ID: 1165556436

View in Genome Browser
Species Human (GRCh38)
Location 19:36636567-36636589
Sequence CCTGTAGGGTACCTGAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165556430_1165556436 -8 Left 1165556430 19:36636552-36636574 CCAGCCTCAACACCACCTGTAGG 0: 7
1: 20
2: 21
3: 29
4: 214
Right 1165556436 19:36636567-36636589 CCTGTAGGGTACCTGAAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165556436 Original CRISPR CCTGTAGGGTACCTGAAGTC CGG Intergenic
No off target data available for this crispr