intergenic
970573992 4:17409671-17409693 AATGGTGAGCAGAGGGATGGAGG - Intergenic
971068124 4:23058590-23058612 CAGGGTGGAGTGAGGGTTGAGGG + Intergenic
971395341 4:26221932-26221954 CAGGGCGGTGAGAGGGATGGGGG + Intronic
972074093 4:35061632-35061654 GAGGGGGGAGAGAGGGAGGGGGG + Intergenic
974093256 4:57334723-57334745 CAGGGTTGACTGTGGGTTGGTGG + Intergenic
975088037 4:70366779-70366801 TAGGGTGGAGAAAGGGGTGGTGG - Exonic
975683755 4:76899687-76899709 CTGGGTTGAGAGAGGGATAGTGG + Intergenic
977045479 4:92064007-92064029 AAGGGTGGACTGGGGGATAGTGG + Intergenic
977641637 4:99364061-99364083 AAGGGTAGTGAGAGGGATGGAGG - Intergenic
977651562 4:99475820-99475842 CAGGGTGGAGAGTGGGAGGAAGG - Intergenic
978342009 4:107728923-107728945 CAGGGTGAACAGGATGATGGTGG + Intergenic
978437227 4:108698655-108698677 GAGGGTGGAAAGAGGGCTGAGGG - Intergenic
978491000 4:109312296-109312318 GAGGGTGGAGGGTGGGATGGAGG - Intergenic
978612455 4:110558525-110558547 CAAGGTGGACAGATGGCTTGAGG - Intronic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
979516066 4:121611669-121611691 CATGGTTGACAGAGGTTTGGGGG + Intergenic
979563321 4:122124610-122124632 GAGGGTGGAGGGAGGTATGGAGG - Intergenic
979654287 4:123173992-123174014 AAAGGTGGACAGAGAAATGGTGG + Intronic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
980638308 4:135538783-135538805 CAGGGTGAACAGGGTGATGGTGG - Intergenic
981878291 4:149576294-149576316 CAGGGTGGAGAGTGGGAGGAGGG - Intergenic
982353558 4:154443026-154443048 TAGGCTGGACAGAGGGGAGGAGG - Intronic
982602655 4:157470895-157470917 CAGGTTGCACAGAGAGAGGGAGG - Intergenic
983066528 4:163216305-163216327 AAGGGAGGAGAGAGGGAGGGAGG + Intergenic
983387414 4:167082798-167082820 GAGAGAGGACAGAGGGAGGGAGG + Intronic
983620740 4:169758315-169758337 TAGGGTAGGGAGAGGGATGGAGG - Intergenic
984959094 4:185077327-185077349 CAGGGTGGAAAGAGAGAGGTCGG - Intergenic
985042723 4:185907755-185907777 CAGGAAGGAGAGAGGGAAGGAGG - Intronic
985095052 4:186404775-186404797 CAATGTGTACAGAGGCATGGAGG - Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985648802 5:1098088-1098110 CTGGGTGTGCAGAGGGTTGGAGG - Intronic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986269226 5:6216897-6216919 CAGGGTGGCCAGAAGCATGTAGG + Intergenic
986424201 5:7614284-7614306 CAGAGGGGATAGAGAGATGGAGG - Intronic
986538120 5:8813976-8813998 GAGCGTGGAGAGAGGGAAGGTGG - Intergenic
986660356 5:10053935-10053957 CAGGAGGGAGAGAGTGATGGGGG + Intergenic
986748346 5:10762842-10762864 CAGGGTGGCCAGAGAACTGGAGG - Intergenic
986936884 5:12900128-12900150 GAGGATGGAGAGAGGGAGGGAGG + Intergenic
987210890 5:15682092-15682114 CAAGGTGGTCAGAGGCAGGGTGG + Intronic
987287343 5:16469798-16469820 CAGGCTGTACAGAAGCATGGTGG - Intergenic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
989975156 5:50576863-50576885 CAGGGAGGACAGATGGATAAAGG + Intergenic
990341896 5:54831635-54831657 CAGGGGGGAAAAAGTGATGGTGG - Intergenic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
991116123 5:62957643-62957665 AAGGGAGGAGAGAGGGATAGAGG + Intergenic
991516250 5:67438856-67438878 GAGGGAGGACTGAGAGATGGGGG - Intergenic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
991923801 5:71683983-71684005 GAGGGTGGTCAGAGGCATAGGGG + Intergenic
992003018 5:72453473-72453495 GGGAGTTGACAGAGGGATGGAGG - Intronic
992077173 5:73202233-73202255 CAGGGCGGAGGGAGGGAGGGAGG + Intergenic
992681169 5:79154673-79154695 AAGGGTGGAAAGAATGATGGTGG - Intronic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
995247014 5:109946066-109946088 CAGAGTAGACAGGGTGATGGAGG + Intergenic
995888582 5:116923422-116923444 CAGGGCAGACAGTGGGAAGGAGG + Intergenic
996862560 5:128083325-128083347 CTGGGTGGAGAGAGGGGAGGTGG + Intergenic
996971016 5:129367799-129367821 CAGGGAGGAGAGAGGGAAAGGGG + Intergenic
997165934 5:131660176-131660198 CAGGGTGGACACAGTCTTGGTGG + Intronic
997197429 5:131989258-131989280 CAGGGTGGGAAGAGGAGTGGTGG + Intronic
997602905 5:135152510-135152532 TAGGATGGACAGAGGGATCATGG - Intronic
998228233 5:140343122-140343144 TAAGGTGGACAGTGGGGTGGAGG - Intronic
998478873 5:142444883-142444905 TAGGGAGGAAAGAGGGTTGGAGG + Intergenic
999431907 5:151531795-151531817 CAGCGTGGACAGCGGTATTGGGG + Exonic
999779757 5:154839801-154839823 CAGGGATGACAGAGTGATGGAGG - Intronic
1000643129 5:163729018-163729040 GAGGGTGGAGAGAGGGAAGAGGG - Intergenic
1000774789 5:165406309-165406331 GAGGGTGGAGGGAGGGAAGGGGG - Intergenic
1001085869 5:168699634-168699656 CAGGAAGGAAAGAGGGCTGGAGG + Intronic
1001228149 5:169963370-169963392 GAGGGAGCAGAGAGGGATGGAGG - Intronic
1001230084 5:169979148-169979170 CATGGGGAACAGAGGGGTGGAGG - Intronic
1001408708 5:171495295-171495317 AAGGAGGGACAGAGGGAGGGAGG + Intergenic
1001517038 5:172363163-172363185 ATGGATGGACAGATGGATGGAGG - Intronic
1001854081 5:174995623-174995645 CAGGGAGGAGAGAGGGGTGAGGG + Intergenic
1002259068 5:177981845-177981867 GATGGTGGACACATGGATGGTGG + Intergenic
1002565984 5:180113192-180113214 CAGGATGGACAGAGGGACCGGGG + Intronic
1002566017 5:180113287-180113309 CAGGATGGACGGAGGGACCGGGG + Intronic
1002635041 5:180603125-180603147 CAGGGCGGGCAGAGGGCTGGAGG - Exonic
1002723512 5:181280509-181280531 GAGGGTGGCCAGAGGGAGTGGGG - Intergenic
1003042336 6:2699915-2699937 CAGGCTGGATAGAAGAATGGAGG - Intronic
1003153135 6:3569916-3569938 CAGGGAGGGGAGAGGGAGGGAGG - Intergenic
1003173189 6:3736226-3736248 CAGGGGAGAAGGAGGGATGGAGG - Intronic
1003499927 6:6695559-6695581 GAGTGTGGGCTGAGGGATGGTGG + Intergenic
1004480900 6:16018426-16018448 CAGGGAGGAAAGAGAAATGGAGG + Intergenic
1004626858 6:17385068-17385090 AAGGGAGGAAAGAGGGAGGGAGG + Intergenic
1004632211 6:17432948-17432970 GAGGGGGGAGAGAGGGAGGGAGG - Intronic
1005814386 6:29538933-29538955 CGAGGTGGAGAGAGGGATGGGGG - Intergenic
1006259277 6:32854307-32854329 GAGGGTTGGCAGAGGGGTGGAGG + Intronic
1006620280 6:35359163-35359185 GTGGCTGGACAGAGGGAGGGAGG + Intronic
1006641463 6:35491743-35491765 CTGGGTGGAGGCAGGGATGGGGG + Intronic
1007282105 6:40720388-40720410 CGGGAGGGACAGAGGGAGGGAGG + Intergenic
1007746983 6:44049156-44049178 CAGCATGGACAAAGGCATGGAGG - Intergenic
1007797710 6:44363726-44363748 AAGGATGGAGAGAGGGAGGGAGG - Intronic
1007809136 6:44474102-44474124 CCTTGTGGTCAGAGGGATGGTGG + Intergenic
1007983428 6:46183078-46183100 CGGGGTGGGCAGTGTGATGGGGG + Intergenic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1008362313 6:50635468-50635490 AAGGGAGGAAAGAGGGAAGGAGG + Intergenic
1008547499 6:52596055-52596077 AAGAGAGGAGAGAGGGATGGGGG + Intergenic
1009338628 6:62526086-62526108 CACTGTGCACAGAGGGGTGGTGG - Intergenic
1009453096 6:63824811-63824833 GAGGGTGGCCAGAGGAACGGGGG + Intronic
1010273738 6:73945179-73945201 CATGGAGGACAGAGGGTGGGAGG - Intergenic
1011239397 6:85255216-85255238 CAGGGTTGAGAGAGAGATTGTGG - Intergenic
1011509831 6:88088318-88088340 CAGGGTGGTGAGAGGGCTGTGGG - Intergenic
1013175263 6:107671040-107671062 CCCGTTGGGCAGAGGGATGGAGG + Intergenic
1013219731 6:108067495-108067517 AAGGCAGGACAGAGGAATGGAGG + Intronic
1013346153 6:109262575-109262597 CAGGTCAGACAGAGGTATGGCGG + Intergenic
1013645043 6:112129056-112129078 CAGGGTGGATAGAGATGTGGAGG - Exonic
1013746454 6:113352311-113352333 CAGGGTGGAGAAAGGTAGGGAGG - Intergenic
1015085542 6:129286993-129287015 AAGGGAGGAAAGAGGGAAGGAGG + Intronic
1015085565 6:129287064-129287086 AAGGGAGGAAAGAGGGAGGGAGG + Intronic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015782988 6:136890574-136890596 GAGGGTGGACACGGTGATGGGGG - Intronic
1016308515 6:142709203-142709225 GAGGGTGGAAAGTGGGATGAGGG - Intergenic
1016317682 6:142808410-142808432 ATGGGTGGACAGAGGCAAGGAGG + Intronic
1016317750 6:142808690-142808712 AAGGATGGATGGAGGGATGGAGG + Intronic
1016866630 6:148773946-148773968 CGGGGAGGACAGAGGGAAGCTGG - Intronic
1017028582 6:150201677-150201699 CAGAGTGGAAACTGGGATGGCGG + Intronic
1017043333 6:150325095-150325117 CAGGGAGGAAAGAGAAATGGGGG - Intergenic
1017190561 6:151648775-151648797 GAGGGTGGCCAGAGGCACGGCGG - Intergenic
1017319686 6:153075427-153075449 CAGGGTAGAGGTAGGGATGGGGG - Intronic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1017762059 6:157577005-157577027 GAGGGTGGAGGGTGGGATGGGGG - Intronic
1018009326 6:159655363-159655385 GAGGGTGGCCAGAGGCATGGTGG + Intergenic
1018681620 6:166270192-166270214 CAGGGAGGACAGGAGGATGGAGG + Intergenic
1018868272 6:167761837-167761859 ATGGGTGGATGGAGGGATGGGGG - Intergenic
1019051592 6:169188024-169188046 GATGGGGGACAGGGGGATGGGGG - Intergenic
1019103388 6:169649991-169650013 GAGGGGGAATAGAGGGATGGAGG - Intronic
1019160707 6:170065868-170065890 GGGGGTGGATGGAGGGATGGAGG - Intergenic
1019160937 6:170066533-170066555 GGGGGTGGATGGAGGGATGGGGG - Intergenic
1019160945 6:170066551-170066573 GGGGGTGGATGGAGGGATGGGGG - Intergenic
1019315062 7:380518-380540 CAGCTCGGACAGAGGGAGGGAGG + Intergenic
1019406165 7:885404-885426 CGGGGTGGCGAGAGGTATGGTGG - Intronic
1019438474 7:1033918-1033940 CAGTGGGGACAGTGGGAGGGTGG - Intronic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019549253 7:1594032-1594054 CATAGAGGAGAGAGGGATGGAGG - Intergenic
1019621646 7:1995417-1995439 CAGGGTGGAGAGAGGAAGCGGGG - Intronic
1019635547 7:2073704-2073726 GAGGGTAGACAGAGGCATAGGGG + Intronic
1019704710 7:2491993-2492015 CTGGATGGAGAGATGGATGGTGG - Intergenic
1019726933 7:2608005-2608027 CAGGGTGGAGTCAGGGAAGGAGG + Intronic
1019730654 7:2627628-2627650 GAGGGAGGACAGAAGGAGGGAGG + Intergenic
1019896046 7:3984187-3984209 GAGAGGGGGCAGAGGGATGGAGG + Intronic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1020678163 7:11204352-11204374 CAGTGAGGACAGAGGAGTGGAGG + Intergenic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1022228743 7:28392122-28392144 GAGGGTGGACGGAGGGAGGAAGG + Intronic
1022311458 7:29200373-29200395 GAAGGTGGATAGAGGGAGGGAGG - Intronic
1023427092 7:40049209-40049231 AAGGGAGGAGAGAGGGAAGGAGG + Intronic
1023636822 7:42220379-42220401 ATGGATGGACAGAAGGATGGAGG + Intronic
1023984896 7:45088718-45088740 GAGGGGGGCCAGGGGGATGGGGG + Intronic
1024391413 7:48816947-48816969 GAGTGGGGACAGAGGGATGAAGG + Intergenic
1024959715 7:54961187-54961209 GAGAGAGGACAGAGGGAGGGAGG + Intergenic
1026017704 7:66683665-66683687 CAGGGTGGAGTGAGGGAGAGGGG + Intronic
1026025807 7:66742543-66742565 CAGGGTGGAGTGAGGGAGAGGGG + Intronic
1027228826 7:76260761-76260783 GAGGGTGGACAGAGAGATTCGGG - Intronic
1027234125 7:76287607-76287629 CAGGGTGGACATAGGCACAGGGG + Intergenic
1028239896 7:88406948-88406970 CAGGGCTGAGAGAGGGAGGGGGG - Intergenic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029348624 7:99997206-99997228 GAGGAAGGACAGAGGGAGGGAGG - Intergenic
1029478368 7:100798654-100798676 CAGGGCGGGCAGGGGAATGGAGG + Intergenic
1029632887 7:101764213-101764235 CAGGCTGGCCTGACGGATGGAGG - Intergenic
1029665423 7:101992143-101992165 CAGGGTAGAAAGAGGCTTGGAGG + Intronic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1031670211 7:124533599-124533621 CATGGTGGACAAAGGAAGGGAGG + Intergenic
1031703802 7:124958299-124958321 GAGGGTGGACAGAGGAACTGAGG + Intergenic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032095396 7:128935647-128935669 CAAGATGGACAGTGGGAAGGGGG + Intergenic
1032220069 7:129987886-129987908 CAGGCTGTACAGGGGGATTGAGG + Intergenic
1032591193 7:133193908-133193930 CAGGATGGACTGAAGCATGGGGG - Intergenic
1033239161 7:139663015-139663037 CATGGTGGCCAGTGGGAAGGTGG - Intronic
1033259296 7:139828629-139828651 TAAAGTGGACAGAGAGATGGAGG - Intronic
1033630080 7:143148958-143148980 CAGAGTGAACAGAGGGGTGCAGG - Intergenic
1033657580 7:143383416-143383438 CAGGGTGGACACGGGGGTTGCGG + Intronic
1035058443 7:156051991-156052013 ATGGTTGGATAGAGGGATGGAGG - Intergenic
1035260666 7:157659451-157659473 GAGGATGGTCACAGGGATGGGGG + Intronic
1035279175 7:157766454-157766476 ATGGGTGGATAGATGGATGGAGG - Intronic
1035459783 7:159031604-159031626 TAGGGTGGACGGAAGGACGGCGG + Intronic
1035692255 8:1568005-1568027 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692285 8:1568153-1568175 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692293 8:1568203-1568225 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692312 8:1568302-1568324 CTGAGTGGACAGTGGCATGGAGG - Intronic
1035692320 8:1568351-1568373 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692349 8:1568499-1568521 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692377 8:1568648-1568670 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692398 8:1568747-1568769 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692408 8:1568797-1568819 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692417 8:1568847-1568869 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035692437 8:1568946-1568968 CTGAGTGGACAGTGGCATGGAGG - Intronic
1035692444 8:1568996-1569018 CTGAGTGGACAGTGGCATGGGGG - Intronic
1035789671 8:2292611-2292633 CAAGGTGGACAGATGGCTTGAGG + Intergenic
1035803134 8:2429094-2429116 CAAGGTGGACAGATGGCTTGAGG - Intergenic
1035938823 8:3873552-3873574 CAGGGTGGACGGTGGGAGGAGGG + Intronic
1036744826 8:11399195-11399217 AGGGGTGGACAGAAGGATGGAGG + Intronic
1037011578 8:13850109-13850131 TAGGGTGGACAGTGGGTTTGAGG + Intergenic
1037776242 8:21837810-21837832 TAGGGTGGGCAGAGGGAAGGAGG - Intergenic
1037884443 8:22589048-22589070 CAGGGTCCAGAGAGGGAGGGAGG - Intronic
1038006300 8:23433210-23433232 AAGGGTGCACAGGGGGACGGCGG + Intronic
1038087690 8:24218025-24218047 GAGGGTGGAGAGATGGAAGGAGG + Intergenic
1038459636 8:27705091-27705113 CAGGGTGGAAAGTGTGAGGGAGG - Intergenic
1039277439 8:35948865-35948887 AAGGAAGGACAGAGGGAAGGAGG + Intergenic
1039474000 8:37829825-37829847 CAGGGTGGGCAGAGGGGTCACGG - Intronic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1039920657 8:41892148-41892170 GAGGGGGGAAAGTGGGATGGAGG - Intronic
1040558331 8:48500739-48500761 CAGGATGGTTAGAGAGATGGGGG + Intergenic
1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG + Intergenic
1040672124 8:49704424-49704446 CAGGGTGACCTGGGGGATGGTGG - Intergenic
1040969248 8:53115600-53115622 CTGGGTGGACAGTGGGCTGGGGG - Intergenic
1041577296 8:59413508-59413530 AAGGGTGGAGAGAGGGAGGCAGG + Intergenic
1041586140 8:59522083-59522105 GAGGGTGGAGAGGGGGAGGGTGG + Intergenic
1041683611 8:60620734-60620756 CAGGGAGGACAGCAGGCTGGGGG + Exonic
1042659063 8:71133791-71133813 CAGGTTGGACAGATAGATAGAGG - Intergenic
1042955341 8:74244317-74244339 CTGGGTGAACATAGGGGTGGTGG + Intronic
1043826132 8:84930772-84930794 AAGGGAGGAAAGAGGGAGGGAGG + Intergenic
1044429824 8:92095670-92095692 CAGGAGGGAAGGAGGGATGGAGG + Intronic
1046986280 8:120391817-120391839 CAGTTGGGACAGGGGGATGGGGG - Intronic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047212980 8:122854545-122854567 CAGGGTGGAAGGAGGGAAAGAGG - Intronic
1047346873 8:124037475-124037497 CAGTGGGGACAGAGGGACAGTGG + Intronic
1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG + Intronic
1048291893 8:133187446-133187468 ACGGATGGGCAGAGGGATGGAGG - Intergenic
1048492388 8:134906199-134906221 CAGTGGGGAAAGAGGGATGCTGG - Intergenic
1048979764 8:139697001-139697023 ATGGGTGGACGGATGGATGGTGG + Intronic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1048979801 8:139697168-139697190 GTGGGTGGACAGATGGATGGTGG + Intronic
1048989286 8:139751913-139751935 GATGGTGGATAGATGGATGGTGG - Intronic
1048989415 8:139752540-139752562 CATGGTGGATAGATGGATGGTGG - Intronic
1049370248 8:142260978-142261000 GAGGGAGGAGAGAGGGAGGGGGG + Intronic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049392975 8:142381504-142381526 CAGGGTGGGCTCAGGGACGGTGG + Intronic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049471052 8:142775182-142775204 GAGGGTGGCCAGGAGGATGGGGG + Intronic
1049501693 8:142970852-142970874 CAGAGAGGGCAGAGGGGTGGAGG + Intergenic
1049501718 8:142970924-142970946 CAGAGAGGGCAGAGGGGTGGAGG + Intergenic
1049691838 8:143964992-143965014 CAGGGTGGGCGGGGGGGTGGGGG - Intronic
1049844572 8:144793569-144793591 TAGGGTCGGCAGGGGGATGGAGG + Intergenic
1049867499 8:144948304-144948326 CAGGGTGCTCAGAGGAATGGTGG + Intronic
1050407133 9:5321591-5321613 CAGGAAGGAAGGAGGGATGGAGG + Intergenic
1050690415 9:8221295-8221317 CTGGCTGGACAAAGGGATGTGGG + Intergenic
1050865787 9:10497147-10497169 GAGGGTGGAGGGAGGAATGGGGG + Intronic
1051309974 9:15759106-15759128 AAGGCTGGAGAGAGGGAGGGAGG - Intronic
1052270788 9:26626101-26626123 CAGGTTGGACAGAGGCCTGCAGG - Intergenic
1052865696 9:33463528-33463550 GAGGGTGGTCAGATGGAAGGAGG - Intronic
1053307729 9:36995864-36995886 CAGGGAGCACAGGGGGGTGGAGG - Intronic
1053789702 9:41678135-41678157 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054155442 9:61636618-61636640 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054178040 9:61889825-61889847 CAGGGTAGACAGTGGGATCTTGG - Intergenic
1054475227 9:65567728-65567750 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1054659489 9:67690999-67691021 CAGGGTAGACAGTGGGATCTTGG + Intergenic
1055934132 9:81589298-81589320 GAGAGAGGGCAGAGGGATGGGGG - Intronic
1056587830 9:87939871-87939893 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1056609037 9:88113074-88113096 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1056765411 9:89441869-89441891 CCGTGTGGACAGAGGGCTAGAGG + Intronic
1056974241 9:91236066-91236088 CAGGAAGTACAGATGGATGGAGG + Intronic
1057022185 9:91707843-91707865 CAGTGTGGACAGGAGGATGGGGG + Intronic
1057695195 9:97318244-97318266 AAGCGGGGACAGAGGAATGGAGG - Intronic
1057761165 9:97875492-97875514 CCAGGTGGACAGAGGGATTCAGG + Intergenic
1057813160 9:98273409-98273431 CAGGGTGGGGAGAGGGGTTGGGG - Intergenic
1057968478 9:99529542-99529564 CAGGGTAGAAATAGGGCTGGTGG - Intergenic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1058506777 9:105674302-105674324 CAGGGAGGCCAGAGTGATGGAGG + Intergenic
1058935764 9:109767907-109767929 CAGGATGGAAGGAGGGAAGGTGG + Intronic
1059636025 9:116171496-116171518 AAGGGTGGACAGAGTGGTGGGGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060822434 9:126669245-126669267 GAGGGTGGAGACAGGGATGAGGG + Intronic
1061164243 9:128913212-128913234 AAGGGTGGACAGGGTCATGGAGG + Intronic
1061255664 9:129453371-129453393 GATGGGGGATAGAGGGATGGAGG + Intergenic
1061789678 9:133052386-133052408 CAGGGGGGAAGGAAGGATGGGGG - Intronic
1061887840 9:133601770-133601792 CATGGTGGTCAGATGGCTGGTGG - Intergenic
1061932958 9:133842770-133842792 CAGCGCGGGCAGAGGGGTGGAGG + Intronic
1062088218 9:134659627-134659649 CAGGGAGGACAGAGGGTTGTTGG - Intronic
1062100628 9:134726560-134726582 ATGAGTGGACAGACGGATGGAGG + Intronic
1062143988 9:134978884-134978906 GAGGGAGGATAGAGGGAGGGAGG + Intergenic
1062144026 9:134978993-134979015 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
1062174294 9:135152482-135152504 GAGGGAGCACAGAGGGATGTAGG - Intergenic
1062215301 9:135385894-135385916 CAGGGTGGGCACGGGGAGGGTGG - Intergenic
1062343416 9:136103836-136103858 CAGGGTGGACAGGTGGAGTGTGG - Intergenic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1062505229 9:136870674-136870696 CATGGTGGGCAGAGGGACAGGGG - Intronic
1062581637 9:137231537-137231559 CAGGGCGTAGAGAGGGAGGGTGG + Intronic
1203367761 Un_KI270442v1:273454-273476 CAGGGTGCAGAGATGGGTGGTGG + Intergenic
1185685516 X:1925225-1925247 CAGGGTGGAAAGAGTGAGAGAGG + Intergenic
1185944677 X:4361969-4361991 GAGGGTGGTGGGAGGGATGGGGG - Intergenic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186500207 X:10044888-10044910 CTGACTGGACAAAGGGATGGGGG - Intronic
1186579569 X:10803024-10803046 TAGGGGAGAGAGAGGGATGGGGG + Intronic
1187126367 X:16457757-16457779 GAGGGGGGAGGGAGGGATGGAGG + Intergenic
1187447646 X:19373058-19373080 CAGGGAGGAGGGAGGGAGGGAGG + Intronic
1187549753 X:20290377-20290399 CAGTGTGGCCAGTGGGATAGTGG + Intergenic
1189308180 X:40002943-40002965 CAGGGTGCAGAGAGGGGAGGAGG + Intergenic
1189354496 X:40300525-40300547 CAGAGAGGACACAGGGGTGGTGG - Intergenic
1189382861 X:40514062-40514084 CAGGGTGGAGTGAAGGAGGGAGG + Intergenic
1189650974 X:43189129-43189151 CAGGACAGACAGAGCGATGGAGG + Intergenic
1189774186 X:44455486-44455508 CTGAGTGTACTGAGGGATGGAGG + Intergenic
1192149208 X:68701564-68701586 CAAGGTGGACAGATGGATAGAGG + Intronic
1192449575 X:71235513-71235535 CAGTGTGAACAAAGGCATGGAGG - Intergenic
1195033710 X:100951252-100951274 AAAGGAGGACAGAGGGAGGGAGG + Intergenic
1195669146 X:107454540-107454562 CAGGGTGGACTGGGGCATAGGGG - Intergenic
1195937455 X:110139328-110139350 CAGGGAGGAGGGAGGTATGGAGG + Intronic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196338206 X:114564228-114564250 CAGGGTGGAGGGTGGGATGAGGG + Intergenic
1197712937 X:129685073-129685095 ATTGGTGGGCAGAGGGATGGTGG + Intergenic
1197841933 X:130757495-130757517 CAGGGAGGAAAGAGGTATGATGG + Intronic
1198395167 X:136212670-136212692 GAGGGTGGACCGAGGACTGGAGG - Intergenic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199706604 X:150431558-150431580 GAGGGTGGACGGAGGGAAGAGGG - Intronic
1200057830 X:153470770-153470792 CAGGGCGGACACAGGGAAGGGGG + Intronic
1200057840 X:153470793-153470815 CGGGGCGGACACAGGGAAGGGGG + Intronic
1200078321 X:153562942-153562964 CATGGTGGACAGAGGGAGCAAGG + Intronic
1200127591 X:153823872-153823894 CAGTGTGGAGATAGGAATGGAGG - Intronic
1201731239 Y:17206034-17206056 GAGGGTGGTGGGAGGGATGGGGG - Intergenic