ID: 1165560319

View in Genome Browser
Species Human (GRCh38)
Location 19:36673717-36673739
Sequence CTAGAGAAACAGAACAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 920
Summary {0: 1, 1: 6, 2: 38, 3: 145, 4: 730}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165560319 Original CRISPR CTAGAGAAACAGAACAAACA GGG (reversed) Intergenic
901334150 1:8434154-8434176 CTATAGAAACATAACACAAAGGG + Intronic
902164319 1:14557598-14557620 CCAGAGAAACAAAACCAATAGGG + Intergenic
902302663 1:15513322-15513344 CCAGAGAAAGAGAACCAATAGGG - Intronic
902582077 1:17414127-17414149 ATAAATAAACAGAACAAAAAAGG - Intronic
902954764 1:19917980-19918002 CTGCAGAAACAGAAAACACAGGG - Intergenic
903111588 1:21139204-21139226 CTAGAGTAATAGTATAAACAGGG - Intronic
903680544 1:25093494-25093516 TGAGAGAAACAGGAGAAACAGGG + Intergenic
904700490 1:32355074-32355096 CTATAGGAACAGACCACACAGGG - Intronic
904895298 1:33812822-33812844 ATAGAGAAACAGAATAGACATGG - Intronic
904968171 1:34396538-34396560 CCATAGAAAGAGAACAAATAGGG - Intergenic
905236353 1:36552621-36552643 TTAGAGACAGAAAACAAACAAGG - Intergenic
905492071 1:38352405-38352427 CCAGAAAAACATAACAAACATGG + Intergenic
905503823 1:38460527-38460549 GTAGAGAAAAAGAATAAAAAAGG + Intergenic
905664448 1:39754272-39754294 CTAGAGAAGCAGAACCAATAGGG + Intronic
905859562 1:41341210-41341232 TTAGAGAAACAGAACCACTAGGG + Intergenic
906780255 1:48567033-48567055 CCAGAGAAACAGGACAAATAGGG - Intronic
906834055 1:49063843-49063865 CTGGAGGAACAGAAGCAACAGGG - Intronic
906900096 1:49825874-49825896 CCAGAGAAACAGAACCAAAAAGG - Intronic
907613552 1:55899308-55899330 CTGGAGAAATAGAACCAATAGGG - Intergenic
908283733 1:62570605-62570627 CTAAACAAAAAGAACAAACCTGG + Intronic
908936166 1:69378661-69378683 TCAGAGAAACAGAACCAATAAGG + Intergenic
909158142 1:72107471-72107493 CAAAAGAAACATAACAAACTTGG - Intronic
909208908 1:72797268-72797290 ATAGACCAACAGAACAAATAAGG - Intergenic
910466570 1:87506595-87506617 CCAGAGAGAGAAAACAAACAGGG + Intergenic
910861641 1:91747962-91747984 CTAGAGAAACAGAACCAGTCGGG - Intronic
911467310 1:98271999-98272021 CTAAACAAAAAGAACAAACCTGG + Intergenic
911743959 1:101418858-101418880 CCAGAGAAACAGAAAAAAATAGG - Intergenic
911751195 1:101499925-101499947 CTAGAAAAACACCAGAAACAGGG - Intergenic
911889501 1:103349370-103349392 CTAGAGAGACAGAACCAATAAGG + Intergenic
912085334 1:105995560-105995582 CTAGAGGAACAGAACCAATAGGG + Intergenic
912146065 1:106795905-106795927 CTACAGAAAGAAAACATACATGG + Intergenic
912185853 1:107275030-107275052 CCAGGGAAACAGAACTAACAGGG + Intronic
912555872 1:110515736-110515758 CCAGAGAAACAGAGCCAATAGGG - Intergenic
912644272 1:111376778-111376800 CTAAGGAAAAAGAACAAAAATGG + Intergenic
912724720 1:112048737-112048759 CCAGAGAAAAAGAACCAATATGG - Intergenic
912744962 1:112238530-112238552 GCAGAGAAACAGAATCAACAGGG - Intergenic
912821135 1:112868645-112868667 CCAAAGAAACAGAAAAAAAACGG + Intergenic
912971777 1:114290417-114290439 CTAGAGGGACAGAACTAATAGGG - Intergenic
913483021 1:119307429-119307451 CTAGAGAAACAGAACCAATAGGG - Intergenic
913484542 1:119321897-119321919 CCATAGAAACAGAACCAAAAAGG + Intergenic
914264136 1:146023070-146023092 CTAGAGGAACAGAACTAATAGGG + Intergenic
914288962 1:146254981-146255003 CTTGAGAAACAGCAGAAACTGGG + Intergenic
915200531 1:154224152-154224174 AAAGAGACACAGAACACACAGGG - Intronic
915606930 1:156958245-156958267 CTAGAAAAACATAACAAAAGCGG + Intronic
915952119 1:160196449-160196471 GAAGAAAAAAAGAACAAACATGG - Intronic
916145656 1:161736734-161736756 CTAAAGAAGCAGAAAAATCATGG + Intergenic
916883485 1:169045259-169045281 GGAGGAAAACAGAACAAACAAGG - Intergenic
917276843 1:173340371-173340393 CCAGAGAAACAGAACTAATAGGG - Intergenic
917469272 1:175312685-175312707 CCAGAGAAACAGAACCAATAGGG - Intergenic
917621740 1:176803082-176803104 CGAAAGAAACAGAAGATACAAGG - Intronic
917649182 1:177059806-177059828 CTAGAGCAACAGATGAAATAAGG + Intronic
917766383 1:178223186-178223208 ATGGAGAATCAAAACAAACATGG + Intronic
918078412 1:181188077-181188099 CCTGAGAAACAGAACAAACTGGG + Intergenic
918536733 1:185583066-185583088 CTGGAGAAAAAGAGCACACAGGG + Intergenic
918603288 1:186390004-186390026 CAAGACAAACATAACTAACATGG - Intronic
918989644 1:191682239-191682261 CTACATAAAAAGAACAAACCTGG - Intergenic
919923880 1:202182188-202182210 CCAGAGAAACAGAACAAACAGGG + Intergenic
920003924 1:202818766-202818788 CAAGAGTAAAAGAAAAAACAAGG + Intergenic
920435768 1:205946062-205946084 CTAGGGAAACAGAAGACAGAAGG + Intergenic
920593711 1:207247933-207247955 CTAATGAATCAGACCAAACAAGG + Intergenic
921279798 1:213555235-213555257 CTGAAGAATCAGAACAAACTAGG + Intergenic
921313735 1:213871181-213871203 GAAGAGAAACAGTACAGACAAGG + Intergenic
922078742 1:222273748-222273770 CCAGAAAAACAGAACCAATAGGG + Intergenic
922272440 1:224045895-224045917 CTACAGAAAATGTACAAACAGGG - Intergenic
922345792 1:224695396-224695418 CCAGTAAAACAGAACCAACAGGG - Intronic
922528480 1:226324907-226324929 CTAGAGAGAGAGAACCAACAGGG + Intergenic
923134317 1:231104678-231104700 CTAGAGAAACAGAACCAATAGGG + Intergenic
923183032 1:231541207-231541229 CTACAAAAACAAAACAAAAAAGG - Intronic
923398746 1:233594128-233594150 CCAGAGAAACAGAACAAATAGGG + Intergenic
923472404 1:234303735-234303757 CAAGAGAAATGAAACAAACAAGG - Intronic
923828293 1:237524666-237524688 TGAGATAAACAGAACCAACAGGG + Intronic
924516766 1:244772722-244772744 CCAGAGAAACAGAACTAATAGGG + Intergenic
924608065 1:245552101-245552123 CCAGAGAAACAGAACCAGCAGGG + Intronic
924936385 1:248775284-248775306 CTAGAAAAACAGATCTAAAAGGG + Intergenic
1063438750 10:6055247-6055269 CTAGTGAATCAGACCAACCATGG + Intronic
1063443486 10:6092043-6092065 CTTAGGAAACATAACAAACATGG - Intronic
1063473402 10:6307372-6307394 CCAGAGAAACAGAACCAGTAGGG - Intergenic
1063827099 10:9910459-9910481 CTAGAGGGACAGAACTAATAGGG + Intergenic
1063905802 10:10778998-10779020 CAACAGAAAAAGAACAAAGATGG + Intergenic
1064240786 10:13626375-13626397 TTAGAAAAACAAAACAAAAAGGG + Intronic
1064364683 10:14697036-14697058 CTAGAGAGAGAGAAAAAAAATGG + Intronic
1064937443 10:20693795-20693817 GTAAAGAAACAGAAGAAAAAGGG - Intergenic
1065807993 10:29412552-29412574 ATAAAGAAACAGAACAAACTTGG - Intergenic
1067034386 10:42902082-42902104 CCAGAGAAACAGAACCACTAAGG + Intergenic
1067171167 10:43907145-43907167 ATAAAGAAAAAAAACAAACAGGG + Intergenic
1068327329 10:55510599-55510621 CTAAATTACCAGAACAAACAAGG - Intronic
1068722902 10:60266121-60266143 CTTAAGAAAGATAACAAACAGGG + Intronic
1068828354 10:61465199-61465221 CCAGAGAAACAGAATTAATAGGG + Intergenic
1068832699 10:61515818-61515840 CTAAAGAAAAAGAACAAGCCTGG - Intergenic
1069024838 10:63528351-63528373 CTAGAGAAAGAGAGGAATCAAGG - Intronic
1069402096 10:68059411-68059433 CGAGAGAAACAAAACAACCCAGG - Intronic
1070109187 10:73465946-73465968 CTAAAGAAAAACAACAAAAATGG + Intronic
1070400128 10:76046064-76046086 CTACAGGAACAAAACATACAAGG - Intronic
1070997685 10:80800288-80800310 CCAAAGAAACAGAACCAATAGGG - Intergenic
1071605619 10:86985757-86985779 CAAGAGACTCAGAAGAAACAGGG - Intergenic
1071759107 10:88580251-88580273 CCAGAGAAACAGAACCAATAGGG - Intronic
1071881669 10:89905576-89905598 CAACAGGAACAGAACCAACAGGG - Intergenic
1071898697 10:90094434-90094456 CAAGAGAAACAGAAACAATAGGG + Intergenic
1072150490 10:92679025-92679047 CTAGAGAAACAGAAGCTTCATGG - Intergenic
1072284814 10:93904327-93904349 CTAGAGTAACAGTGAAAACAGGG - Intronic
1072367242 10:94724734-94724756 CTAAAGAAGCAGAACAAATTTGG - Intronic
1072848527 10:98860157-98860179 CCAGGGAAACAGAATAAATAGGG - Intronic
1072879358 10:99209569-99209591 CTAGAAAAAAAGAACAAACTAGG + Intronic
1072997535 10:100258854-100258876 CTAGAGAAATAAGACCAACAAGG + Intronic
1073583610 10:104688617-104688639 GTAGAGAAAAAGAACAAGAAAGG - Intronic
1073679960 10:105692409-105692431 ATAGGGAAACATACCAAACAAGG - Intergenic
1073774704 10:106772513-106772535 CCAAAGAAACAGAACCAATAAGG - Intronic
1073820727 10:107260864-107260886 ATAAAAAAACGGAACAAACAAGG + Intergenic
1074318621 10:112380762-112380784 CTTAAGAAACAAAACAAAAAAGG - Intronic
1074965281 10:118485608-118485630 TTAGGTAAACAGAACAAATAAGG + Intergenic
1074993656 10:118735891-118735913 CTAGATAATCAGAACAGACAAGG + Intronic
1075383185 10:122035313-122035335 GTAGAGAAGCAAGACAAACAAGG + Intronic
1075559002 10:123454919-123454941 CCAGAGAAATAGAACCAATAGGG + Intergenic
1075646526 10:124100432-124100454 CCAGAGAAACAGAACCAATAAGG + Intergenic
1076228528 10:128800586-128800608 CCAGAGAAACAGAATCAATAGGG + Intergenic
1076476163 10:130753036-130753058 CCAGAGAAACAGAACCAATAGGG + Intergenic
1076591474 10:131586729-131586751 TCAGAGGAACAGAACCAACAGGG - Intergenic
1076940079 10:133599087-133599109 CCAGAGAAACAGAACCAATAGGG - Intergenic
1077381573 11:2243902-2243924 CCAGAGAAACAGAACCAACAGGG + Intergenic
1078363360 11:10687345-10687367 CTAGAGAAACAGAAGAGGGAGGG - Intronic
1078564915 11:12406086-12406108 CCAGAGAAACAGAACCAGTAGGG + Intronic
1078755702 11:14206996-14207018 CTACAGAAACCAAAAAAACATGG + Intronic
1079361665 11:19775538-19775560 GTAGGGAAACAAAACAGACAAGG + Intronic
1079871059 11:25798461-25798483 CCAGAGGAACAGAACCAATAGGG + Intergenic
1080041872 11:27767723-27767745 CTAGAGAGACAGAACTAATAGGG + Intergenic
1080086117 11:28284855-28284877 CTAAAGAAACAAAATATACATGG + Intronic
1080227999 11:29982717-29982739 CTAGAGTCAAAGTACAAACAGGG + Intergenic
1080364360 11:31553765-31553787 CTAGAGAAACTGAACCAATAGGG - Intronic
1080798174 11:35585167-35585189 CTTTAGAAAAAGAAGAAACATGG + Intergenic
1081262283 11:40975364-40975386 CCAGAGAGACAGAACCAATAGGG - Intronic
1081482598 11:43503607-43503629 CCAGAGAAGCAGAACCAATAGGG + Intergenic
1081723753 11:45310398-45310420 AGAGAGAGACAGAACCAACATGG - Intergenic
1082054449 11:47801648-47801670 CTAGAGAAATTAAAGAAACATGG - Intronic
1083221348 11:61254802-61254824 CAAGAGAAAAAGACCAATCAAGG - Intergenic
1083704258 11:64502643-64502665 CCAGAGAAACAGAACCAACATGG + Intergenic
1084478008 11:69399893-69399915 CCAGAGAAACAGAATCAATAGGG + Intergenic
1084486903 11:69453486-69453508 CCAGAGAAACAGAACCCAGAGGG + Intergenic
1084733261 11:71088337-71088359 CCAGAAAAACAGAACCAATAGGG - Intronic
1085466795 11:76729617-76729639 CTAGAGAAACTGTTCACACAGGG + Intergenic
1085591883 11:77770646-77770668 ATAAAGAAACACACCAAACATGG + Intronic
1085956280 11:81400076-81400098 CTGGAAATACTGAACAAACAAGG - Intergenic
1086239001 11:84666511-84666533 CCAGAGAAACAGAACCAATATGG - Intronic
1086621203 11:88888374-88888396 ATAGAGAAAGTGAAGAAACAGGG + Intronic
1087013084 11:93531564-93531586 GCAGAGAAACAGAACCAATAGGG - Intronic
1087552509 11:99669598-99669620 CTAGAAAAATATATCAAACAGGG - Intronic
1087856967 11:103103848-103103870 CCAGAGAAACAGAATCAACAGGG + Intergenic
1088409580 11:109519684-109519706 TTAGAGAAACAGGATAAACTGGG + Intergenic
1088532092 11:110821406-110821428 CCAGAGGAACAGAACCAATAAGG - Intergenic
1088729069 11:112664767-112664789 CAAGAGAAACTGAAAAAAAAAGG + Intergenic
1089000314 11:115046344-115046366 CTAGAGAAACAGCACTAGTAAGG + Intergenic
1089421418 11:118333868-118333890 CTAGAGAAACAGAACCAATAGGG + Intergenic
1089649401 11:119902684-119902706 CCAGAGAAACAGAACCGATAGGG + Intergenic
1090301715 11:125647473-125647495 CTTGAAAAAAAGAACAAACTTGG - Intronic
1090688592 11:129153434-129153456 CTAAGCAAAAAGAACAAACATGG + Intronic
1090814259 11:130277174-130277196 GTAGAGGAACAAAACAGACATGG - Intronic
1091812384 12:3410213-3410235 CTTGAGAAACCTAAAAAACATGG - Intronic
1092013008 12:5131452-5131474 TTAGAGAGACAGACCAACCATGG - Intergenic
1092023026 12:5217863-5217885 CTAGAGAAAATGAACAAGAAAGG - Intergenic
1092027953 12:5258829-5258851 CTAGAGAAACAGAACTAACAGGG - Intergenic
1092676538 12:10927262-10927284 CCAGAGAAAGGGAACAAAGAGGG - Intronic
1093655717 12:21692144-21692166 CTTGAGAACCAGAGCAACCAGGG + Intronic
1093769821 12:23005318-23005340 CTAGAGAAACAAAACAAATAAGG + Intergenic
1093927654 12:24925493-24925515 CCAGGGAAACAGAACCAATAGGG - Intronic
1094195419 12:27744185-27744207 TTAGAAAAACAAAACATACATGG - Intronic
1094861240 12:34469067-34469089 CAACAGCAACAGAACAAACCTGG - Intergenic
1095134429 12:38582461-38582483 CTAGAAAATAAAAACAAACAAGG - Intergenic
1095320282 12:40818903-40818925 CTATTGAAAGAAAACAAACAAGG - Intronic
1095655397 12:44662866-44662888 ATACAGAAGCAAAACAAACATGG + Intronic
1096219173 12:49817518-49817540 CTTGAGCAAAAGAACAAACTTGG + Intronic
1097411852 12:59264774-59264796 CCAGAGAAACTGAATAAAAATGG - Intergenic
1097593732 12:61602531-61602553 ATACAGAAAGAGACCAAACATGG + Intergenic
1097686161 12:62692905-62692927 CAAAAGCAAGAGAACAAACATGG - Intronic
1097767171 12:63539393-63539415 CCAGAGAAACAGAACCAACAGGG + Intergenic
1097783518 12:63734339-63734361 CCAGAGAAACAGAACCAACAGGG + Intergenic
1098223925 12:68301242-68301264 CTAGAGAAACAGGAACACCACGG + Intronic
1098360970 12:69654230-69654252 CTAGAAAAGCAGCACAACCAGGG + Exonic
1098875942 12:75866791-75866813 CCAGAGAAACAGAACGAATATGG - Intergenic
1098992175 12:77075863-77075885 CCAGAGAAACAGAACCAATAGGG - Intergenic
1099070866 12:78044372-78044394 CTAAAGAAAAAGAACAAAGCTGG - Intronic
1099375809 12:81895085-81895107 CTAGAGAAACAGAAAGTCCATGG - Intergenic
1099504000 12:83449626-83449648 CCAGAGAAGCAGAACAAATAGGG + Intergenic
1099821413 12:87715818-87715840 CTAAACAAAAAGAACAAACCTGG + Intergenic
1099949770 12:89288732-89288754 CCAGAGAAAGAGAACCAATAAGG + Intergenic
1100034699 12:90236408-90236430 CCAAAGAAACAGAACCAATAGGG - Intergenic
1100082906 12:90874931-90874953 CTAGAGGGACAGAACTAATAGGG - Intergenic
1100332517 12:93597864-93597886 GCAGTGAAACAGAAAAAACATGG - Intergenic
1100621236 12:96276036-96276058 CTTGAGAAAGAGAACAAAGTTGG + Intergenic
1101403554 12:104408912-104408934 CCAGAGAGACAGAACCAACAGGG + Intergenic
1101485063 12:105148616-105148638 GCAAAGAAACAGAAAAAACAAGG + Intronic
1101991498 12:109489342-109489364 CTAGAGACCCAGACCAAGCAAGG - Intronic
1102326343 12:111988391-111988413 CTTAAAAAACAAAACAAACAAGG + Intronic
1102714399 12:114957295-114957317 CCAGAGAAACAGACCCAATAGGG - Intergenic
1103124774 12:118411863-118411885 CTAGAGAAACAAAACCAAGATGG - Intronic
1103425689 12:120831329-120831351 CCAGAGAAATAGAACCAATAGGG - Intronic
1103428580 12:120861349-120861371 CTAGAAAAACAGAAAAAGGAAGG + Intronic
1104181674 12:126387747-126387769 CTAGAGAAGCAGAACCAATAGGG + Intergenic
1104325950 12:127798609-127798631 CTAAAGCAACAGAACCAAAAAGG - Intergenic
1104563539 12:129859978-129860000 CCAGAGGGACAGAACTAACAGGG - Intronic
1106066518 13:26357621-26357643 CCAGAGATGCAGAACCAACAAGG + Intronic
1106259496 13:28053087-28053109 TTAGAAAGACAGAAGAAACATGG + Intronic
1106931457 13:34670287-34670309 CTAGAGGGACAGAACTAATAAGG - Intergenic
1107208094 13:37819878-37819900 CTAGAGGAACTAAAAAAACAAGG + Intronic
1107324756 13:39229929-39229951 CCAGAGAAACAGAACTAATAGGG - Intergenic
1107637862 13:42411126-42411148 CCAGAGAAACAGAACCAATATGG + Intergenic
1108948334 13:56053160-56053182 TTAAAGGAACAGAAAAAACAAGG + Intergenic
1108972178 13:56391675-56391697 CTAGACAGATTGAACAAACAAGG + Intergenic
1109110355 13:58310337-58310359 CAAGAGAAACAGAAAAAAGGAGG - Intergenic
1109166820 13:59045561-59045583 CCACAGAAACAGGACAGACAGGG - Intergenic
1109665755 13:65534006-65534028 CAAGGAAAACTGAACAAACATGG - Intergenic
1109779257 13:67085684-67085706 CCACAGAAACAGAACAAAGTAGG - Intronic
1109785976 13:67175421-67175443 CTACAGAAACACTACAAGCAGGG + Intronic
1110017456 13:70425814-70425836 CTAGAAAGACAAAATAAACAAGG + Intergenic
1110182186 13:72630665-72630687 CTAAACAAAAAGAACAAATATGG + Intergenic
1110943057 13:81376034-81376056 CTAGGGAAACAGAAAAAAGGAGG - Intergenic
1110972200 13:81778538-81778560 CCAGAGAAAACAAACAAACATGG - Intergenic
1111317208 13:86578204-86578226 GTGGAGAAACAGAAAAAAAAAGG - Intergenic
1111559254 13:89923572-89923594 CCAGAGAATCAGAACCAACACGG - Intergenic
1111895210 13:94133436-94133458 TTAAAAAATCAGAACAAACAGGG + Intronic
1112002509 13:95224214-95224236 AAAGAGAAACATTACAAACAAGG + Intronic
1112805113 13:103156183-103156205 CTAGAAAAACAAGACAAATAGGG - Intergenic
1112997507 13:105592405-105592427 CTAGAGTGACAGAACGAATATGG + Intergenic
1113041046 13:106104138-106104160 GTAGAGGGACAGAACAGACAGGG - Intergenic
1113134159 13:107071024-107071046 CCAGGGAAACAGAACCAACAGGG + Intergenic
1113144117 13:107187698-107187720 TGAGAGAAAGAGAACAAAAAGGG - Intronic
1113325901 13:109280935-109280957 TTAGAGAAACAGAATAAACAGGG + Intergenic
1113427030 13:110216714-110216736 CTAGTGACCCAGAAAAAACAGGG - Intronic
1113574645 13:111386418-111386440 CCAGAGAAACAGAGCCAATAGGG + Intergenic
1113773075 13:112924269-112924291 CTACAGAGACAGCACAGACACGG + Intronic
1114192070 14:20447282-20447304 GTGGAAAAACAGAAGAAACATGG + Intronic
1114360231 14:21963726-21963748 CTAGCTGAACAAAACAAACATGG - Intergenic
1115972183 14:38957904-38957926 CATGACAAACAGAACAAAGATGG + Intergenic
1116032606 14:39590711-39590733 CTAGAGAAGCAGAGCAGAGAAGG - Intergenic
1116335034 14:43647039-43647061 CTAGAGAAATAAGATAAACATGG + Intergenic
1116445795 14:45009397-45009419 CTAGACAAAAAGAACAACTAGGG - Intronic
1116651903 14:47604291-47604313 CTAAAGAAAAATAATAAACATGG - Intronic
1116665195 14:47765869-47765891 CTAGAGAACCCCGACAAACATGG - Intergenic
1116688948 14:48080334-48080356 CCAGAGAAACAGAACAAATAGGG - Intergenic
1117145417 14:52832574-52832596 GGAGAGAAACAGAACCAATAGGG - Intergenic
1117163339 14:53010327-53010349 CTAGTGAAAATGAACAAATAAGG + Intergenic
1117372156 14:55088486-55088508 CCAGAGAAACTGAACACATAGGG + Intergenic
1117434630 14:55704142-55704164 CCAGAGAAATAGAACCAATAGGG - Intergenic
1117560554 14:56933613-56933635 CCAGAGAAACAGAATCAATAAGG + Intergenic
1117822765 14:59668153-59668175 CTACAGAAAAAGAACAAAGCTGG + Intronic
1118012178 14:61621251-61621273 CCAGAGAAACAGAACCAATAGGG - Intronic
1118214462 14:63795542-63795564 CTAGAGGGACAGAACTAATAGGG - Intergenic
1118416366 14:65541248-65541270 CTAGAGAAACAGTACCAATAGGG + Intronic
1118480268 14:66157906-66157928 CTAAAGAAAGAGAACAATCTTGG - Intergenic
1118722235 14:68602430-68602452 CCAGAGAAACAGAACCAACAGGG + Intronic
1119668794 14:76503311-76503333 CTCCATAAAGAGAACAAACAAGG + Intergenic
1119872051 14:78026425-78026447 TCAGAGAAACAGAACCAACAGGG - Intergenic
1120161970 14:81155611-81155633 TGAGAGAAAGAGAAGAAACAAGG - Intergenic
1120355713 14:83430891-83430913 TTAGAGTAATAGAACAAAAAAGG - Intergenic
1120596353 14:86442175-86442197 CTAGAGAGACAGAACTAATAGGG + Intergenic
1121197144 14:92084201-92084223 CTAGAGGGACAGAACTAATAAGG - Intronic
1121220303 14:92279839-92279861 CCAGAGAAACAGAACAAATTGGG + Intergenic
1121539696 14:94716013-94716035 CCAGAGAAACAGAACCAACAAGG + Intergenic
1121555082 14:94830336-94830358 CCAGAGAAACAGAGCCAACAGGG - Intergenic
1121914814 14:97828689-97828711 CTAGAGAAACTGTACATACAGGG + Intergenic
1121915897 14:97836745-97836767 CTAGAGAACCAGAACAGCCAAGG + Intergenic
1122030968 14:98911602-98911624 CTAGAGAAAGAAAACCAACATGG - Intergenic
1122087271 14:99316662-99316684 CCAGAAAGACAAAACAAACATGG + Intergenic
1122385341 14:101341543-101341565 CCAGAGAAACAGAACCACCAGGG - Intergenic
1123726915 15:23112347-23112369 CTGGAGCAACACAACAAGCAGGG + Intergenic
1124080001 15:26484678-26484700 CTACAGAAACAGAAAAGAGATGG + Intergenic
1124153785 15:27207892-27207914 TTACAGAAACAGGACAACCAGGG + Intronic
1124236224 15:27991525-27991547 TTAGAGAAACAGAAAGATCAGGG + Intronic
1124401737 15:29354399-29354421 CCAGAGAAACAGAACCAATGGGG - Intronic
1124723939 15:32138327-32138349 CTAGAAAAATAGACCAAAAAGGG + Intronic
1125620244 15:41054527-41054549 ATAGAGAAAAATAACAAAAATGG + Intronic
1126855713 15:52837566-52837588 CTCTAGAGAAAGAACAAACAGGG - Intergenic
1126909755 15:53405186-53405208 CCAGGGAAACAGAAATAACAGGG + Intergenic
1127330623 15:57935887-57935909 CTAGGCAAAAAGAACAAAGATGG - Intergenic
1127401504 15:58591154-58591176 AGAGAGAGACAGAGCAAACAGGG + Exonic
1127505403 15:59593202-59593224 CTACAAAACCAGAACAAAGAGGG + Intergenic
1128223717 15:65987012-65987034 CTCGAGGAACAGAACAAGCCGGG - Intronic
1130027681 15:80283832-80283854 CCAGAGAAAGAGAACCAATAGGG - Intergenic
1130058677 15:80552988-80553010 CTAGAGAAACATAACAGTGAGGG - Intronic
1130625601 15:85511230-85511252 CCAGAGAAACAGGCCAAACAAGG - Intronic
1130710737 15:86278569-86278591 CTTGAAAAATAAAACAAACATGG - Intronic
1131778234 15:95825662-95825684 CTAAAGTCACTGAACAAACAGGG + Intergenic
1131871253 15:96767466-96767488 CAAGAGGAACAGAAAAAAGAGGG - Intergenic
1133656110 16:7866079-7866101 CTACAGAAAAAGAAAAACCACGG - Intergenic
1133709132 16:8384395-8384417 CCAGAGAAACAGAACCAATAGGG - Intergenic
1133905528 16:10018779-10018801 CTAGAGAATCAGAGCAACCTCGG - Intronic
1134181956 16:12055077-12055099 CTAGAGAAACAGAACCAGTGTGG + Intronic
1135383768 16:22017274-22017296 TTAGAGAAGCATATCAAACACGG - Intronic
1135459111 16:22626115-22626137 CTAGAGAAACAGAACCAACAGGG + Intergenic
1135727858 16:24870838-24870860 CTAGAGATGCAGAAGAAAGATGG + Intronic
1136302074 16:29342083-29342105 CAAGAGAAAGTAAACAAACACGG - Intergenic
1136677880 16:31930061-31930083 CTAGAGAAACAGAACAAGACAGG + Intergenic
1138187994 16:54991385-54991407 CCAGAGAAACAGAATCAATAGGG + Intergenic
1138753073 16:59447671-59447693 CTTGAAAACCAGCACAAACAAGG - Intergenic
1138973520 16:62174674-62174696 CCAGAAAAACAGAACCAATAGGG - Intergenic
1139197570 16:64938648-64938670 CTAGAGGACCATAAAAAACAAGG - Intergenic
1139551649 16:67676450-67676472 CCAGAGAAACAGAACCAATAGGG - Intronic
1140101752 16:71923929-71923951 CTACAGTAACTGAAGAAACAAGG - Intronic
1140172394 16:72619434-72619456 CTAGAGAAAAAGTATAAATAAGG + Intergenic
1140593150 16:76376883-76376905 CCAGAGAAACAAAACTAACAAGG + Intronic
1140797851 16:78457154-78457176 CAACAGAAACAAAACAAAAAAGG - Intronic
1141017094 16:80460916-80460938 GTAGAGGAACAGAATAAACCTGG + Intergenic
1141959920 16:87398605-87398627 CAAGAGCAACATAACATACATGG - Intronic
1142613589 17:1122782-1122804 CTAGAGAAACAAAACCAACAGGG - Intronic
1142806618 17:2374594-2374616 AAAAAGAAATAGAACAAACAAGG + Intronic
1143129125 17:4665033-4665055 CTAGGGAAGCAGAAGCAACAAGG + Intergenic
1143630490 17:8136944-8136966 GGAGAGAAAGAGAACAATCAAGG + Intergenic
1144155242 17:12494067-12494089 CTAGAGGGACAGAACTAATAAGG - Intergenic
1144188947 17:12825386-12825408 TTAGAGAAACAGAACCAATAAGG + Intronic
1144346882 17:14357464-14357486 CCAGAAAAACAGAAACAACAGGG + Intergenic
1145348715 17:22058639-22058661 TTAAAGTAAAAGAACAAACAGGG - Intergenic
1146081985 17:29788693-29788715 TTAGAGAAATAGAACCAAAAAGG - Intronic
1146236455 17:31169408-31169430 CTAAAGGAACATAACAAACAAGG - Intronic
1146501472 17:33368561-33368583 TTAGATAATCAAAACAAACAAGG + Intronic
1147504367 17:41000738-41000760 CAAGAGTCACAGAACAATCATGG + Intergenic
1148635337 17:49144749-49144771 TTAGAGGGACAGAACTAACAGGG + Intronic
1148654337 17:49272052-49272074 CCAGAGAAACAGAACCAGTAGGG + Intergenic
1148844154 17:50518922-50518944 CTGCCGAACCAGAACAAACAGGG - Intronic
1149229297 17:54514586-54514608 CTAGACAAAAAGAACAAAGCTGG - Intergenic
1149440992 17:56673702-56673724 CTAAAGCCACAGAATAAACAGGG + Intergenic
1151421222 17:73999197-73999219 GGAGAGAAAAAGAACAAACGCGG + Intergenic
1152057459 17:78041149-78041171 CAGGAGAAACGGAACAAACACGG + Intronic
1152545618 17:80998815-80998837 GTAAAGGAACAGAACAAACGTGG - Intronic
1152766652 17:82144821-82144843 CTAGTGAAAAAGAACAAATTAGG - Intronic
1152977293 18:234017-234039 ATAGAGAAACATTACAAAAATGG - Intronic
1153184266 18:2469469-2469491 ATAGAGAAACAGAACTAATGGGG - Intergenic
1153426140 18:4966344-4966366 CCAGAGAAAAAGAACAAAACTGG + Intergenic
1153561818 18:6378760-6378782 CTAGGCAAAAAGAACAAACCTGG - Intronic
1153584583 18:6608089-6608111 CCAGAGAAACAGAACCAATAAGG + Intergenic
1153602060 18:6790477-6790499 CAAGAAAAACAGAAGATACAGGG + Intronic
1153655161 18:7275559-7275581 CCAGAGAAAGAGACAAAACAGGG - Intergenic
1153984951 18:10343568-10343590 GTAGAGAAACAGCACACACAAGG + Intergenic
1154258858 18:12810960-12810982 ATTGAGTAACAAAACAAACAAGG - Intronic
1154505650 18:15038245-15038267 CTTGAGAAACAGAAGGACCAAGG - Intergenic
1155246392 18:23914277-23914299 TTGGAGAGACAGAATAAACAAGG - Intronic
1155534967 18:26807788-26807810 CAAAAGAAACAGGACAAAAATGG - Intergenic
1155686780 18:28563102-28563124 CTAGAGGGACAGAACTAATAGGG + Intergenic
1155779699 18:29815493-29815515 CTTGAGAACCAGAATAAGCAAGG + Intergenic
1156426200 18:37015439-37015461 CTAAAGAAAAAGAACAAAGTTGG - Intronic
1156556607 18:38075570-38075592 CCAGAGAAACAGATCTAAGAGGG + Intergenic
1156850681 18:41722323-41722345 CTAGAGAAACACAAGGACCATGG + Intergenic
1156967228 18:43108879-43108901 CAAAAGAAACAAAATAAACAAGG - Intronic
1157206161 18:45701836-45701858 TTTGAGAAACAGAGCAAAAAAGG + Intergenic
1157939334 18:51909827-51909849 CTAGAGAAACAAAACCAATAGGG - Intergenic
1157969001 18:52243660-52243682 CTAAAGATACAGCACAAACTGGG + Intergenic
1158212128 18:55063476-55063498 CCAGAGAAACAGAACCAATGGGG - Intergenic
1158678666 18:59546884-59546906 CTAGAAAAACAGAAAAAGAATGG - Intronic
1158772752 18:60541098-60541120 CTAGAAAAACAGCCCAATCAGGG - Intergenic
1158799699 18:60891949-60891971 CTAAAGAAACAGAATAAGCAGGG + Intergenic
1159169953 18:64753292-64753314 CCAAAGAAACAGAACCAATAGGG - Intergenic
1159194432 18:65094309-65094331 CAACAAAAACAGAAGAAACAGGG + Intergenic
1159422642 18:68243127-68243149 CCAGAGAGACAGAACTAATACGG - Intergenic
1159486336 18:69063034-69063056 CTTGAGAACCAGAACAAAACAGG + Intergenic
1161836057 19:6647435-6647457 CCAGAGAAACAGAACCAAGGAGG - Intergenic
1162226427 19:9226404-9226426 CTAGCCAATCAGGACAAACACGG - Intergenic
1163733081 19:18961470-18961492 CCAGACAAACGGAAGAAACAAGG + Intergenic
1163940406 19:20487123-20487145 CTAAGCAAAAAGAACAAACATGG + Intergenic
1164194698 19:22945919-22945941 CTAGAGAAAGAGGAGAGACAAGG - Intergenic
1164299849 19:23952261-23952283 CTAAAGAAACTGGACCAACAGGG - Intergenic
1165070742 19:33253620-33253642 CTAGAGAGACAGGACAGCCATGG - Intergenic
1165217141 19:34283409-34283431 CCAGAGAAGCAGAAATAACAAGG + Intronic
1165265488 19:34659838-34659860 CTAAATAAAAAGAACAAAGATGG + Intronic
1165560319 19:36673717-36673739 CTAGAGAAACAGAACAAACAGGG - Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167973072 19:53201032-53201054 AAAGAGAAACAGAACAAGCTGGG - Intergenic
1168118295 19:54238334-54238356 CCAGTGAAAAAGAAGAAACATGG - Intronic
1168200535 19:54812176-54812198 CCAGGGAGACAGAACACACAGGG + Intronic
1168289254 19:55349145-55349167 CATGAGAAAGAAAACAAACAGGG - Intergenic
925447020 2:3935628-3935650 CTAGTCAAAAAGAACAAACCTGG - Intergenic
925818883 2:7779586-7779608 TTAGAGAAACAGAACCAGTAGGG - Intergenic
925864748 2:8217650-8217672 CTAGAGGCACAGAACACTCAGGG - Intergenic
926498460 2:13621132-13621154 CTAAGCAAACAGAACAAAGATGG - Intergenic
926625633 2:15087259-15087281 TCAGAGAAACAGAACCAATATGG - Intergenic
926762716 2:16293197-16293219 CTAGAGGAGCAAAACAAAAACGG + Intergenic
926781133 2:16472956-16472978 CCAGAGAAACACAACTAACAGGG - Intergenic
927011113 2:18905383-18905405 CTTGAGAAACAGAACAAAGCAGG - Intergenic
927409929 2:22813630-22813652 CCAGAGAAACAGAACAATGAGGG + Intergenic
927425184 2:22973574-22973596 CTAGAGGAACAGAACTAATAGGG - Intergenic
927740062 2:25560734-25560756 CTAGAGAAACAGACTCAATAGGG - Intronic
928222493 2:29416143-29416165 CCAGAGAAACAGAACCAGGAGGG - Intronic
928241965 2:29594395-29594417 ATAGACAAACAGTACAAATAAGG + Intronic
928244482 2:29615309-29615331 CTAGAAGAACAGAAGAAAGAGGG - Intronic
928319567 2:30272331-30272353 CCAGAGAAACAGAACAAATTAGG - Intronic
928407496 2:31025704-31025726 CCAGAGAAACAGAACCAACAGGG + Intronic
928753983 2:34502036-34502058 CCAGAGAAACAGAGCAGAGAAGG - Intergenic
928782099 2:34835706-34835728 CTAAACAAAAAGAACAAACCTGG + Intergenic
928794838 2:35005583-35005605 CTAAGGAAAAAGAACAAACCTGG + Intergenic
929728130 2:44454649-44454671 ATAGAGAAACAGATCAGAAATGG - Intronic
929821231 2:45275459-45275481 CCAGAGAAACAGAACCAACAAGG - Intergenic
929853520 2:45614836-45614858 CCAGAGAAACAGAACTAGTAGGG - Intergenic
930180710 2:48353294-48353316 ATAGAGGAACAAAATAAACAAGG - Intronic
930448189 2:51500971-51500993 CTAGGTAAACAAAACAAACTGGG - Intergenic
930476261 2:51886531-51886553 AAAGAGAAACAGTAAAAACAGGG - Intergenic
930623631 2:53670691-53670713 CTGGAGAAACAAAAAAAGCAAGG + Intronic
930626402 2:53703056-53703078 CTAGAAAAACAGACAAAACCAGG + Intronic
930839589 2:55830753-55830775 CTAAAGAAAAAGAACAAAGCTGG + Intergenic
930839782 2:55832971-55832993 CTAAACAAAAAGAACAAAGATGG - Intergenic
931607548 2:64067145-64067167 GTAGAGAAAGAGAAGAAACAAGG - Intergenic
931660627 2:64559244-64559266 CCAGATAAACAGAACCAATAGGG + Intronic
932098370 2:68872913-68872935 CTAGAGGGACAGAACTAATAGGG - Intergenic
932100299 2:68893316-68893338 CTAGAGAAACTAGAGAAACAAGG - Intergenic
933162696 2:79043847-79043869 CTCAATGAACAGAACAAACAAGG - Intergenic
933450832 2:82448489-82448511 CCAGAGAAAGAAAACAAAAAAGG + Intergenic
933656745 2:84894790-84894812 CTAGAGAAAGAAAAAACACATGG + Intronic
933829121 2:86192250-86192272 CCAGAGAAACAGAAACAATAAGG - Intronic
935360286 2:102240924-102240946 CTTGAGACACAGGACAAACAAGG + Intergenic
935498262 2:103807714-103807736 CCAGAGAAACACAACCAACAGGG + Intergenic
935610710 2:105022285-105022307 CTATATAAACAAAACAGACATGG + Intergenic
935884921 2:107607204-107607226 ACAGAGAAACAGAACTAACAGGG - Intergenic
936381139 2:111987364-111987386 CAAGAAAAATAGAACAAAAAAGG - Intronic
936606132 2:113956496-113956518 ATACTTAAACAGAACAAACAAGG - Intronic
936897369 2:117443924-117443946 CTAGAGAAACAGAGCCAAACAGG + Intergenic
937547324 2:123038520-123038542 CTAGAGAAGAAGAAATAACAAGG + Intergenic
937971588 2:127553200-127553222 CTAAACAAAAAGAACAAATATGG - Intronic
938574584 2:132592213-132592235 CTAAAGAGAAAGATCAAACATGG + Intronic
938683395 2:133714309-133714331 CTAGAGGGACAGAACTAATAGGG - Intergenic
938746893 2:134287750-134287772 CTAGAGAGATTGAACAAAAAAGG - Intronic
938982525 2:136540054-136540076 CTAGAGAAACAGAACCAATAGGG + Intergenic
939034216 2:137111712-137111734 CTGGCTAAACAGAATAAACAAGG - Intronic
939754919 2:146098577-146098599 CTAGAAAAACATAACCAAAAGGG - Intergenic
939817039 2:146909098-146909120 CTAGATAAACAAAACCAAGATGG + Intergenic
939817530 2:146914549-146914571 CTAGAGAAACAGAACCAGTAGGG - Intergenic
940041511 2:149366538-149366560 CCAGAGAAAAAGAACAAGGATGG + Intronic
940243324 2:151587040-151587062 CTAGAGAAACAGAACCAATAGGG - Intronic
940244280 2:151597593-151597615 CTAGAGAAACAGAACCAATAGGG - Intronic
940245236 2:151608139-151608161 CTAGAGAAACAGAACCAATAGGG - Intronic
940548724 2:155124125-155124147 CCAGAGAAACAGAACCAATTCGG - Intergenic
940698338 2:157009188-157009210 CTTGAGAAAGAGAACAAAGCTGG - Intergenic
941499033 2:166245998-166246020 CTATAGAAATACAGCAAACAAGG + Intronic
941802191 2:169672334-169672356 CCAGAGAAACAGAACCAAGAGGG + Intronic
941966779 2:171308640-171308662 CTAGAGAGATAGAACCAATAGGG + Intergenic
942500546 2:176585746-176585768 ATAGACAAACAGAAAAAATAGGG + Intergenic
942899512 2:181097056-181097078 CCAGAGAAACAGAACCAATAGGG + Intergenic
943244924 2:185434662-185434684 CCAGAGAAACAGAACCATTAAGG + Intergenic
943265998 2:185733749-185733771 CAAGCAAAACAGAACCAACAGGG - Intergenic
943399307 2:187385557-187385579 CAAGAGAACCAGAAAATACAGGG + Exonic
943513538 2:188856525-188856547 CTAGAGAGACAGAACTAATAGGG + Intergenic
943746486 2:191467566-191467588 CTAGAGAGAGAGAAAAAAAAGGG + Intergenic
943919375 2:193683230-193683252 GTTGAGAACCAGAACAAGCAAGG - Intergenic
944293773 2:198038790-198038812 ATATACAAACAGAACAAAAAGGG + Intronic
944572553 2:201059260-201059282 CCAGAGAAACAGAACCAATAAGG - Intronic
944579981 2:201124080-201124102 CTAGAGAAGCAGTAGAAAGAAGG + Intronic
944788703 2:203101440-203101462 CTAGACAAAAAGAACAAAGCTGG - Intronic
944876710 2:203969561-203969583 CTAGAGACACAAAGAAAACATGG - Intergenic
945000550 2:205345639-205345661 CTAGAGAATTTGAACAAAAAAGG + Intronic
945174510 2:207029010-207029032 CTAAACAAAAAGAACAAACTTGG + Intergenic
945244066 2:207702223-207702245 ATAGAGGAAAGGAACAAACAGGG - Intergenic
946113620 2:217442569-217442591 CCAGAGAAACAGAACCAATATGG + Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946315433 2:218908433-218908455 TTAAAGTCACAGAACAAACAAGG + Intergenic
947082154 2:226410746-226410768 CCAGAGAAACAGAACCAATGTGG - Intergenic
947348990 2:229222906-229222928 CCAGAGAAACAGAACCAATAGGG - Intronic
947452113 2:230218176-230218198 TTTAACAAACAGAACAAACATGG + Intronic
948246212 2:236488760-236488782 CTAGTAAAACAGAAAAATCAGGG + Intronic
1168937319 20:1676667-1676689 CTAGACAAAGAGAAACAACACGG - Intergenic
1169135510 20:3194869-3194891 CTAGAGAAGCAGAGAAATCAGGG + Intronic
1169175219 20:3505510-3505532 CCAGAAAAACAGAACAAATTGGG - Intronic
1169425221 20:5491522-5491544 CAAGACAAACAGAACAGACTTGG - Intergenic
1169992544 20:11519422-11519444 CTAGACAAACTGACCAAGCAAGG + Intergenic
1170151970 20:13235861-13235883 CAAGAGAAACAGAACATGCCTGG + Intronic
1170654568 20:18274053-18274075 CTAGATGACCACAACAAACAAGG - Intergenic
1171045505 20:21806462-21806484 CCAGAGAAACAGAATCAATAGGG + Intergenic
1171379891 20:24726720-24726742 CCAGGGAAACAGAACCAATATGG + Intergenic
1171397450 20:24845878-24845900 CTAAACAAAAAGAACAAAGATGG - Intergenic
1172582739 20:36061272-36061294 CCAGAGAAAGAGAACCAATACGG - Intergenic
1173692299 20:44971210-44971232 CTAGACAATCATAACAAACATGG - Intronic
1173942778 20:46926199-46926221 CCAGAGAAACAGAAAAAAATAGG + Intronic
1174733895 20:52945647-52945669 TCAGAGAAACAGAGCCAACAGGG + Intergenic
1175480236 20:59305455-59305477 CTAGAGAGACAGAACCAACAGGG + Intronic
1176273343 20:64247843-64247865 CCAGAGAAACAGAACCAATAGGG + Intergenic
1176375358 21:6084387-6084409 CTAGAAAAATAAAACAAAAAAGG - Intergenic
1176792211 21:13330871-13330893 CTTGAGAAACAGAAGGACCAAGG + Intergenic
1176916590 21:14633235-14633257 CTAGAGAAACAGAAGTAATAGGG - Intronic
1177088927 21:16741891-16741913 CTAGATAAACATAACAAAACAGG + Intergenic
1177972285 21:27805428-27805450 CCAGAGAAACAGGACCAATAGGG + Intergenic
1177991606 21:28041735-28041757 CTTGAGAAACAGAAGGACCAAGG + Intergenic
1178026194 21:28470811-28470833 CTTGAGAACTGGAACAAACAAGG + Intergenic
1178026239 21:28471440-28471462 CTAAACAAAAAGAACAAACCTGG + Intergenic
1178111027 21:29370346-29370368 CCAGAGAAACAGAACCAATAAGG - Intronic
1178199152 21:30383207-30383229 CCAAAGAAACAGAACCAATAGGG + Intronic
1178216789 21:30607640-30607662 CTAAACAAAAAGAACAAAGATGG + Intergenic
1178511940 21:33212711-33212733 CCAGAGAAACAGAACCAATGAGG + Intergenic
1179314366 21:40228509-40228531 TTTGAGCAACAGAACAAATAAGG - Intronic
1179748116 21:43453857-43453879 CTAGAAAAATAAAACAAAAAAGG + Intergenic
1180596659 22:16979714-16979736 CTAAGCAAAAAGAACAAACATGG + Intronic
1181101579 22:20544020-20544042 CTAAAGAAACAAAGGAAACAAGG - Intronic
1181587845 22:23863586-23863608 CCAGAGAGAGAGAAAAAACAGGG - Intronic
1181685722 22:24526581-24526603 CTAGAGAAGCAGAACCAGTAGGG - Exonic
1181898594 22:26133174-26133196 CTAGTGATACAGCAAAAACATGG - Intergenic
1182016338 22:27043166-27043188 CTAGATAAACAGGACAGAAATGG + Intergenic
1182776497 22:32835028-32835050 CAATGGAAACAGCACAAACAAGG - Intronic
1183123884 22:35756033-35756055 CCAAAGAAACAGAAAAAAAAAGG + Intronic
1183269761 22:36853722-36853744 CCAGCAAAGCAGAACAAACAGGG + Intergenic
1183844902 22:40534764-40534786 CTAGATAAACACACCAAACATGG - Intronic
1184625699 22:45726979-45727001 CTAGAGAAACAGAACCAACTAGG - Intronic
1185114490 22:48923931-48923953 CCAGAGAAACAGAATAAACAGGG - Intergenic
1185114493 22:48923950-48923972 CTGGAGAAACATAACTAATACGG + Intergenic
1185200459 22:49499892-49499914 CCAGAGAAACAGAACCAGTAGGG + Intronic
1185302827 22:50091418-50091440 CTGGAGAATCTCAACAAACACGG - Intronic
949203267 3:1406621-1406643 CCAGAGAAACAGAGCCAATAGGG + Intergenic
949607458 3:5670014-5670036 CCAAAGGAACAGAACCAACAGGG + Intergenic
949659156 3:6257141-6257163 CTAGAGGGACAGAACTAATAGGG - Intergenic
949666770 3:6348246-6348268 CCAGAGAAGAAGAACAAATATGG + Intergenic
950333679 3:12177149-12177171 CCAGAGAACCAGTACAAAAAAGG - Intronic
950721382 3:14885143-14885165 CTAGAGGAACTGAACAAAGGGGG - Intronic
951046587 3:18046442-18046464 CAAGAGAGACAGTACAAGCATGG - Intronic
951387523 3:22060293-22060315 TTAGAGAAACAGAACCAATAGGG - Intronic
951539092 3:23765433-23765455 CTAGAGACACTGAACGAACAGGG + Intergenic
951545267 3:23818566-23818588 AGAGAGAGACAGAGCAAACATGG - Intronic
951633417 3:24745908-24745930 CTAGAGAAATAGAACAAATAGGG - Intergenic
951960698 3:28315966-28315988 GTAGAGAAACAGTACAATCATGG - Intronic
952705930 3:36378128-36378150 CTAGAGAAACAAGATGAACATGG + Intergenic
953118121 3:40012918-40012940 CCAGAGAAACTGAACCAATAGGG - Intronic
953208855 3:40856623-40856645 CCAGAGAAACACAACCAATAGGG - Intergenic
953772096 3:45785650-45785672 CTAGAGGGACAGAACTAATAGGG - Intronic
953846746 3:46433552-46433574 CTAGGGAAACTGAACAAAGGGGG - Intergenic
954418052 3:50403768-50403790 CTTGGGATACAGCACAAACAAGG - Intronic
954638257 3:52083322-52083344 GTGGCGAAACAGAGCAAACAAGG + Intronic
954899202 3:54004563-54004585 CCAGGGAAACAGAATCAACAGGG + Intergenic
955927718 3:64023914-64023936 TTAGGGAAACAGACCAACCAAGG + Intronic
957395818 3:79636322-79636344 CTAGAGAAACAACAAAAATAGGG + Intronic
957412991 3:79864205-79864227 CCAGAAAAACAGAACACACAGGG + Intergenic
957426525 3:80046540-80046562 CTAGACAAAAAGAACAAAGCTGG + Intergenic
957994078 3:87666299-87666321 CCAGTGAAACAGAACAAATGGGG + Intergenic
958157132 3:89769866-89769888 CTAGAGTAACACAAGCAACATGG + Intergenic
958649268 3:96916601-96916623 GGAGAGAAACAGAAGAGACAGGG + Intronic
958959826 3:100498598-100498620 CCAGAGAAACAAAACCAACAGGG - Intronic
959085346 3:101846762-101846784 CCAGAGAAACAGAACCAATAGGG + Intronic
959099227 3:101991591-101991613 CTAAAGAAACAGAGCATCCAAGG - Intergenic
959135344 3:102411830-102411852 CCAGAAAAACAGAACCAATAGGG + Intronic
959279030 3:104314133-104314155 CTAGAGAAACAAAAAATACCAGG + Intergenic
959474321 3:106790721-106790743 CTAGACACACTGAACAAAAAGGG + Intergenic
959516111 3:107269018-107269040 GTAGAGAAACAGAAAATCCATGG + Intergenic
959633224 3:108532652-108532674 GCAGAGAAACAGAACCAATAGGG - Intergenic
959743823 3:109753371-109753393 TCAGAGAAACAGAACAAATGGGG - Intergenic
960372110 3:116853217-116853239 CCAGAGAAACAGAACCAATAGGG - Intronic
960754342 3:120993741-120993763 CTAAAGAAAAAGAACAAAGCTGG - Intronic
960911919 3:122657849-122657871 CTAGAGAAACAGAACCAACAGGG + Intergenic
961491610 3:127260359-127260381 CTATAGAAGTAGAACAAAAATGG + Intergenic
962382097 3:134906160-134906182 AAAGGGAAACAGAATAAACATGG - Intronic
962666483 3:137658979-137659001 CTAAGTAAAAAGAACAAACATGG + Intergenic
963007794 3:140742023-140742045 CAAGAGAAACAGAAGCAATAGGG + Intergenic
963344596 3:144079535-144079557 CCAGAGAAACAGAACCAACAGGG - Intergenic
963378902 3:144504528-144504550 CTAGAGGGACAGAACTAAGAGGG + Intergenic
963408643 3:144902308-144902330 CAAGAGAAAGAGACCAAAAAAGG - Intergenic
963516113 3:146310360-146310382 CAAGAGAAAAAGTACAAACAAGG - Intergenic
963534109 3:146506568-146506590 CCAGAGAAAGAGAACCAATAGGG + Intergenic
963894816 3:150674001-150674023 TTAGAGAAGCACTACAAACATGG - Exonic
964196607 3:154072227-154072249 CTAGAGAAACTAGAAAAACACGG + Intergenic
964413994 3:156428534-156428556 CCAGAGAAACAGAACCAATAGGG - Intronic
964903599 3:161691492-161691514 CTAGGGAAACAGCAAAAGCAAGG - Intergenic
965014320 3:163137112-163137134 CTGAAGAAAAAGAACAAACCTGG - Intergenic
965029738 3:163350460-163350482 CCAGAGAAATAGAACCAATATGG - Intergenic
965115982 3:164488931-164488953 CTTAAAAAACACAACAAACAAGG - Intergenic
965229656 3:166034242-166034264 CTAAACAAAAAGAACAAACGTGG - Intergenic
965246596 3:166279416-166279438 CCAGAGAAACAGAACCAGTAGGG - Intergenic
965256508 3:166420528-166420550 CTTGAAAACCAGCACAAACAAGG - Intergenic
965488248 3:169305488-169305510 GCAGAAAAAAAGAACAAACATGG + Intronic
965614899 3:170584590-170584612 CTAGAGAAACAGGAGAAGAAGGG - Intronic
965712366 3:171568282-171568304 CCAGAGACACAGAAGAAGCATGG + Intergenic
965941244 3:174184648-174184670 TGAGAGAAATAGAAGAAACAGGG + Intronic
966263112 3:178003575-178003597 CTAGAGAAACAGTGAAAACATGG - Intergenic
966346027 3:178981245-178981267 GTAGAGAAACTACACAAACAAGG - Intergenic
966495327 3:180573620-180573642 CCAGAGAAACAGAACCAATAGGG - Intergenic
967201572 3:187076665-187076687 TTAGAGGAAGAGAAGAAACATGG + Exonic
967248424 3:187512703-187512725 CTAGAGGAACAGAACTAATGGGG + Intergenic
967348128 3:188481560-188481582 TTAGAGAAACAGAGTAAAGAAGG + Intronic
967560813 3:190917486-190917508 CTTGAGAACCAGAACAAAACAGG - Intergenic
967692316 3:192490166-192490188 AAAGAGAAACACAAGAAACAAGG - Intronic
967943244 3:194782532-194782554 CCAGAAAAACAGAACCAATAGGG - Intergenic
967944118 3:194788679-194788701 CTAGAGAAACAGAACCAACAGGG + Intergenic
968223112 3:196953156-196953178 CCAGAGAAACAGAAACAATAGGG - Intronic
968691962 4:1995298-1995320 CCAGAGAAACAGAACCAAGAGGG - Intronic
969133631 4:5012019-5012041 CAAGAGATACAGAGGAAACAGGG + Intergenic
969149782 4:5159422-5159444 CTAGTGAAACAGAACCAATGGGG + Intronic
969948904 4:10813469-10813491 ATACAGAAACCCAACAAACAAGG - Intergenic
969967399 4:11011429-11011451 CTTGATAAACAGGACAGACAGGG - Intergenic
970043804 4:11826969-11826991 CTTGAGTAACAGAAAAAAAAGGG - Intergenic
970648601 4:18152203-18152225 CTTGAGAACTGGAACAAACAAGG + Intergenic
971077426 4:23166141-23166163 CAAGAGAAAGGGAACAAGCATGG + Intergenic
971109194 4:23563845-23563867 CCAGAGAAACAGAATAAAAAGGG + Intergenic
971808025 4:31385639-31385661 CCAGAGAAACAGAACCAACAGGG - Intergenic
971876276 4:32312957-32312979 CTAGAGAAAGAGAACCAGCAGGG - Intergenic
972044139 4:34641911-34641933 ATAGTGAAAAAGAACAAAGAAGG + Intergenic
972093536 4:35318858-35318880 CCAGAGAAACAAAACTAATAGGG - Intergenic
972289174 4:37675548-37675570 CTAGTTAGACAAAACAAACATGG + Intronic
972686428 4:41358148-41358170 CAGGAGAAAGAGAACAAAGAGGG + Intergenic
972784320 4:42312854-42312876 TTAGAGAAACAGGTTAAACACGG - Intergenic
973015125 4:45128548-45128570 CCAGAGAAACAAAACAAAACAGG + Intergenic
973594885 4:52478035-52478057 CCAGAGAAACAGAACCAACAGGG + Intergenic
973694256 4:53474621-53474643 CTGTAGTAACAGAATAAACATGG - Intronic
973873827 4:55194174-55194196 CTAGGCAAAAAGAACAAAGATGG + Intergenic
974104164 4:57449046-57449068 CTTGAGAAAAAGAACAAAGCTGG - Intergenic
974529968 4:63096205-63096227 CCAGAGAAACAGAACCAAGAGGG + Intergenic
974574028 4:63693478-63693500 CCAGAGAAACAGAATCCACAGGG + Intergenic
974609666 4:64199979-64200001 ACAGAAAAACAGAACAAAAAAGG + Intergenic
974831357 4:67193330-67193352 CAAGAGGAACCGAACCAACAAGG + Intergenic
974883326 4:67786141-67786163 CTAGAGAAATAGAACCAGCCAGG + Intergenic
975086245 4:70343269-70343291 CCAGAGAAACAGAACCAAATGGG + Intergenic
975107076 4:70579575-70579597 CTAAACAAAAAGAACAAACCCGG + Intergenic
975177446 4:71304148-71304170 CCAGAGAAACAGAACCAAGAGGG + Intronic
975496548 4:75041791-75041813 CTAGAGAAAGAGAGCAATGAGGG + Intronic
975544384 4:75546572-75546594 CTAGAGAAACAGAACCAATAGGG + Intronic
976396090 4:84557279-84557301 CCAGAGAAACAGAACAAATAGGG - Intergenic
976576904 4:86683121-86683143 GCAGAGAAACAGAACCAATAGGG + Intronic
976775406 4:88700666-88700688 CCAGAGAAACAGAACCAACAGGG + Intronic
977283515 4:95071889-95071911 CCAGAGAAACAGAGCCAATAAGG + Intronic
977440208 4:97056471-97056493 ATAGAGAAACCACACAAACAAGG - Intergenic
977446768 4:97140550-97140572 CTAGAGAACCAGAAAAGCCATGG + Intergenic
977763923 4:100775469-100775491 CTAGAGAAAAAGGTCACACAAGG - Intronic
977841243 4:101708705-101708727 CTAGCGAAACTGAACAAAATAGG + Intronic
977846862 4:101777156-101777178 CTAGAGGGACAGAACTAATAAGG - Intronic
978429344 4:108617417-108617439 CTAGAGAAACAGAACTGATAGGG - Intergenic
978800460 4:112751043-112751065 GTACAGAAACGGAACAAAGAAGG + Intergenic
978859865 4:113435504-113435526 CTATATAAATAGAAGAAACAAGG + Intergenic
979426216 4:120571270-120571292 CTAGAGAAGCCGCACAATCATGG + Intergenic
980133666 4:128840470-128840492 GAAGAGAAGCAGAACAAAAAGGG - Intronic
980205319 4:129711977-129711999 CAAGAGAAACAGAATATACTTGG + Intergenic
980217256 4:129868289-129868311 CTAGAGGGACAGAACTAATAGGG - Intergenic
980282905 4:130743292-130743314 CTAAATAAACAGAACAAAGCTGG - Intergenic
980497946 4:133608694-133608716 CTAGAGGGACAGAACTAATAGGG + Intergenic
980718982 4:136668126-136668148 CTAGAGAAACTGAAGTAAGATGG - Intergenic
981041874 4:140230630-140230652 CCAGAGAAATAGAACCAATAGGG + Intergenic
981960742 4:150535483-150535505 ATATAGAAAGAGAACAAAGAAGG - Intronic
982374247 4:154672268-154672290 CTAGAGAAACTGCACTAGCAGGG + Intronic
982520092 4:156405733-156405755 CTAAACAAAAAGAACAAATATGG + Intergenic
982951038 4:161696400-161696422 CTAAACAAAAAGAACAAATATGG - Intronic
983845245 4:172509882-172509904 CTAAGGAAACAGAACAAATCTGG - Intronic
983974323 4:173914655-173914677 CTAGAGAAATAGAAACAAAATGG + Intergenic
983992335 4:174135868-174135890 CAAGTGAAATAGAACAAACTCGG + Intergenic
984085563 4:175306541-175306563 ATAGAAAAAGAGAACAGACAAGG - Intergenic
984163531 4:176282405-176282427 CTATAGAAAAAGAAAAAACAAGG + Intergenic
984390928 4:179131262-179131284 CTAGAGGGATAGAACTAACAGGG - Intergenic
984470986 4:180173254-180173276 GTAGAAAAACAGAACAAAAAAGG + Intergenic
985798782 5:1987285-1987307 AGAGAGAAAGAGAGCAAACAGGG - Intergenic
985868787 5:2537572-2537594 CTATGCAAACCGAACAAACAGGG - Intergenic
986365963 5:7031985-7032007 CAAAAGAAAAAAAACAAACAAGG - Intergenic
986749158 5:10770656-10770678 CCAGAGAAACAGAACCAACAGGG - Intergenic
987154250 5:15071966-15071988 CCAGAGAATCAGAATCAACAGGG - Intergenic
987305230 5:16631232-16631254 CCAGAGAAACAGAACCAATAGGG + Intergenic
987578008 5:19755405-19755427 CTAGAGGGACAGAACTAACAGGG + Intronic
987964064 5:24849608-24849630 ATACACAAACAGAACATACATGG - Intergenic
988102695 5:26702358-26702380 CTAGAGGGACAGAACAAACAGGG - Intergenic
988365241 5:30289801-30289823 CCAAAGAAAAAGAAAAAACAAGG - Intergenic
988477811 5:31603231-31603253 CTAGTGAAGCAGAAAAAAGAGGG - Intergenic
988962689 5:36385455-36385477 CAAGAAAAACAGAAGTAACAAGG - Intergenic
988980111 5:36559687-36559709 CCAGAGAAATAGAACCAATAGGG - Intergenic
989263746 5:39448503-39448525 CTAGAGGGACAAAACAAATAGGG + Intronic
989692701 5:44163808-44163830 CTAGAGAAAAAAACCAAATATGG + Intergenic
990054491 5:51554581-51554603 CCAGAGAAACAGAACAAACAGGG - Intergenic
990095393 5:52105444-52105466 TTGGATAAATAGAACAAACACGG + Intergenic
990221146 5:53589985-53590007 CTAGAGGGACACAACTAACAAGG - Intronic
990317713 5:54599531-54599553 CTAAAGAAAAAGAACAAAGCTGG + Intergenic
990384039 5:55242116-55242138 CTAGAGCAACAGAAATAAAAAGG - Intergenic
990774930 5:59295653-59295675 CTACAAAAACAGAATACACAGGG - Intronic
991538744 5:67703564-67703586 CTGAAGAAAAAGAACAAACTTGG + Intergenic
992433962 5:76737463-76737485 TGAGAGAAACAGACCAAAAAAGG - Intergenic
992716810 5:79519405-79519427 CTAGAGAAATAGAACCAATAGGG + Intergenic
992929717 5:81630345-81630367 CTAGCGAAACACAATAATCAGGG + Intronic
993111103 5:83658320-83658342 CTGGAGAAACAACATAAACAAGG - Intronic
993170594 5:84413991-84414013 CCAGAGAAACAGAATTAACGTGG - Intergenic
993299606 5:86191754-86191776 CCAGAGAAACAGAGCCAATAGGG - Intergenic
993614126 5:90089503-90089525 CTAGGCAAAAAGAACAAATATGG + Intergenic
993737887 5:91499394-91499416 CCAGAGCAACTGAACAAACCCGG - Intergenic
993815264 5:92536487-92536509 GTAGAGATTCAGAACAATCATGG - Intergenic
993897586 5:93556109-93556131 CTACAGAAGCAGAAAGAACATGG - Intergenic
994177506 5:96727826-96727848 CAAGAGGAACAGAAGAAAAAAGG + Intronic
994212915 5:97106112-97106134 CTAAGGAAACAGAATATACATGG - Intronic
994400059 5:99267331-99267353 AAAGAGAAACAGAAGAAACAAGG + Intergenic
994752279 5:103752634-103752656 CCAGAGAAACACAACTAATAGGG + Intergenic
994875681 5:105418084-105418106 CTAAGCAAAAAGAACAAACATGG + Intergenic
994957163 5:106546741-106546763 CTAGACAAACAGAAAGCACAAGG - Intergenic
995176109 5:109179461-109179483 CTAGAGTAACAGAACATAGGAGG - Intronic
995682525 5:114736034-114736056 CTAGGCAAACAGAACAAAGCTGG - Intergenic
995915137 5:117236449-117236471 CTAGAGAAAAAAAAAAAAGACGG - Intergenic
996468307 5:123829240-123829262 CTAGAGGAACAGAACTAATAGGG + Intergenic
997874183 5:137533892-137533914 CCAGAGAAACAGAACTAATAGGG - Intronic
998475788 5:142420416-142420438 CTAGAAAAAAAAAACAAACAGGG - Intergenic
998476628 5:142427678-142427700 CTGGGTAAACACAACAAACAAGG + Intergenic
998494729 5:142578176-142578198 CCAGAGAACCAGAACCAATAGGG + Intergenic
998815095 5:146006041-146006063 CTAAAGACACAAGACAAACATGG + Intronic
999194324 5:149771712-149771734 CTAGGCAAACAGAAAGAACAAGG - Intronic
999490277 5:152043506-152043528 CCAGAGAAACTGAACCAATAGGG - Intergenic
999590977 5:153145318-153145340 CTAGAGAAAACCAATAAACAAGG + Intergenic
999670509 5:153955404-153955426 TTAGAGAAATAAAATAAACATGG + Intergenic
1000144166 5:158437034-158437056 CCAGAGAAACTGAACAAATTTGG + Intergenic
1000152813 5:158519872-158519894 GGAAAGAAAAAGAACAAACAAGG - Intergenic
1000387322 5:160687282-160687304 CTAGAGATACATAAAAAAAATGG - Intronic
1000440786 5:161260632-161260654 CTGGGGAAACAGAATAAAAATGG + Intergenic
1000445552 5:161314427-161314449 CTAGGGAGACATAACAAAAATGG - Intronic
1000550487 5:162656569-162656591 GTGGAGAAACAAAACAGACATGG - Intergenic
1000724762 5:164755667-164755689 CTTGGGAAGCAGAACAAAAAAGG - Intergenic
1000730357 5:164827647-164827669 CTAGAGGGACAGAACTAATAGGG - Intergenic
1001188911 5:169607700-169607722 CCATAGTAACAGAACAAAGAGGG + Intergenic
1001547101 5:172577105-172577127 CAAGAGAAAAAGAACACAAAGGG + Intergenic
1001643841 5:173265354-173265376 CTAAAGAAAAAGAACTAACCCGG - Intergenic
1001676157 5:173518055-173518077 CCAGAGAAAGAGAACCAATAGGG + Intergenic
1001783021 5:174386805-174386827 CCAGAGAAACACAACCAACAGGG - Intergenic
1002346101 5:178548084-178548106 CCAGAGAAACAGAACCAATAGGG - Intronic
1003149206 6:3534564-3534586 CCAGAGAAACAGAACTAATAAGG - Intergenic
1003338095 6:5194041-5194063 CCAGAGAAACAGAACCAACAGGG + Intronic
1003711597 6:8598392-8598414 CTAAACAAAAAGAACAAACCTGG - Intergenic
1003732717 6:8843878-8843900 CTAGAGGGACAGAACTAATAAGG - Intergenic
1003757946 6:9143312-9143334 CCAGAGAAACAGGACCAACAGGG - Intergenic
1004192596 6:13477193-13477215 CCAGAGAAACAGAACCAATAGGG + Intronic
1004653793 6:17638382-17638404 CTGGAGAAACAGATCACAGATGG - Intronic
1004981340 6:21028065-21028087 CTAGAGAATCTGAAGAAACCTGG + Intronic
1005009400 6:21321736-21321758 ACAGAGAAACTGAACAAACAGGG + Intergenic
1005506216 6:26470964-26470986 CCAGAGAGACAGAACCAATAGGG - Intronic
1005512192 6:26521076-26521098 CTTGAGAAAAAGAACAACAAGGG + Intergenic
1005835715 6:29707428-29707450 ACAGAGAAACAGAACCAATAAGG - Intergenic
1006015600 6:31078391-31078413 CTGGAGAAACTGACCAGACAAGG + Intergenic
1006106170 6:31718322-31718344 TGAGAGAAACTGAAGAAACAGGG + Intergenic
1006701981 6:35982392-35982414 TTAGAGAACCAAAAGAAACAGGG - Intronic
1007501609 6:42302468-42302490 TTAAAAAAACAAAACAAACAAGG - Intronic
1007643130 6:43358929-43358951 CTAGAAAAGCAGAACCAGCAGGG + Intronic
1008179340 6:48308925-48308947 CCAGAGAAACAGAACCAATAGGG - Intergenic
1008186348 6:48395763-48395785 CTACACAAACAGAACAAAGCAGG - Intergenic
1008451288 6:51653668-51653690 ATAAAGACACAGAATAAACACGG + Intronic
1008681025 6:53872571-53872593 CTAAAGAAAAAGAACAAAGCTGG - Intronic
1008726709 6:54430369-54430391 CTAGAGGGACAGAACTAATAGGG + Intergenic
1008929471 6:56923520-56923542 CCAGAGAAACAAAACAGATAAGG + Intronic
1009003769 6:57754051-57754073 CTAGAGAAACAGAAAACTGATGG + Intergenic
1009449440 6:63784290-63784312 CCAGAGAAACAGAACCAATCAGG - Intronic
1009818428 6:68768240-68768262 CTAGACAAAAAGAACAAATCTGG + Intronic
1010268083 6:73890417-73890439 CTAGAGTAACTGAACGAGCATGG - Intergenic
1010360916 6:74992306-74992328 CCAGAGAAACAGAAGATACTTGG - Intergenic
1010406664 6:75513988-75514010 CTAGAGAAACAGAATCGATAAGG + Intergenic
1010582079 6:77612082-77612104 CCAGAGAAACAGACCCAATAGGG + Intergenic
1010844607 6:80689385-80689407 ATTGAGAAAAAGAAAAAACAAGG - Intergenic
1011197686 6:84799097-84799119 CTCGAGAAAGAGAACAACCTGGG - Intergenic
1011334106 6:86241324-86241346 CTAAACAAAAAGAACAAACCTGG + Intergenic
1011590175 6:88963886-88963908 CTAGAGAAACCCAAAAAAGAGGG + Intergenic
1011867042 6:91842228-91842250 CTTGAGAAAAAGAACAAAGCTGG - Intergenic
1012366243 6:98444107-98444129 CCAGAGAGACAGAAAAAACATGG + Intergenic
1012440519 6:99257915-99257937 CTAGAGACACAGGAGAACCAGGG + Intergenic
1012517171 6:100075795-100075817 CTAGAGAAAGAGAAGGAACTGGG + Intergenic
1013023287 6:106241946-106241968 CCAGAGAAACAGAACCATCATGG - Intronic
1013100087 6:106978882-106978904 CTAGAGGAACAGAAGACACAGGG + Intergenic
1013192188 6:107812918-107812940 CCAGAGAAACAGAACCAATAGGG - Intronic
1013259734 6:108429716-108429738 CTAGACAAAAAGAACAAATCTGG - Intronic
1014346958 6:120283151-120283173 CTAGAGGGACAGAACTAATAGGG + Intergenic
1015469769 6:133590747-133590769 CCAGGTAAACAGAACCAACAGGG - Intergenic
1015552748 6:134429199-134429221 CTATAGAAAAAGAAAAAAAATGG - Intergenic
1015565952 6:134571563-134571585 CTAAACAAAAAGAACAAATATGG + Intergenic
1016029475 6:139322767-139322789 CTACAGAAAAAGAAGGAACAAGG - Intergenic
1016308401 6:142707730-142707752 CCAGAGAAACACAACCAATAGGG - Intergenic
1017027534 6:150194392-150194414 CTCAAGAGACAAAACAAACAGGG - Intronic
1017596360 6:156032913-156032935 CGAGAGAAGAAAAACAAACAAGG + Intergenic
1017866296 6:158446393-158446415 AAAGAAAAACAGAACAAAAAGGG - Intronic
1018117911 6:160606029-160606051 CTTGAGAAACAGGGCTAACAGGG - Intronic
1018569547 6:165194758-165194780 CTAGAGGGACAGAACTAATAGGG - Intergenic
1018600239 6:165530308-165530330 CTAGAGGGACAGAACTAATAGGG - Intronic
1019029569 6:168998810-168998832 CTAGAGGGACAGAACTAATAGGG + Intergenic
1019133680 6:169895263-169895285 CCAGAAAAACAGAACCAACAGGG + Intergenic
1019830010 7:3318782-3318804 CTAGAAAAACTCAACAAAGAAGG + Intronic
1019873181 7:3786110-3786132 CAAAAGAAAGAGAACAAACAAGG - Intronic
1020659096 7:10961513-10961535 CTAAGCAAAAAGAACAAACATGG - Intergenic
1020822051 7:12982523-12982545 CTAGAGGAACAGAACTAACTAGG - Intergenic
1020988106 7:15161760-15161782 CCAGAGAAACAGAACCAATAGGG - Intergenic
1021212242 7:17868831-17868853 CTATAGAAACAGAAAAGAAAAGG + Intronic
1021351964 7:19604876-19604898 TTAGATAAACAGAAGCAACAGGG - Intergenic
1021468776 7:20977686-20977708 AAAGACAAACAGAACCAACATGG - Intergenic
1021662499 7:22934362-22934384 CTGGAGAAACAAAAAGAACAGGG - Intergenic
1021665236 7:22970496-22970518 CTATATCAAAAGAACAAACAAGG + Intronic
1021814708 7:24435884-24435906 CCAGAGAAACAAAACCAATATGG - Intergenic
1022160576 7:27706551-27706573 CCAGATAAATAGAACCAACAGGG - Intergenic
1022424402 7:30254418-30254440 CAAGACAAACAGAACAAGTAGGG - Intergenic
1022857128 7:34326067-34326089 CCAGAGAAATAGAACCAGCAGGG + Intergenic
1023505310 7:40893718-40893740 CTAGGCAAAAAGAACAAACCTGG + Intergenic
1023508341 7:40923339-40923361 TTTGAGAATCAGAAAAAACAAGG + Intergenic
1023626323 7:42118608-42118630 TTAGTGAAGCAGAACAATCAAGG - Intronic
1023634163 7:42193141-42193163 CTAGAGAAACAGCTCAAGGAAGG + Intronic
1023657266 7:42436618-42436640 CTAAACAAAAAGAACAAATATGG - Intergenic
1023935139 7:44734314-44734336 CTGTAAAAACAAAACAAACAAGG - Intergenic
1024104849 7:46072514-46072536 TTAAAGAAAAAGAACTAACATGG - Intergenic
1024259705 7:47564750-47564772 CCAGGGAAGCAGAACCAACAGGG - Intronic
1024263054 7:47586243-47586265 CCAGAGAAACAGATCCAATAGGG - Intergenic
1024438408 7:49386973-49386995 CTAGGGAAAAAGACCATACATGG - Intergenic
1024507187 7:50171812-50171834 CTAGAGAAGCAGAACCAGTAAGG - Intergenic
1024601099 7:50982444-50982466 CTATAAAAACAGGACAAAGAAGG - Intergenic
1026216455 7:68353689-68353711 GTAGAGTAAGATAACAAACATGG + Intergenic
1026704743 7:72680666-72680688 CTAGAGGGACAGAACTAATAGGG - Intronic
1028173161 7:87623656-87623678 CAAGAGAAGCAGAACACTCAGGG - Intronic
1028539292 7:91924712-91924734 TAAGAGAAACAGAAGAGACAAGG + Intergenic
1028628212 7:92901856-92901878 CCAGAGAAGCAGAACCAGCAGGG + Intergenic
1030192822 7:106826232-106826254 CCAGAGCAACAGAACCAATATGG - Intergenic
1030360165 7:108587335-108587357 CTAGAGCAACAGAACTAATAGGG + Intergenic
1030362965 7:108614657-108614679 CTAGAGAAATAGAATCAATAGGG + Intergenic
1030482751 7:110124809-110124831 CTAAACAAAAAGAACAAACCTGG + Intergenic
1030627369 7:111858860-111858882 CCAGAGAAACAGAACCAATAGGG - Intronic
1030829773 7:114206995-114207017 CTATAGAAACAGAAAGAATAAGG - Intronic
1030832827 7:114247863-114247885 CCAGAGAAACAGAACCAATAGGG + Intronic
1031232321 7:119123724-119123746 CCAGAGAAACAGATCACACATGG - Intergenic
1031466341 7:122116991-122117013 CAATAGAAAAAGAACCAACATGG + Intronic
1031588809 7:123565497-123565519 CCAGAGAAACAGAACAAATATGG - Intergenic
1031627897 7:124011410-124011432 GCATAGAAACAGATCAAACAGGG - Intergenic
1031834334 7:126664397-126664419 CTAAAGAAACAAAAACAACATGG + Intronic
1031871631 7:127094409-127094431 CCAAAGAACCAGAACAAATATGG + Intronic
1032326556 7:130934595-130934617 CCAGAGAAACAGAACCAAGAGGG + Intergenic
1032407161 7:131664991-131665013 CCAGAGAAACAGAAAAAAAGAGG + Intergenic
1032996208 7:137449187-137449209 CTAGAGCAAAAGAACAAAGCTGG + Intronic
1033073765 7:138229225-138229247 CAAGAGAAACAGAACTAATAAGG - Intergenic
1033390417 7:140922892-140922914 CAAGGGAAACAGAATAAACTAGG + Intronic
1033709465 7:143926236-143926258 ATACAGAAACAGAGCAAAAAAGG - Intergenic
1034046338 7:147932265-147932287 CTTGAGAAAAAGAACAAAGCTGG + Intronic
1034610136 7:152359660-152359682 CTAAAGAAAAAAAACAAAGAAGG + Intronic
1034743573 7:153501449-153501471 CTAAAGAAAAAGAACAAAGTTGG + Intergenic
1034889383 7:154826578-154826600 CTAGAGCTACAAATCAAACATGG + Intronic
1037055162 8:14431239-14431261 CTAAAGAAAAAGAACAAAGCTGG + Intronic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037708910 8:21339865-21339887 CCAGAGAAACTGAACCAATAGGG - Intergenic
1037894111 8:22640610-22640632 CTAGAGATCCAGAACACACAGGG + Intronic
1038093294 8:24278755-24278777 CCAGAGAAACAGAATTAACAGGG + Intergenic
1038180170 8:25220366-25220388 AGAGAGAAAGAGAACAAAAAAGG - Intronic
1038315220 8:26478825-26478847 CCAGAGAAACAGAACCAACTGGG - Intronic
1038335651 8:26643417-26643439 CCTGACAAACAGAACACACAAGG - Exonic
1038383721 8:27121074-27121096 CCAGAAAGACAGAACAAATAGGG + Intergenic
1038767752 8:30444701-30444723 CAAGAAAGACAGAACAAAGAAGG + Intronic
1039292677 8:36113399-36113421 GCAGAGAAACAGAACCAATAGGG + Intergenic
1039340974 8:36649543-36649565 CTAGAAAAACATAACATAAATGG + Intergenic
1039384120 8:37116760-37116782 CCAGAGAAACAGAACCAATAGGG - Intergenic
1040019570 8:42728653-42728675 TTATAGAAACAGAACAAATCAGG + Intronic
1040732637 8:50468658-50468680 ATAGAGAAACATTACAAACATGG - Intronic
1040823066 8:51586253-51586275 CTAGAGAAAGAGAAGCCACATGG + Intronic
1040916606 8:52571695-52571717 AGAGTGAAACAGAACAAACCAGG + Intergenic
1042107533 8:65344723-65344745 CCAGAAAAACAGAACCAATAGGG + Intergenic
1042160947 8:65894644-65894666 CTAGGCAAAAAGAACAAATATGG + Intergenic
1042388065 8:68201332-68201354 CTAGAGGGACAGAACTAATAGGG + Intronic
1042724197 8:71854686-71854708 CTAGAGAAACACAATGAATAAGG - Intronic
1042844531 8:73157081-73157103 CTAGAGAAACAGAACTAATAGGG + Intergenic
1043133906 8:76497309-76497331 CTAAACAAAAAGAACAAACCAGG + Intergenic
1043286239 8:78535356-78535378 GGAGAGAAACAGAAAAAAGAAGG - Intronic
1043566067 8:81549267-81549289 CCAGAGAAACAGAACCAACCAGG - Intergenic
1043569547 8:81587234-81587256 CTAAAGAAAAAGAACGAACCTGG - Intergenic
1044139556 8:88633666-88633688 CCAGAGAAAGAGAACATAGAGGG + Intergenic
1044359456 8:91264464-91264486 CTAGGGAAAAAGAATAAACCTGG + Intronic
1045247631 8:100457558-100457580 TTATAGAAACAGAACAAACATGG - Intergenic
1045349525 8:101325560-101325582 CTAAAAAAAAAGAAAAAACAAGG - Intergenic
1045815979 8:106276665-106276687 TTAAATAAACAGAAGAAACATGG - Intronic
1046235347 8:111417102-111417124 CCAGAGAAACACAACCAATAGGG + Intergenic
1046389026 8:113543376-113543398 CCAGAGAAACAGAAGCAATATGG + Intergenic
1046500790 8:115073537-115073559 CTAGAGGGACAGAACTAATAGGG - Intergenic
1046694474 8:117323597-117323619 CTAGAGAAACATAAAACATAAGG + Intergenic
1046797149 8:118385605-118385627 CCAGAGAAACAAAACCAAGAGGG - Intronic
1046923602 8:119762887-119762909 CCAGAGAAACAGAAAAGAGAAGG + Intronic
1047385761 8:124407693-124407715 CCAGGGAAACAGACCAAATAAGG - Intergenic
1047535742 8:125718160-125718182 CTAGAGAAACAGAACCATTAGGG + Intergenic
1048061217 8:130921019-130921041 CTGGAGAAACAGAACCAACAGGG - Intronic
1048091283 8:131243142-131243164 TTAGAGAAGGAGAACAAAAAGGG - Intergenic
1048447652 8:134503960-134503982 TTAGAGAAACAGAACTCATAGGG - Intronic
1048829333 8:138460719-138460741 CTATAAAAAAAGAACAGACAAGG + Intronic
1049089338 8:140502609-140502631 CCAGAGAGACAGAATCAACAGGG + Intergenic
1049310053 8:141929035-141929057 CTAGAAAAAAACAGCAAACACGG + Intergenic
1050614344 9:7386424-7386446 TTACAGAATCAGAACAAAGAGGG + Intergenic
1050847491 9:10240387-10240409 CTAGAGAAACAGAAGGTCCAGGG + Intronic
1051345049 9:16143882-16143904 CCAGAGAAACAGAAGCAATAGGG + Intergenic
1051476116 9:17510761-17510783 CTAGGAAAACAGAACCAACATGG - Intergenic
1051728166 9:20109809-20109831 CTAGAGGAACCCAACACACAAGG + Intergenic
1052029494 9:23611912-23611934 CCAGAGAAACAGAACCAATAGGG + Intergenic
1052032627 9:23645662-23645684 CCAGAGAAAGAGAACCAACTGGG + Intergenic
1052317844 9:27134896-27134918 CCAGAGAAGCAATACAAACATGG - Intronic
1052916942 9:33930585-33930607 CAAGAGAAAAAGAATAAAAAGGG + Intronic
1056698655 9:88882687-88882709 CTAAGCAAAAAGAACAAACATGG - Intergenic
1056740074 9:89246785-89246807 CCAGAGAAACAGATCCAATAGGG + Intergenic
1057331994 9:94123718-94123740 CTAGAGAAAAGAAACAAAAATGG - Intergenic
1057991607 9:99776389-99776411 CCAGACAGACAGGACAAACAAGG + Intergenic
1058020338 9:100079461-100079483 CTAGAAAAGCAGAACTAATAGGG - Intronic
1058608700 9:106751921-106751943 CTGGAGAAACAGAGCAGAGAGGG + Intergenic
1058652639 9:107190950-107190972 CCAGAGAAAGAGAAGAATCAAGG + Intergenic
1058878536 9:109266103-109266125 CAAGAGACACAGTATAAACATGG + Intronic
1059161063 9:112035450-112035472 CTACAGCAACAGAAGACACAGGG + Intergenic
1060933279 9:127502315-127502337 CCACAGAAACAGAACAGGCACGG - Intronic
1061599862 9:131661018-131661040 ATAGATAAAAAGAAAAAACAGGG + Intronic
1061661775 9:132135089-132135111 CCAGAGAGACAGAACCAATAGGG - Intergenic
1062125404 9:134858043-134858065 CTAGAGAAATAGTAAGAACATGG + Intergenic
1185521655 X:744707-744729 CCAGAGAAACAGATTCAACAGGG - Intergenic
1185522645 X:752997-753019 CCAGAGAAACAGATTCAACAGGG - Intergenic
1186283834 X:8023180-8023202 TTTGAGAAGCTGAACAAACATGG + Intergenic
1186306415 X:8264562-8264584 CCAGAGAAACAGAATGAACAGGG - Intergenic
1186372632 X:8962966-8962988 TTTGAGAACCAGAAAAAACAAGG + Intergenic
1186584089 X:10852785-10852807 TTAGAGAAAAAGAACACAAAGGG - Intergenic
1186589244 X:10912129-10912151 CAAGAGAAACACATAAAACAAGG - Intergenic
1187548550 X:20278242-20278264 CTAAGCAAAAAGAACAAACATGG + Intergenic
1188278257 X:28228789-28228811 CCAGAGAAACAGAACCAATAGGG - Intergenic
1188416193 X:29937847-29937869 CTAAAGAAACAGAATTTACAAGG - Intronic
1189600278 X:42616358-42616380 CTAGAGAAAAATGACATACAGGG - Intergenic
1189797058 X:44655170-44655192 CTAGATAGACTGAACAAAGAGGG + Intergenic
1189845863 X:45136383-45136405 AGAGAGAAAGAGAACAGACAAGG - Intergenic
1191041445 X:56085227-56085249 CCAGAGAAACAAAACCAAGAGGG + Intergenic
1192153139 X:68724282-68724304 CTAGGGAAGCAGAAGAAACCAGG - Intronic
1192397068 X:70793271-70793293 CTTGAGAACTGGAACAAACAAGG + Intronic
1192696869 X:73425966-73425988 CTAAGGAAACAGAACAAAGCTGG + Intergenic
1192701365 X:73477752-73477774 CTAAAGAAAAAGAACAAAGCTGG - Intergenic
1193160498 X:78223386-78223408 CTAGAGAAACTGAAACAACAAGG + Intergenic
1194044007 X:88979262-88979284 CCAGAGAAACAGAATAAATAGGG + Intergenic
1194452626 X:94063303-94063325 CTAGAACAAGAGAACAAACTTGG + Intergenic
1194943361 X:100039750-100039772 ATAGACAAACAGAACAAGTAAGG + Intergenic
1195097044 X:101512715-101512737 CTAGAGAAATAGAACCAATAGGG + Intronic
1195231558 X:102854800-102854822 CTAGGCAAAAAGAACAAATATGG - Intergenic
1195287788 X:103402174-103402196 CCAGAGAAACAGAACCAGTAGGG + Intergenic
1195919471 X:109968284-109968306 CTAAAGAAACAGAACCAGTAGGG - Intergenic
1196057234 X:111368862-111368884 CTAGAGAGACAGAACTAATACGG + Intronic
1196282306 X:113836235-113836257 CCAGAGAAACAGAACCAATAGGG + Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1196309857 X:114151119-114151141 ATAAAGAAACAGGAAAAACAAGG + Intergenic
1196460981 X:115930468-115930490 CTAGGCAAAAAGAACAAACCTGG - Intergenic
1196600300 X:117594047-117594069 CTAGAGAAAAAGAACAAAGAGGG + Intergenic
1196714922 X:118801454-118801476 CTAGAGATAAAGAAAACACAAGG - Intergenic
1197319696 X:125012153-125012175 CTAGAGGAACAGCACACACCAGG + Intergenic
1197552265 X:127906011-127906033 TTAGAGGGACAGAACAAATAGGG - Intergenic
1197964257 X:132040560-132040582 CTAGAGAAAGAAAATAAAAATGG + Intergenic
1198012398 X:132571588-132571610 CTAGAGGGACAGAACTAATAGGG + Intergenic
1198447213 X:136729077-136729099 CCAGAGAAACAGAACCAATGTGG - Intronic
1198868731 X:141153713-141153735 CTGGAGAAACAGAGCAAATAGGG + Intergenic
1201442290 Y:14021305-14021327 TTTGAGAAGCAGAACAAACATGG - Intergenic
1201621471 Y:15963612-15963634 CCAGAGAAACAGAGCAAATAAGG + Intergenic
1201712410 Y:17007277-17007299 GTAGAGAAACAAAAGAAATAGGG - Intergenic
1201741781 Y:17331982-17332004 CTAGGGGAACTGAACAAAAAGGG - Intergenic
1201890519 Y:18938826-18938848 CCAGAGAAACAGAACCAGTAGGG + Intergenic
1201945982 Y:19510491-19510513 CTGAACAAACAGAACAAAAAAGG + Intergenic
1202028462 Y:20549451-20549473 CTAGAGACTAAGAAGAAACAAGG - Intergenic