ID: 1165566185

View in Genome Browser
Species Human (GRCh38)
Location 19:36730293-36730315
Sequence GTTCAGCAGCAGCATGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165566182_1165566185 13 Left 1165566182 19:36730257-36730279 CCCAACATGTAGATCTTGTTTAA No data
Right 1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG No data
1165566181_1165566185 21 Left 1165566181 19:36730249-36730271 CCTCTAAGCCCAACATGTAGATC No data
Right 1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG No data
1165566183_1165566185 12 Left 1165566183 19:36730258-36730280 CCAACATGTAGATCTTGTTTAAA No data
Right 1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165566185 Original CRISPR GTTCAGCAGCAGCATGCTGT AGG Intronic