ID: 1165565622

View in Genome Browser
Species Human (GRCh38)
Location 19:36724879-36724901
Sequence AAGTGATGGAAAGAATATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 0, 2: 6, 3: 57, 4: 505}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165565622_1165565626 20 Left 1165565622 19:36724879-36724901 CCTCCATATTCTTTCCATCACTT 0: 1
1: 0
2: 6
3: 57
4: 505
Right 1165565626 19:36724922-36724944 TTGAATTAAAACCTTTTTTGTGG 0: 1
1: 0
2: 3
3: 35
4: 552
1165565622_1165565627 21 Left 1165565622 19:36724879-36724901 CCTCCATATTCTTTCCATCACTT 0: 1
1: 0
2: 6
3: 57
4: 505
Right 1165565627 19:36724923-36724945 TGAATTAAAACCTTTTTTGTGGG 0: 1
1: 0
2: 3
3: 55
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165565622 Original CRISPR AAGTGATGGAAAGAATATGG AGG (reversed) Intronic
903638678 1:24839930-24839952 AATTGATGAAAATAGTATGGAGG + Exonic
904366472 1:30014022-30014044 AAGTGTTGTTAAGAACATGGTGG - Intergenic
905002944 1:34687690-34687712 AAGTGTTGGCAAGAATGTGGAGG - Intergenic
905082944 1:35340968-35340990 CAGTGATAAAAAGATTATGGTGG - Intronic
905358283 1:37400332-37400354 AAATGATGGTAAGATCATGGAGG + Intergenic
906044734 1:42819418-42819440 AACTCATGGAAAGAATAGAGAGG - Intronic
906606477 1:47175949-47175971 ATGTGTTGGAAAGAACCTGGAGG + Intergenic
907829079 1:58047034-58047056 ATGTCATGGTAAGAATTTGGAGG - Intronic
908675159 1:66595319-66595341 CAGTGATGAGAAGAATTTGGAGG - Intronic
908980019 1:69944647-69944669 AAGTGTTGGCAAGGATGTGGGGG - Intronic
908983403 1:69986106-69986128 AAGTGTTGGCAAGAATGTGGAGG - Intronic
909241777 1:73222518-73222540 AAGAGATTGAAAGAGTCTGGAGG - Intergenic
910503553 1:87923433-87923455 AGGTGATGGAACTAATGTGGAGG - Intergenic
910736451 1:90463316-90463338 GAATGATGGAAAAAGTATGGTGG - Intergenic
911307818 1:96252574-96252596 AAGTGTTGGAAAGAATAAATTGG + Intergenic
912637959 1:111316355-111316377 AAGTCATGGATAGAATTAGGAGG + Intronic
913428541 1:118762360-118762382 AAGTGTTGGTGAGAATAAGGAGG + Intergenic
913657912 1:120979020-120979042 AAGAGAAAGAAAGAAAATGGTGG + Intergenic
915523193 1:156460358-156460380 AAGGTATGGAGAGACTATGGTGG - Intergenic
916158316 1:161880886-161880908 AAGTGTTGCCAAGGATATGGAGG - Intronic
916789194 1:168110201-168110223 AATTAATAGAAAAAATATGGTGG + Intronic
916999621 1:170342293-170342315 CAGTGATGGAAGGAACATCGAGG + Intergenic
917496248 1:175542820-175542842 AAGCGTTGGAAAGAATTTAGTGG - Intronic
918161713 1:181907278-181907300 AAGTGTTGGCAAAAATATGAAGG - Intergenic
918349379 1:183637295-183637317 AAGAGATGGAAAGATTCTGAAGG + Intronic
918627266 1:186670501-186670523 AAGTGAAGGAAAGAGTATGGTGG + Intergenic
918922990 1:190739292-190739314 ATGTGTTGGTAAGAATATGGAGG + Intergenic
919069570 1:192736678-192736700 AAGTGATGGAGAGAGGATGATGG - Intergenic
919074734 1:192799201-192799223 AAGTGGGGAAAAGATTATGGAGG - Intergenic
919462394 1:197893376-197893398 AAGTGTTGGCAAGGATATGGAGG - Intergenic
919563275 1:199151315-199151337 AAATGATGTAAAGAAAATAGGGG + Intergenic
919739338 1:200972791-200972813 AGCTGAGGGAAAGAATATAGGGG + Intronic
920731189 1:208487551-208487573 AAGTGATGACAAGAAAATGAAGG - Intergenic
921728072 1:218546161-218546183 AAGAGAAGGAAAGAATATTTGGG + Intergenic
922296431 1:224253834-224253856 AAATGTTGGCAAGGATATGGAGG - Intronic
922332334 1:224588118-224588140 AAGGGAGGGAACGAACATGGGGG - Intronic
922547634 1:226470532-226470554 AAGTGTTGGTGAGAATGTGGAGG - Intergenic
923265725 1:232312298-232312320 TAGTGATGGGTTGAATATGGGGG + Intergenic
923326252 1:232882827-232882849 AAGTCCTGGTAAGAATTTGGAGG - Intergenic
923383859 1:233447409-233447431 AAGTGATGGATAGAGAAAGGTGG - Intergenic
923664549 1:235988380-235988402 AAGTTTTGGTAAGGATATGGAGG + Intronic
923960140 1:239071946-239071968 AAGTGGAGGAAAGAGTATGAAGG + Intergenic
1063040589 10:2333402-2333424 AAGTCAAGGAACAAATATGGAGG + Intergenic
1063946744 10:11183582-11183604 AAGTGTTGGAGGGAATGTGGAGG - Intronic
1064534750 10:16347182-16347204 AAGTGTTGGCAAGGGTATGGAGG + Intergenic
1065674750 10:28162839-28162861 GAGTGAGAGAAAGAATATGGAGG - Intronic
1065798162 10:29326270-29326292 ACATGTTGGAAAGAATATGGAGG + Intergenic
1066229683 10:33420247-33420269 AAGCGCTGCAAAGAAAATGGAGG + Intergenic
1066301492 10:34101383-34101405 CAGTGAGGGCAAGAATAGGGTGG - Intergenic
1067851504 10:49757832-49757854 AAGTCTTGGAAAGGATATAGAGG + Intronic
1068544327 10:58328883-58328905 AAGTGTTGGAAAGGATGTGGAGG - Intergenic
1068608729 10:59034983-59035005 TAGTGCTGGAAAGAATTTTGGGG - Intergenic
1069000869 10:63262839-63262861 CAATGATTGAAAGAATATGCTGG - Intronic
1069594043 10:69659105-69659127 AAGTGATGGGGAGATTGTGGTGG + Intergenic
1070161384 10:73868689-73868711 AAGTGAGGGAAAGAGAAGGGAGG - Intronic
1070437937 10:76411888-76411910 CAGTGATGGAAAACAGATGGAGG + Intronic
1071582231 10:86782471-86782493 AAGTGTTGGCAAGGATGTGGAGG - Intronic
1071941852 10:90599376-90599398 AAATGATAGAAAATATATGGAGG - Intergenic
1072334203 10:94383173-94383195 AAGAGAAAGAAAGAATAGGGAGG - Intergenic
1072365172 10:94702159-94702181 AAATGACGGAAAAAATATTGAGG - Intronic
1072941095 10:99764674-99764696 AAGTGTTGGATAGAATGTGAAGG + Intergenic
1073707162 10:105998146-105998168 AAGTGTTGGCAAGAATGTAGAGG - Intergenic
1073820392 10:107255993-107256015 AAATGATGGAAAGAATCTTAAGG + Intergenic
1075572244 10:123554679-123554701 AAGTGAGAGAAAGAAAATTGAGG - Intergenic
1076073007 10:127507519-127507541 AAGTGATGGAACAAACATGCAGG + Intergenic
1077698885 11:4421135-4421157 AAGAGCTGGAAGGGATATGGGGG + Intergenic
1078162192 11:8850546-8850568 AAGTGTTGGAGAGGATGTGGAGG + Intronic
1079576632 11:22011585-22011607 GAAGGATGGAAAGAATATTGGGG + Intergenic
1080055892 11:27906000-27906022 AAGTGAAGGAAAGAGGAGGGTGG - Intergenic
1080705304 11:34686497-34686519 AAGTGTTGGTAAGGATATGCTGG - Intergenic
1081327847 11:41768122-41768144 AAGTGTTGGAGAGGATGTGGAGG + Intergenic
1081532837 11:43975176-43975198 CAGTGAGGGAAAAAAAATGGAGG + Intergenic
1081721846 11:45295095-45295117 CTGTGATGGAAAGAAGGTGGGGG + Intergenic
1083495483 11:63048387-63048409 AAGGGATGGAAAGAATAAAGGGG - Intergenic
1083502065 11:63118590-63118612 ATGTGATGGAGATAATTTGGGGG - Intronic
1083699291 11:64464491-64464513 AAGTGGGGGAAAGAATACTGTGG - Intergenic
1084303200 11:68264658-68264680 AACAGATGGATAGGATATGGTGG - Intronic
1085113336 11:73908020-73908042 GAATGATGGAAAGAAGGTGGTGG - Intronic
1085776781 11:79373595-79373617 CAGTGAAGGAAAGAAGAAGGAGG + Intronic
1085960611 11:81457286-81457308 AAGTGACAGATAAAATATGGTGG - Intergenic
1085963280 11:81489188-81489210 CAGTGATGGAAAGACCATAGAGG + Intergenic
1086020956 11:82228769-82228791 AGATGATGGAAAGAATAGCGGGG - Intergenic
1087078094 11:94144228-94144250 GAATGATGGAAAAAAAATGGGGG - Intronic
1087143576 11:94790180-94790202 GACTGATGGCAAGAACATGGCGG - Intronic
1087380679 11:97400765-97400787 AAGAGAAGGAAGGAAAATGGAGG + Intergenic
1087967264 11:104432407-104432429 AAGTCATTGAAAGGATAAGGAGG + Intergenic
1087989333 11:104729062-104729084 ATGTCATGGGAAGAATGTGGTGG + Intergenic
1088135189 11:106548302-106548324 AAGTGTTGACAAGAATATGGAGG + Intergenic
1088696523 11:112370803-112370825 AGGAGATGGAAAGAATAGGAAGG + Intergenic
1089329351 11:117678996-117679018 AAGTGATGGCACACATATGGGGG + Intronic
1090153767 11:124414275-124414297 AGTTGATGGAAAGAATATTGGGG - Intergenic
1090737370 11:129621818-129621840 AGATGATGTAAAGTATATGGAGG - Intergenic
1091149397 11:133313496-133313518 TTGTGATGGAAAGATTATGCTGG + Intronic
1093601636 12:21032971-21032993 AACTGAAGGAAAAAATATAGAGG - Intronic
1093901584 12:24641072-24641094 AAGTATTGGAGAGGATATGGAGG + Intergenic
1094450563 12:30579109-30579131 AAATGATGGCAAGAATATGGAGG + Intergenic
1094528852 12:31252929-31252951 AAGTGAGGGAAAGTATCTGCAGG + Intergenic
1094781894 12:33801280-33801302 AAATGATGGAAAAAATATCAAGG - Intergenic
1095311498 12:40702816-40702838 AAGTGCTGAAAAGAATGTGTTGG - Intronic
1095487246 12:42698087-42698109 AAGGTATGGTAAAAATATGGTGG + Intergenic
1096391520 12:51232991-51233013 AAGTGTTGGAGAGGATGTGGAGG - Intergenic
1096635885 12:52959048-52959070 GACTGATTGAAAGAATATGGTGG - Intergenic
1097908041 12:64940586-64940608 AAGTGTTGGCAAGAATTTAGGGG + Intergenic
1098047677 12:66418795-66418817 AAATGCTGGAGAGAATGTGGAGG + Intronic
1098328383 12:69326358-69326380 ATGTGTTGGCAAGGATATGGTGG + Intergenic
1100098469 12:91073403-91073425 AAGTTATAGAAGGAAAATGGAGG + Intergenic
1100859833 12:98793034-98793056 CAATGATGGAAACAGTATGGCGG - Intronic
1101137781 12:101763240-101763262 AAGGAAAGGAAAGAAAATGGGGG + Intronic
1101373314 12:104150019-104150041 AAGTGGAGGAGAGAAAATGGGGG + Intergenic
1102775966 12:115519359-115519381 AAGTGATGGAAATCTGATGGAGG + Intergenic
1103139137 12:118533622-118533644 AGGTCATGGGAAGAACATGGGGG + Intergenic
1103200724 12:119085848-119085870 AAGTGAGAGAAAGAGGATGGAGG + Intronic
1104168063 12:126253085-126253107 AAGTCATGAAAAGAACATGGAGG + Intergenic
1104475570 12:129067998-129068020 AAGTGATTGAAAAAATAAAGTGG - Intergenic
1104515537 12:129421970-129421992 AGGAGAAGGAAAGAATCTGGGGG - Intronic
1104683237 12:130766935-130766957 AAGGGAGTGAAAGAATAGGGGGG + Intergenic
1105052972 12:133071287-133071309 AAGTGCTGGCAATAATGTGGAGG + Intergenic
1105842153 13:24263567-24263589 AGGTGATTTAAAGTATATGGAGG - Intronic
1106113051 13:26793707-26793729 AGCTGATTGAAAGTATATGGAGG - Intergenic
1107217995 13:37944927-37944949 AATTCAGGGAAAGAATTTGGAGG + Intergenic
1107593433 13:41934319-41934341 AAGAGCTGGCAAGAATATGGAGG + Intronic
1107649100 13:42526356-42526378 AAATGATGGGAAGAATCGGGGGG - Intergenic
1108088429 13:46819605-46819627 GAGTGAAGGAAGGAGTATGGAGG + Intergenic
1108472188 13:50778447-50778469 ATGGGATGGAAAGAAGAAGGAGG - Intronic
1109225181 13:59685111-59685133 AATTTATGGAAAGATTATTGGGG + Intronic
1109436266 13:62307584-62307606 AAGTGATGGAAAGAAGGTCCAGG - Intergenic
1112365800 13:98754326-98754348 AAATGCTGGAGAGGATATGGAGG + Intergenic
1112659072 13:101486494-101486516 ATCAGAGGGAAAGAATATGGGGG + Intronic
1112702299 13:102024264-102024286 AAGTGTTGGCAAGAATGTGGAGG - Intronic
1113015167 13:105820999-105821021 AAATGATGGAAATAAACTGGGGG + Intergenic
1113801265 13:113087603-113087625 AAATGATGGAAATACTTTGGGGG - Intronic
1114206635 14:20578338-20578360 AAGTAATGGTAAGAATGTTGAGG + Intergenic
1114947974 14:27711053-27711075 TAGAGATGGAAAGAAGAGGGTGG - Intergenic
1115606930 14:35012352-35012374 GTGTGATGGAAACAATTTGGGGG + Intronic
1115691777 14:35851653-35851675 AAGTGTTGGAAAGGATGTGGAGG + Intronic
1116038065 14:39652930-39652952 AAGTGTTGGAGAGAATGTGGAGG + Intergenic
1116297058 14:43125429-43125451 AACTGAGGCAAAGAAGATGGGGG + Intergenic
1116370370 14:44122427-44122449 AAGTCATGGGAAGAAGCTGGGGG - Intergenic
1116705523 14:48293575-48293597 AAGTGCTGGCAAAGATATGGAGG - Intergenic
1117695579 14:58358996-58359018 TAGTGTTGGCAAGAATATGAAGG - Intronic
1117825445 14:59697358-59697380 CAGTGATGAACAGGATATGGTGG - Intronic
1118901399 14:69989176-69989198 AAGTGTTGGTAAGGATGTGGAGG - Intronic
1119168902 14:72517789-72517811 AAGTGATGGCATCAAAATGGAGG - Intronic
1120773120 14:88403171-88403193 AAGTGTTGGCAAGGATGTGGAGG + Intronic
1120807896 14:88772992-88773014 GAGTAATGGACAGAATATGTTGG - Intronic
1121066058 14:90966093-90966115 AAGTGATGGGAGGAAACTGGAGG + Intronic
1121368907 14:93339062-93339084 AAGTGATGTACAGAAAATGGAGG + Intronic
1121947511 14:98137200-98137222 AGCTCATGGAAAGAAAATGGTGG + Intergenic
1123172534 14:106388107-106388129 AAATGTTGGCAAGAATGTGGGGG + Intergenic
1123218324 14:106832391-106832413 GAGTGATGGAAAGATTAAGCCGG - Intergenic
1125327168 15:38547777-38547799 AAGCGGTGAAAAGATTATGGAGG - Intronic
1125828541 15:42695105-42695127 ACGGGGTGGAAAGAACATGGTGG - Intronic
1125999684 15:44196792-44196814 AGGTGATAGAAAGAAAAAGGGGG - Intergenic
1127650823 15:61005103-61005125 AATTGATGGAAACAATCTGAGGG + Intronic
1129510076 15:76115291-76115313 AAGTGAAGGAAACAATACGTTGG - Intronic
1130552743 15:84901715-84901737 AAGTGTTGGCAAGGATATAGAGG + Intronic
1130863671 15:87913526-87913548 GAGTGATGAGAAGAATTTGGTGG - Intronic
1131661028 15:94516571-94516593 AAGTGATGTCAAAAAGATGGTGG + Intergenic
1132421387 15:101672889-101672911 AAGTGATGGAAAGAATTCTGGGG + Intronic
1133778062 16:8913403-8913425 AAGCGAAGCGAAGAATATGGGGG + Intronic
1134437627 16:14276120-14276142 AAGTGTTGGCGAGGATATGGGGG + Intergenic
1135642357 16:24131976-24131998 ATTTGAAGGAAAGGATATGGAGG - Intronic
1137043277 16:35633680-35633702 AAATGTTGGCAAGAGTATGGAGG - Intergenic
1138485086 16:57335937-57335959 AAGTGATGGCAAGGATGTGGAGG - Intergenic
1138767441 16:59621442-59621464 AACTGATAGAATAAATATGGAGG + Intergenic
1138854093 16:60667251-60667273 ATGTGATGGTAAGAATAGGCTGG + Intergenic
1139033483 16:62914280-62914302 AATTGATTGTAAGAATATGGGGG - Intergenic
1139109821 16:63876159-63876181 CTGTGAAGGCAAGAATATGGAGG + Intergenic
1139680608 16:68559000-68559022 ATGAGATGGAAGGAAGATGGTGG - Intronic
1140632482 16:76870730-76870752 AAGAGATAGACAGTATATGGTGG - Intergenic
1140786480 16:78347207-78347229 AAAGGATGGAAAGAGAATGGAGG - Intronic
1141071613 16:80961390-80961412 AAGTGTTGGTGAGAATGTGGAGG + Intergenic
1141381510 16:83581467-83581489 AAGTCATGAAAGGAATAAGGAGG - Intronic
1142341756 16:89528025-89528047 CAGTGATGTACAGAAGATGGAGG + Intronic
1142357989 16:89612940-89612962 AACAGATGGTGAGAATATGGAGG + Intergenic
1143429256 17:6867693-6867715 AAGTGATGGAAAGATTTTAAGGG + Intergenic
1143452269 17:7043113-7043135 AAGTGTTGGAGAGAGTTTGGGGG - Intronic
1144392685 17:14810597-14810619 AAGTGACTGAAGGAATATAGGGG - Intergenic
1145824470 17:27866541-27866563 AAGAGAAGGAAAGAAAAGGGAGG - Intronic
1147253255 17:39165985-39166007 AAGAGGTGCAAGGAATATGGGGG + Intronic
1148833684 17:50453562-50453584 GAGTGACTGAAAGAAGATGGGGG + Intronic
1149168488 17:53781704-53781726 AAATGAAGGAAAGAATATTAAGG + Intergenic
1149722334 17:58858774-58858796 TAGTGCTGGAATGAACATGGGGG + Intronic
1150029434 17:61716774-61716796 CAGTAGTGGAAATAATATGGGGG - Intronic
1150185425 17:63176052-63176074 AAGTGTTGGCGAGAATATGGAGG + Intronic
1150645711 17:66976386-66976408 GAGGGATGGAAAGAAGTTGGAGG - Intronic
1151030543 17:70732949-70732971 AAGTGATGTACAGAACTTGGAGG + Intergenic
1151256529 17:72881011-72881033 AAGTGTTGGTGAGGATATGGAGG + Intronic
1151829608 17:76541817-76541839 TACTAATGGAAAGACTATGGGGG + Intronic
1153585885 18:6619773-6619795 AAATGTTGGAGAGAATGTGGAGG + Intergenic
1153754801 18:8270413-8270435 AAGTGTTGGCAAGGATGTGGAGG + Intronic
1153872252 18:9332262-9332284 AAGTGCTGGAAAGATAATGATGG - Intergenic
1154051043 18:10958014-10958036 AAATGTTGGAAAGAATGTGGAGG + Intronic
1156619392 18:38831284-38831306 ATTTGATGGGAAGAAAATGGTGG + Intergenic
1157040401 18:44032371-44032393 AAGAGATGGAATAAATATCGGGG + Intergenic
1157773690 18:50373838-50373860 AAGGGATGGACAGAACCTGGCGG + Intergenic
1157913966 18:51646233-51646255 GAGGAATGGAAAGAATATTGGGG + Intergenic
1158686068 18:59615840-59615862 AAGAGAAGGAAAGAATAAGAAGG + Intronic
1159068471 18:63595198-63595220 AAATGAAAGAAAGAATAAGGAGG - Intronic
1159102074 18:63968843-63968865 AAGTCATGGAGAAAAGATGGGGG + Intronic
1159832677 18:73296604-73296626 AAGTGAAGAAGAAAATATGGAGG - Intergenic
1162088698 19:8263522-8263544 AAGTATTGGAGAGAATGTGGGGG + Intronic
1164010487 19:21199241-21199263 ATGTGGAGGAAATAATATGGGGG - Intergenic
1164540598 19:29118980-29119002 AAGTGATGGAGAGAGTATCTGGG + Intergenic
1165565622 19:36724879-36724901 AAGTGATGGAAAGAATATGGAGG - Intronic
1166070855 19:40386819-40386841 AAGAGATGGAAAGAGAATGAAGG - Intronic
1166440682 19:42812109-42812131 AAGTTATGGAAAGAATTCTGTGG - Intronic
1166450183 19:42892090-42892112 AAGTGTTGGCAAGGATGTGGAGG + Intronic
1166460186 19:42980985-42981007 AAGTTATGGAAAGAATTCTGTGG - Intronic
1166477460 19:43140695-43140717 AAGTTATGGAAAGAATTCTGTGG - Intronic
1166479346 19:43156351-43156373 AAGTGTTGGCAAGGATGTGGAGG + Intronic
1166488888 19:43240177-43240199 AAGTTATGGAAAGAATTCTGTGG - Intronic
1166501866 19:43347512-43347534 AAGTGTTGGCAAGGATGTGGAGG + Intergenic
1166508253 19:43385943-43385965 AAGTGTTGGCAAGGATGTGGAGG - Intergenic
1166691296 19:44822560-44822582 AAGGGATGGAAAGATTTAGGGGG + Intergenic
1167100111 19:47399393-47399415 AGGTGGGGGAAGGAATATGGGGG - Intergenic
1167173338 19:47848515-47848537 AAATGAAGGACAGAAAATGGAGG - Intergenic
1167849742 19:52192238-52192260 AAGAGATTGAAAGAAGGTGGGGG + Intronic
1168364661 19:55775743-55775765 AATTGATGGAAGGAAAAGGGAGG + Intergenic
924997571 2:377017-377039 AAGTGATGTTAGCAATATGGTGG + Intergenic
925484325 2:4311791-4311813 AAGTGATGGAAAAAATGTTAAGG - Intergenic
926255123 2:11187178-11187200 AAGTGAAGACAAGGATATGGGGG - Intronic
926502605 2:13674369-13674391 CTGTGATGGAAAGAACCTGGTGG - Intergenic
927014073 2:18938143-18938165 AGGTGTTGAAAAGTATATGGAGG - Intergenic
928495776 2:31830093-31830115 AAGTGTTGGTGAGAATGTGGAGG - Intergenic
928811276 2:35230041-35230063 CAGGGATGGAATGAATTTGGGGG - Intergenic
928915033 2:36461358-36461380 AAGGGAGGGAAAGATTAGGGAGG + Intronic
929001384 2:37350328-37350350 AAGGGATAAGAAGAATATGGAGG - Intronic
929062730 2:37940307-37940329 AAGTGAAGGAAAAAATATTAAGG - Intronic
929761899 2:44814053-44814075 GAGTGGTGGAAAGAAGGTGGCGG + Intergenic
931111394 2:59115162-59115184 AAATGATGGACAGAATATGGAGG - Intergenic
931447228 2:62336731-62336753 AAGTGAGGGAAGGAACATTGTGG - Intergenic
932907564 2:75770023-75770045 AAGTGGTGGAAATAATAAAGTGG - Intergenic
933520984 2:83373187-83373209 AAGTGTTGGCAAGGATGTGGAGG + Intergenic
934575826 2:95400812-95400834 AAGTACTGGCAAGAATGTGGAGG - Intergenic
934795651 2:97096729-97096751 AAGTATTCGAAAGAATGTGGAGG + Intergenic
935504904 2:103888752-103888774 CAGTGGTGGGAAGAAGATGGTGG - Intergenic
935510344 2:103964082-103964104 AAGTGATTGAAAGAGTCTGCAGG + Intergenic
935917930 2:107977907-107977929 AAGTGGTGAGAAGAATATGTTGG + Intergenic
936224810 2:110639087-110639109 AAGTGATATAATGAATATGCAGG + Intronic
936760729 2:115778045-115778067 AGGTGAAGAAAAGAATAAGGAGG - Intronic
936763958 2:115821442-115821464 AAGTGCTGAAAATAATAAGGTGG - Intronic
936860343 2:117009739-117009761 AAATGTTGGCAAAAATATGGAGG - Intergenic
937067763 2:119031008-119031030 AAGTGAAGGAAAGAAAAATGTGG + Intergenic
937620814 2:123983247-123983269 AAATGATAGCAAGAATATTGGGG + Intergenic
937629100 2:124079294-124079316 GTGTGATGGGAAGAACATGGGGG - Intronic
937752716 2:125497133-125497155 AAGTGTTGGAAAGTCTGTGGAGG - Intergenic
938619044 2:133030487-133030509 AAATGGTGGAAAGGATCTGGGGG + Intronic
939912415 2:147999503-147999525 AACTGATGCATAGAATCTGGGGG - Intronic
939947098 2:148423147-148423169 AAATGATGGAAAAAATATTAAGG + Intronic
941010531 2:160294446-160294468 CGGGTATGGAAAGAATATGGTGG + Intronic
941839393 2:170063992-170064014 AACTGCTGGCAAGTATATGGGGG - Intronic
941961875 2:171261863-171261885 AGGTGATGGAAAGGAGGTGGGGG + Intergenic
941984237 2:171493936-171493958 AAGTGTTGGCAAGGATTTGGAGG - Intergenic
942262031 2:174175571-174175593 AAGTGCTAGAAAGGATGTGGAGG + Intronic
942952193 2:181733379-181733401 AAGTGAAGGAAAAAATATTAAGG + Intergenic
943097304 2:183445548-183445570 AAGTGTTGACAAGAATGTGGAGG - Intergenic
943105442 2:183541329-183541351 AATTGAGGAAAAGAATATAGAGG - Intergenic
943752875 2:191527987-191528009 AAGTAATGAAGAGTATATGGTGG - Intergenic
943804386 2:192104299-192104321 GAGAAAGGGAAAGAATATGGTGG + Intronic
944653008 2:201850777-201850799 AGGTGTTGGCAAGAATGTGGAGG - Intronic
945320860 2:208421979-208422001 AAGTGATTTACACAATATGGAGG + Intronic
945341708 2:208663967-208663989 AAGTGATGGAAAGAATAAAAGGG + Intronic
946848346 2:223881062-223881084 AAGGGAAGGAAAGAAAATAGTGG + Intronic
947371395 2:229450266-229450288 ACTTGATGGAAAGAATATCTAGG + Intronic
948091033 2:235295875-235295897 AGGTGGTGGAATGAAGATGGCGG + Intergenic
949075732 2:242056448-242056470 AAGAGATGGAAAGAAAAGAGGGG - Intergenic
1169660997 20:7978236-7978258 AAGTGAGAGAAAGAAGAGGGAGG - Exonic
1169779853 20:9297328-9297350 AAGGGATAGGAATAATATGGTGG + Intronic
1169823266 20:9737832-9737854 AAGTGTTAGTAAGAATGTGGAGG + Intronic
1170326109 20:15156164-15156186 AAGTGATGGCAAGGATGTGAAGG + Intronic
1172308080 20:33895940-33895962 GAGGGATGGCAAGGATATGGGGG + Intergenic
1172699415 20:36843728-36843750 TGGTGATGGAAAGAATAGGAGGG + Intronic
1172805287 20:37607501-37607523 AAGTGATAAAAAGACCATGGGGG + Intergenic
1173761163 20:45561914-45561936 AAGTTAGGGAAATAATTTGGGGG + Intronic
1174181661 20:48678950-48678972 AAGTGAGGGAACGAATATGAAGG + Intronic
1174483577 20:50847645-50847667 ATGTGATGGAAAGAAGAACGTGG - Intronic
1175695050 20:61096651-61096673 AAGTGATGGCAAAGATGTGGGGG - Intergenic
1177127023 21:17206961-17206983 AAGTGTTGGAAAGGATGTGAAGG + Intergenic
1178215033 21:30586373-30586395 AAGTGATGGTGAGAATGTGGAGG + Intergenic
1178388694 21:32180706-32180728 ATGTGTTGGCAAGGATATGGAGG - Intergenic
1179118015 21:38512314-38512336 AAGTATTGGCAAGAATGTGGAGG + Intronic
1179352001 21:40620623-40620645 AAATGATGGTGAGAATATGATGG + Intronic
1179518684 21:41927814-41927836 AAGGGTTGGAAACAAGATGGTGG + Intronic
1184862428 22:47180840-47180862 GAGGGATGGAAAAAATATGGGGG + Intergenic
951031282 3:17884851-17884873 AAGAAATGGTAAGAATATGGGGG - Intronic
951042807 3:18006297-18006319 AAGTCCTAGAAAAAATATGGGGG + Intronic
951755376 3:26085605-26085627 ATGTGATGGTAATAAAATGGGGG - Intergenic
951905290 3:27700382-27700404 AAGTGTTAGCAAGGATATGGAGG - Intergenic
952535722 3:34306923-34306945 TACTGATGGAATGAATATGTGGG + Intergenic
952838312 3:37623512-37623534 AAGAGAAGGAAAGAATGTGGAGG - Intronic
953813806 3:46136613-46136635 AAGTGTTGAAAAGGATGTGGAGG - Intergenic
954932071 3:54292677-54292699 AAGTGTTGGCAAGGATGTGGAGG + Intronic
956399714 3:68864448-68864470 TAGTGCTGGCAAGAATATGAAGG + Intronic
957446770 3:80322818-80322840 AAGTGTTGGAAAGCATATATTGG + Intergenic
957648340 3:82964929-82964951 AAGTTATGGCAAGGATATAGTGG - Intergenic
957687265 3:83517251-83517273 ATGTGATGGAAGGAATGAGGGGG - Intergenic
957987746 3:87593250-87593272 AAGTGGTGAAAAAAATCTGGAGG + Intergenic
959105203 3:102057640-102057662 AAGTGTTGGAAAGGATGTAGAGG - Intergenic
959574366 3:107918492-107918514 AAGTGTTGGCAAGGATGTGGAGG + Intergenic
959789392 3:110339476-110339498 AAGTTTTGGAAAGGATGTGGAGG - Intergenic
960371611 3:116847531-116847553 AAGAGATGGAAAGATTATCCTGG - Intronic
961946837 3:130700045-130700067 AACTTATGAAAAGAATATGTAGG - Intronic
962189684 3:133297432-133297454 AAGTGATTGAAAGAAGAAAGAGG + Intronic
962346390 3:134622064-134622086 ATGTGTTGGCAAGAATATGGAGG + Intronic
962736319 3:138328660-138328682 AAGTGATGGTAAAAACATGCAGG - Intronic
962826496 3:139104557-139104579 AAGGTATGCAAAGGATATGGGGG - Intronic
963142321 3:141957018-141957040 AAGTGTAGAAAAGGATATGGAGG + Intronic
963318228 3:143784102-143784124 TAGTGATGCAGAGAATGTGGAGG - Intronic
963656980 3:148065588-148065610 AAGTGATGATTAGAATTTGGTGG - Intergenic
963667601 3:148208510-148208532 AGTTGATGGAGAGAGTATGGGGG + Intergenic
964424515 3:156537005-156537027 ATGCAATGGGAAGAATATGGGGG + Exonic
965372975 3:167887907-167887929 AACTGATGGAAAGTATGAGGTGG - Intergenic
965909089 3:173748869-173748891 AACTGATTGAAATAATAAGGTGG + Intronic
965972629 3:174580978-174581000 AAGTGTTGGTGAGAATGTGGAGG - Intronic
966492309 3:180541610-180541632 AAGTGCTGGAGAGGATGTGGAGG + Intergenic
967160297 3:186730949-186730971 AATGGATAGAAATAATATGGTGG - Intronic
967165001 3:186772632-186772654 AGGTGATGGCGAGAAGATGGAGG + Intergenic
967247937 3:187506750-187506772 AAGTGATAGAAAGAATAGAGAGG + Intergenic
967442475 3:189525217-189525239 TAGTGATGCAAAGAACATGCAGG - Intergenic
968143179 3:196275378-196275400 AAGAGATGGACAGAAGAGGGTGG + Intronic
968193928 3:196691391-196691413 GAGTGATAAAAAGAATAAGGAGG - Intronic
968263795 3:197346557-197346579 AAGTGATGGCAAGGGTTTGGGGG - Intergenic
969287727 4:6215744-6215766 AAGTGTTGGTGAGCATATGGAGG + Intergenic
969535299 4:7752933-7752955 AAGTCATGGAGAGGATATAGAGG - Intergenic
969888604 4:10238980-10239002 AAGTTACTGCAAGAATATGGTGG + Intergenic
970037125 4:11749945-11749967 AAGTGTTGGCAAGAATGTGAAGG - Intergenic
970150041 4:13080072-13080094 AAGGGAGGCAGAGAATATGGGGG + Intergenic
970180935 4:13392599-13392621 AAGTGCTGGCCAGGATATGGAGG - Intronic
971096510 4:23411099-23411121 AAGTGATGTTAAGAATGTTGTGG + Intergenic
971481734 4:27120949-27120971 AAGTTATTGAACAAATATGGAGG + Intergenic
972375963 4:38470801-38470823 CAGTGATGTACAGAAAATGGAGG - Intergenic
972875212 4:43350396-43350418 AAGTGATGAAAAAATTATAGGGG - Intergenic
974583175 4:63833537-63833559 AAATGATGTAAAGAAGATGTGGG - Intergenic
975209869 4:71688016-71688038 AAGATAGGGAATGAATATGGAGG - Intergenic
975838833 4:78453240-78453262 AACTGAAGGAAAGAAAAAGGAGG + Intronic
976017914 4:80581686-80581708 AAGTGATGGTAAGGATAGGAAGG - Intronic
976437944 4:85040788-85040810 AAATGTTGGCAAGGATATGGAGG - Intergenic
976471975 4:85439456-85439478 AAATGATGGCAAGGATGTGGAGG - Intergenic
976568668 4:86583321-86583343 AAGGGATTGAAAATATATGGGGG - Intronic
976626680 4:87191772-87191794 TAGTGGTGGATACAATATGGGGG - Intronic
977085073 4:92585194-92585216 AAGTGAGGGGAAAAATTTGGGGG + Intronic
977422378 4:96818573-96818595 AATAGATGGAAAAAATATGGTGG - Intergenic
977519042 4:98057440-98057462 AAGTGAAGGAAAGAATCTCAGGG + Intronic
980259460 4:130429008-130429030 AAGTATTGGAAAGAAAATGAGGG - Intergenic
980305318 4:131053441-131053463 AAATGATTTAAAGTATATGGAGG - Intergenic
980312134 4:131144431-131144453 AAGTGTTGGCAAAGATATGGAGG + Intergenic
980514537 4:133837818-133837840 AAGTGTTGGTGAGAATGTGGAGG - Intergenic
981649135 4:147036270-147036292 GAGTGGTGGGAAGAATATGGAGG - Intergenic
982844511 4:160232813-160232835 GAGTGATAGAATGAATATGAAGG - Intergenic
982890819 4:160847878-160847900 AAGTTATGGAAAAAATATAAAGG + Intergenic
983314527 4:166113741-166113763 AAGTGTTGGTAAGGATGTGGAGG + Intergenic
983896050 4:173083258-173083280 AAATGATGGAAAAAATATTAAGG - Intergenic
984112451 4:175635241-175635263 AAATGGTGCCAAGAATATGGTGG - Intronic
984960106 4:185088444-185088466 ATGTGTAGAAAAGAATATGGAGG - Intergenic
985239762 4:187917621-187917643 AAGTGTTGGCAAGCATGTGGAGG + Intergenic
986202851 5:5594227-5594249 AAGTGTTGGCAAGGACATGGAGG + Intergenic
986480222 5:8179440-8179462 ATGTGGTGAAAAGAACATGGGGG - Intergenic
987008243 5:13733060-13733082 AAGTGATGAAGATAATATGATGG + Intronic
987347116 5:16988877-16988899 ATGTGCTGGAAAGAAGGTGGTGG - Intergenic
987819435 5:22943169-22943191 AAGTGCTGGAGAGGATGTGGAGG - Intergenic
987944801 5:24591004-24591026 TAATGATGGAGAGAATATGTGGG + Intronic
988048074 5:25985542-25985564 AAGTGTTGGCAAGGATGTGGAGG - Intergenic
989063030 5:37428888-37428910 AAGTGTAGGCAAGGATATGGAGG - Intronic
989959055 5:50388712-50388734 AAATGAAGGAAAAAATATTGAGG + Intergenic
990144283 5:52741621-52741643 GGGTAATGGAAGGAATATGGAGG - Intergenic
990620603 5:57555005-57555027 AAGTGCTGGAAAGACACTGGAGG - Intergenic
991106055 5:62843240-62843262 CAGTTATGAAAAGAAAATGGTGG + Intergenic
991948335 5:71923361-71923383 AAGTGTTGGAAGGAGTATGAAGG + Intergenic
992560874 5:77951587-77951609 AAGTGATGAAAAGTATGTGGAGG + Intergenic
992873651 5:81030366-81030388 AAATGAAGGAAAAAATATTGAGG + Intronic
993002054 5:82391040-82391062 AGGTGATGGATACAGTATGGGGG + Intergenic
993042961 5:82836279-82836301 TAGAGATGGGAAGAATTTGGAGG - Intergenic
993133390 5:83927212-83927234 AAGGAATGGAAAAAATATAGAGG - Intergenic
993544346 5:89192742-89192764 AAGTGTTGGAGAGGATATGGAGG - Intergenic
993624142 5:90203955-90203977 AATTGATGGAATAAATATTGAGG - Intergenic
994255496 5:97589261-97589283 AAGTGTTGGCAAGAATATGGAGG - Intergenic
994557861 5:101327587-101327609 AAGTGTAAGAAATAATATGGAGG - Intergenic
994657859 5:102616062-102616084 AAGTTTTTAAAAGAATATGGAGG + Intergenic
994810174 5:104507075-104507097 AAGTTTTGGAAACAAAATGGAGG - Intergenic
994946317 5:106396964-106396986 AGATAATGAAAAGAATATGGGGG - Intergenic
995875876 5:116788948-116788970 AAGAGAAGGAAAGAAAATGTTGG - Intergenic
996309912 5:122092967-122092989 AAATGATCTAAAGTATATGGGGG + Intergenic
998695778 5:144637555-144637577 AAATGCTGGCAAGAATATGGAGG + Intergenic
998962991 5:147509032-147509054 AAGTGATGCTGGGAATATGGGGG - Intronic
1000658657 5:163912978-163913000 AAGTAATGGAAAGAATGGAGAGG + Intergenic
1000782219 5:165496525-165496547 AAGTGACAGAAGTAATATGGAGG - Intergenic
1000796914 5:165675390-165675412 AAGTGTTGGCAAGGATATGGAGG - Intergenic
1001418122 5:171563078-171563100 AAGTGGTGGAAGGGATCTGGTGG - Intergenic
1001750811 5:174129738-174129760 GAGTGATGGATTGAATGTGGAGG + Intronic
1001848336 5:174941036-174941058 AAGTGATGGGAGGAGTCTGGAGG + Intergenic
1002550155 5:179982527-179982549 AAGTGTTGGTGAGAATGTGGAGG - Intronic
1003026189 6:2557911-2557933 AAGGGATGGGAAGTATAAGGGGG - Intergenic
1003541286 6:7020294-7020316 AAGTGCTGGAGAGAATGTGGAGG + Intergenic
1003676090 6:8205792-8205814 AAGAAAAGGAGAGAATATGGGGG + Intergenic
1003684791 6:8291618-8291640 AAGTTTTGGGGAGAATATGGGGG - Intergenic
1003685048 6:8294480-8294502 AAGGGATAGATAGGATATGGGGG + Intergenic
1004414003 6:15407757-15407779 AAGTGAAGAAAAGAATGTGATGG - Intronic
1004629918 6:17411430-17411452 AAGTGCTGGTGAGAATATGAAGG - Intronic
1005515390 6:26549780-26549802 AAGAGTTGGAAAGAAGAGGGAGG + Intergenic
1005646852 6:27847415-27847437 AAGTGAGGGAAAAATGATGGAGG - Intronic
1006631060 6:35430137-35430159 TAGTGTGGGAAAGAATAGGGAGG - Intergenic
1006821093 6:36895964-36895986 AAGTGTTGGTAAGGACATGGAGG - Intronic
1006965076 6:37975126-37975148 AAGTGTTGGTGAGGATATGGAGG - Intronic
1007286025 6:40748095-40748117 AAGTGATGGCAACAATCTAGAGG - Intergenic
1007505212 6:42330287-42330309 CAGTGTTGGCAAGAATGTGGAGG + Intronic
1007921394 6:45612956-45612978 AAGTGTTGACAAGGATATGGAGG - Intronic
1008520881 6:52361877-52361899 AATTCTTGGAAAGAATATGAGGG + Intronic
1008876349 6:56333756-56333778 AAGTGATGGCAAGGGTATGGAGG - Intronic
1010579955 6:77583557-77583579 AGGTGTTGGCAAAAATATGGAGG + Intergenic
1010662724 6:78589307-78589329 AGATGAGGGAAAGAATAAGGGGG - Intergenic
1011153619 6:84303651-84303673 AAGTGTTGGCAAGAATGTGAAGG + Intergenic
1011298120 6:85845855-85845877 AAGTGAAGGAAAAAATATTAAGG - Intergenic
1011451471 6:87497106-87497128 AGGTATTGGAAAGAATATGTGGG - Intronic
1011524336 6:88247000-88247022 TAGTGATGGAAATGAGATGGAGG - Intergenic
1011638426 6:89397234-89397256 AAGTGTTGGCAAGGATGTGGAGG + Intronic
1011980073 6:93363564-93363586 AAGTGTTGGTGAAAATATGGAGG + Intronic
1012099511 6:95013067-95013089 AAGTGTTGGTGAGAATATGGAGG - Intergenic
1012150110 6:95739300-95739322 AAGTGTTGGCTAGAATTTGGAGG + Intergenic
1012351277 6:98253896-98253918 AAGTGTTGGCAAGGATGTGGAGG - Intergenic
1012422032 6:99076333-99076355 AAGTGATACAAATACTATGGAGG + Intergenic
1012998844 6:106000511-106000533 AAGAGATGGAAAGAGTATATAGG - Intergenic
1013047641 6:106503154-106503176 AAGAGATGGAGAGATTAGGGGGG + Intergenic
1013067265 6:106695858-106695880 AAGTGATGGAAATGACTTGGTGG - Intergenic
1013153900 6:107475002-107475024 AAGTGAAGGAATGAATATTTTGG - Intergenic
1013452749 6:110301149-110301171 AAGTGTTGGAAAAGCTATGGCGG - Intronic
1013652018 6:112205204-112205226 AAGTGTTAGAAAAAATATAGCGG + Intronic
1013680531 6:112520801-112520823 AAGTGAGGTACAGAAAATGGAGG + Intergenic
1014522747 6:122465485-122465507 AAGTGACGGAAAGAATGATGAGG - Intronic
1014861477 6:126472782-126472804 AAGTGTTGGCAAGGATGTGGAGG - Intergenic
1015223622 6:130831850-130831872 ATGTGATGGAAAGCATGTGGAGG + Intronic
1015278770 6:131409810-131409832 AAGTAATGGCAAGAATACAGAGG - Intergenic
1015407947 6:132858138-132858160 AAATAATGCAAAGAATAAGGTGG - Intergenic
1015792659 6:136979722-136979744 ATGTGATGGAAAGAATCCTGGGG - Intergenic
1016568019 6:145479895-145479917 AAGTGTTGGCAAGGATGTGGAGG - Intergenic
1018069023 6:160144935-160144957 AAGTGTTGGCAAGGATGTGGAGG - Intronic
1018083647 6:160280166-160280188 AAGTGTTGGCAAGGATGTGGAGG - Intergenic
1018301563 6:162408547-162408569 AAATTATGGATAGAATATAGTGG - Intronic
1018336354 6:162794109-162794131 AAGTGTTGGTGAGGATATGGAGG - Intronic
1018441244 6:163815359-163815381 AAATGTTGGAAGGAATGTGGGGG - Intergenic
1018458936 6:163979227-163979249 AAGTGTTGGCAAGTATGTGGAGG + Intergenic
1018880166 6:167869814-167869836 AAGTGATGGTAACTTTATGGTGG + Intronic
1019085361 6:169470351-169470373 AGGTGATGGATAGAGTCTGGGGG - Intronic
1021340986 7:19462340-19462362 AAGTGTTGGCAAGGATGTGGAGG - Intergenic
1021809702 7:24391537-24391559 AAGAGATGAAGAGATTATGGTGG - Intergenic
1021974039 7:25994612-25994634 AAGTGTTGGTGAGGATATGGAGG + Intergenic
1022660539 7:32362469-32362491 AAGTGAGGGAAAAAATAGTGGGG - Intergenic
1022669026 7:32438533-32438555 AGGAGTTGGAAAGCATATGGTGG + Intergenic
1022689642 7:32635850-32635872 AAGTGGAGGAAAAGATATGGGGG + Intergenic
1022815998 7:33914782-33914804 AAGAGATGGAAAAATTATAGAGG + Intronic
1023236427 7:38095030-38095052 AAGTGTTGGCAAGAATAAAGAGG + Intergenic
1024017585 7:45332025-45332047 AAGTGTTGGTAAGGATGTGGAGG - Intergenic
1026192029 7:68137555-68137577 AACTTATGGAAATAATATGATGG - Intergenic
1027851288 7:83455498-83455520 AAGATATGGAAAGAATACTGTGG + Intronic
1028569918 7:92275713-92275735 AAGTGGAGGAAAGAAGCTGGGGG - Intronic
1028842040 7:95439138-95439160 AAGGGATAAAAGGAATATGGAGG - Intergenic
1029653469 7:101909405-101909427 AAGTGATGGAAAGAGGCTGGTGG + Intronic
1030632633 7:111912613-111912635 AGGAGAAGGAAAGAAGATGGAGG + Intronic
1030706820 7:112701440-112701462 AAGTCATGGAAAAAATATGTGGG + Intergenic
1030888705 7:114970714-114970736 AAGTGCTGGAAATATTAGGGAGG - Intronic
1031433596 7:121704974-121704996 AAGTGTTGGCAAGAATGTGAAGG + Intergenic
1031443908 7:121827389-121827411 AATTGTTGGCAAGGATATGGGGG + Intergenic
1032032179 7:128493497-128493519 AAGTAATGGCAAGGATGTGGTGG - Intronic
1032661494 7:133988821-133988843 AAGAGATGGAGAAAATCTGGAGG + Intronic
1032920522 7:136540628-136540650 AATTGATGAAGAAAATATGGTGG + Intergenic
1033000412 7:137498085-137498107 AAATGATACAAAGAATATGAAGG + Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034233716 7:149552907-149552929 AAGAGATGGAAAGAATGTCCTGG + Intergenic
1034454642 7:151160966-151160988 ATGAGAAGGAAAGAATTTGGTGG - Intronic
1035274587 7:157740107-157740129 AAGTGATAAAAGGCATATGGAGG - Intronic
1035430040 7:158812460-158812482 AAGTGTTGGCAAGGATGTGGAGG + Intronic
1035886948 8:3301543-3301565 AAGAGATGGGAAGAAACTGGAGG + Intronic
1036959549 8:13228939-13228961 AAGTGTTGGTAAGGATGTGGAGG + Intronic
1037122167 8:15301711-15301733 AAGTAATGGAAACAATATGAGGG - Intergenic
1037392008 8:18403131-18403153 TAGTCATGGAAAGAATGTGCAGG + Intergenic
1037629424 8:20640020-20640042 AAGTGAAGGAAAGAAAACTGTGG - Intergenic
1038107866 8:24456418-24456440 TAGTGTTGCAATGAATATGGGGG + Intronic
1038218861 8:25588602-25588624 AAGAGATGGCAAGGAAATGGGGG - Intergenic
1039263984 8:35804703-35804725 AAGTGATTGAAAGAATGGGGAGG + Intergenic
1039851936 8:41375872-41375894 AAGTGTTGGTAAGAATTAGGGGG + Intergenic
1039889714 8:41676226-41676248 AAGTGTTGGTGAGGATATGGGGG - Intronic
1040440097 8:47432450-47432472 AACTGATGTAAAGCATGTGGGGG - Intronic
1040926162 8:52686035-52686057 AAGTGATGGAACTATTATGGAGG - Intronic
1040926168 8:52686108-52686130 AAGTGATGGAACTATTAAGGAGG - Intronic
1041134838 8:54747080-54747102 AAGTGATGGTAATAAGATGGAGG - Intergenic
1041192550 8:55368254-55368276 AAGTGATAGAAAGATCATTGTGG - Intronic
1041216086 8:55601612-55601634 AAGTGTTGGTAAGGATCTGGAGG - Intergenic
1041234538 8:55786496-55786518 AAGTATTGGAATGAATATGGAGG + Exonic
1041668862 8:60472653-60472675 AAGGGTTGGCAAGAATGTGGAGG + Intergenic
1042167123 8:65956878-65956900 GTCTGATGGATAGAATATGGTGG + Intergenic
1042352386 8:67790468-67790490 AAGTGCTGCAATGAATATGTGGG - Intergenic
1042588543 8:70370799-70370821 GAATGATAGAAAGAATATGCAGG + Intronic
1042594072 8:70426744-70426766 GAGTGAATGAATGAATATGGTGG + Intergenic
1042614791 8:70636239-70636261 AAGTGTTGGCAAGAATGTGGAGG - Intronic
1042815121 8:72869692-72869714 AAGTGTTGGCAAGGATGTGGAGG + Intronic
1042848836 8:73195032-73195054 AAGTGTTGGAAAGAATGTGGAGG - Intergenic
1043366162 8:79535895-79535917 AAATGAAGGAAAAAATATGAAGG - Intergenic
1043773399 8:84233698-84233720 AAGTGAAGGAAAAAGAATGGAGG - Intronic
1044203106 8:89459232-89459254 AAATGATGGAAAAAATATTAAGG + Intergenic
1044304863 8:90627448-90627470 AAGAGATGAAAAAAATATGGGGG + Intronic
1044766592 8:95582360-95582382 AAGTTATGAAAATAAGATGGAGG + Intergenic
1045149169 8:99384076-99384098 AAGCGTTGGAAAGGATGTGGAGG - Intronic
1045370620 8:101518750-101518772 CAGAGATGGAAAGAACTTGGGGG - Intronic
1045760076 8:105595030-105595052 GAATTATGGAAAGAATATGGGGG + Intronic
1046031791 8:108790959-108790981 AAGAAATAGAAAGAATATGTTGG - Intergenic
1046066403 8:109202207-109202229 AAGGGAAGGAGAGAATATGAAGG - Intergenic
1046377192 8:113399185-113399207 AAGTATTGGCAAGAATGTGGAGG + Intronic
1046381988 8:113463482-113463504 AAGTAATGGAAAGAAAAGAGAGG + Intergenic
1046753789 8:117952795-117952817 AAGTGGGGAAAAGAATATTGAGG - Intronic
1047073650 8:121375999-121376021 ATGTGATGGAAAGAAGAAGAAGG - Intergenic
1047917469 8:129597586-129597608 AAGTGTTGGTGAGAATATGGAGG - Intergenic
1050059962 9:1697748-1697770 AAGTGTTGGCAAGGATATGAAGG + Intergenic
1050544701 9:6700135-6700157 AAGTGAAGGATAGAATATGCAGG + Intergenic
1051025696 9:12608012-12608034 AATAGTTGGATAGAATATGGTGG - Intergenic
1051733123 9:20168706-20168728 AAGTGCTGGCAAGAATGTAGAGG + Intergenic
1051960002 9:22747955-22747977 AATTGATGAAAATAGTATGGAGG + Intergenic
1052186184 9:25597720-25597742 AATGGCTGGAAAGAAAATGGAGG - Intergenic
1052281963 9:26743123-26743145 AGTTGATGGAAAGAAGGTGGGGG + Intergenic
1052587186 9:30443706-30443728 GAATCATGGAAAGAACATGGGGG + Intergenic
1056008390 9:82299241-82299263 AAGAGAAGGAAGGGATATGGTGG + Intergenic
1059003519 9:110376120-110376142 AGGTGATGCAAAGACTATTGGGG - Intronic
1059370937 9:113834674-113834696 AAGTGTTAGCAAGAATGTGGAGG + Intergenic
1060016519 9:120091350-120091372 AATGGAAGGAAAGAATATGAAGG - Intergenic
1060327883 9:122634880-122634902 AAGTGTTGGCAAGGATATGAAGG + Intergenic
1061062348 9:128256992-128257014 AAGGGATGGTAGGGATATGGTGG + Exonic
1061343955 9:130006931-130006953 TAGTGATATAAAGAATGTGGAGG + Intronic
1061902979 9:133682364-133682386 AGATGACGGAAAGAAGATGGCGG + Intronic
1062709199 9:137964115-137964137 AAGTGAAGGAAAGAATGTTAAGG - Intronic
1186187527 X:7036290-7036312 AAGTTATGGAAAGAATTCTGTGG - Intergenic
1186269227 X:7866733-7866755 GAGTGAAGGAAAGAATGTGTGGG + Intergenic
1187695097 X:21911761-21911783 AACTGATGGACAGAATATTCAGG - Intergenic
1187808438 X:23147770-23147792 AAGTGTTGGGGAGAATGTGGAGG + Intergenic
1187911164 X:24112494-24112516 AAGTGCTGGTGAGAATGTGGAGG - Intergenic
1188590879 X:31833643-31833665 AAGTGAAGGAAAGAAGAAAGAGG + Intronic
1189135956 X:38550277-38550299 AAATGCTGGCAAGAATATGGAGG - Intronic
1189340189 X:40199060-40199082 CAGTGAGGGAAAGAAGTTGGTGG - Intergenic
1189878493 X:45463269-45463291 AAGTGTTGGTGAGAATGTGGAGG - Intergenic
1190156964 X:48001996-48002018 AAGTGAAAGAAAAAATATGGTGG + Intronic
1190175449 X:48145272-48145294 AGGTGAAGGAAAGGATTTGGGGG + Intergenic
1190179541 X:48180398-48180420 AGGTGAAGGAAAGAATTTGTGGG - Intergenic
1190185709 X:48232134-48232156 AGGTGAAGGAAAGCATTTGGGGG - Intronic
1190192444 X:48288794-48288816 AGGTGAAGGAAAGGATTTGGGGG - Intergenic
1190343327 X:49314786-49314808 ATGTGGAGGAAATAATATGGGGG + Intronic
1190471537 X:50785118-50785140 AAGTGTTGGTGAGAATGTGGAGG + Intronic
1190662318 X:52666154-52666176 AGGTGAAGGAAAGGATTTGGAGG + Intronic
1190710395 X:53064122-53064144 TAGAGGTTGAAAGAATATGGAGG - Intronic
1190774544 X:53542242-53542264 TAGTAAAGGAAAGAAAATGGTGG - Intronic
1191661129 X:63652443-63652465 AAATGATTGAAAGTATATGGAGG + Intronic
1191899885 X:66030126-66030148 CAGTGATTAAAAGAATATTGAGG + Intronic
1192083950 X:68076321-68076343 ACATGTTGAAAAGAATATGGAGG + Intronic
1193043680 X:77030465-77030487 AAGTGAAGGAAAAAATGTTGAGG - Intergenic
1193214285 X:78844074-78844096 AAGTGTTAGAAAGAATATGGAGG + Intergenic
1193634339 X:83929889-83929911 CAGTGATGGTAAGAATAGAGAGG - Intergenic
1193681880 X:84531148-84531170 AAATTATGGTAAGAATTTGGAGG + Intergenic
1194024192 X:88731202-88731224 CAGTGCTGGAACAAATATGGGGG - Intergenic
1194957363 X:100196664-100196686 ACATGATGGAAGGAATAAGGTGG - Intergenic
1195288735 X:103410725-103410747 AAGTGATTTAAAAAATATGTTGG + Intergenic
1196125470 X:112094238-112094260 TAGTGATGGATCGAATATGGTGG + Intergenic
1196521209 X:116674409-116674431 AAGTGTTGGCAAGTATATGGTGG - Intergenic
1197027067 X:121765369-121765391 AAGTGTTGGCAAGGATATGAAGG + Intergenic
1197711022 X:129667590-129667612 AAGTGTTGGTGAGGATATGGAGG - Intergenic
1197857611 X:130933534-130933556 AAGGGATTTAAAGCATATGGGGG - Intergenic
1197961907 X:132016275-132016297 AAAGGATAGATAGAATATGGAGG - Intergenic
1199594096 X:149493190-149493212 AAGAGGTGGAAAGGATATAGTGG + Intronic
1199761815 X:150910451-150910473 AAGAGTTGGCAAGAATGTGGAGG + Intergenic
1200024027 X:153240016-153240038 AAGTGATGGAAAGTGTTTAGAGG - Intergenic
1200314146 X:155113972-155113994 AAGTGTTGGTGGGAATATGGAGG + Intronic
1201278398 Y:12319705-12319727 AAGTGAAGGAACTCATATGGGGG + Intergenic
1201358455 Y:13120563-13120585 AAGTGAAGGAACTCATATGGGGG + Intergenic