ID: 1165566185

View in Genome Browser
Species Human (GRCh38)
Location 19:36730293-36730315
Sequence GTTCAGCAGCAGCATGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 12, 2: 32, 3: 79, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165566183_1165566185 12 Left 1165566183 19:36730258-36730280 CCAACATGTAGATCTTGTTTAAA 0: 1
1: 0
2: 0
3: 24
4: 246
Right 1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG 0: 1
1: 12
2: 32
3: 79
4: 230
1165566181_1165566185 21 Left 1165566181 19:36730249-36730271 CCTCTAAGCCCAACATGTAGATC 0: 1
1: 0
2: 1
3: 2
4: 85
Right 1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG 0: 1
1: 12
2: 32
3: 79
4: 230
1165566182_1165566185 13 Left 1165566182 19:36730257-36730279 CCCAACATGTAGATCTTGTTTAA 0: 1
1: 0
2: 1
3: 21
4: 232
Right 1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG 0: 1
1: 12
2: 32
3: 79
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165566185 Original CRISPR GTTCAGCAGCAGCATGCTGT AGG Intronic
900393165 1:2442649-2442671 GTGCAGAAGCAGCATGGTGTGGG + Intronic
901154398 1:7125699-7125721 GTTCAGCAGGAGCAGCATGTAGG + Intronic
901286478 1:8083251-8083273 GTTCAGCAGCAGTGAGCTCTGGG + Intergenic
901496224 1:9623764-9623786 CTTCAGCAGCCACCTGCTGTTGG + Intergenic
901620135 1:10578230-10578252 TTTCAGTAGCTGCCTGCTGTGGG + Intronic
901791556 1:11655900-11655922 GTTCAGCAGCAGCTGGCGGGCGG - Exonic
901793789 1:11668744-11668766 GTTCAGCAGCAGCTGGCGGGCGG - Exonic
901842602 1:11963603-11963625 GATCAGCAGCCGCAGGCTGTTGG - Exonic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
906126211 1:43428421-43428443 CTTCAGCAGCAGCATGGAGGAGG + Exonic
909386147 1:75059037-75059059 GCTAAGCATCAGGATGCTGTGGG + Intergenic
909460608 1:75908955-75908977 GTACAGCAGCACCATGCTAGAGG - Intronic
910240359 1:85079737-85079759 CCTCAGCAGCAGCATGCCCTGGG - Intronic
910485697 1:87711048-87711070 GCTGAGCCCCAGCATGCTGTAGG - Intergenic
911753025 1:101520571-101520593 GTTCAACAGCACCATGTTATAGG - Intergenic
911764104 1:101653712-101653734 GTTTAGCAGCATAATACTGTAGG - Intergenic
912589540 1:110802399-110802421 AGTCAGCAGCAGCATGCTATAGG + Intergenic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
918621033 1:186606102-186606124 GTTCAGCAGCACCGGGCTCTAGG - Intergenic
921495400 1:215834565-215834587 GTGAAGCAGCATCATGATGTCGG - Intronic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
922504912 1:226120861-226120883 GTTCAGCTGGAGCATGCTGCCGG - Intergenic
922621053 1:226988424-226988446 GTCAAGCAGCAGCATGCGGGGGG + Intergenic
922771482 1:228186290-228186312 GTACAACAGCGGCATGCTCTTGG + Intergenic
923271575 1:232359568-232359590 GTTCAGCAGCGACTTGCTGAGGG + Intergenic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
1063827890 10:9919678-9919700 CTTCAGAAAAAGCATGCTGTTGG + Intergenic
1065496570 10:26335410-26335432 GTTTGGCAGCACCATGCTGTAGG - Intergenic
1068007249 10:51406170-51406192 GTTCTGCAGCAGCAGGCAGTGGG - Intronic
1069789905 10:71012893-71012915 GTTCTGCTGCAGCATCCTGGTGG - Intergenic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072054886 10:91745224-91745246 ATTCAACAGCACCATGCCGTAGG + Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1074702482 10:116104585-116104607 GTTCAGCAAAAGCAGGCTGCAGG + Intronic
1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG + Intergenic
1076238505 10:128884177-128884199 GTTCAGCGGCATCAGGCTGAAGG - Intergenic
1076736301 10:132460717-132460739 GGGCAGCATCTGCATGCTGTGGG + Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1077930297 11:6724274-6724296 GTTTAGCAGCAGCACATTGTAGG + Intergenic
1077953706 11:6990247-6990269 GTACAGCAGCAGTATGATTTTGG - Intergenic
1078121359 11:8513199-8513221 GATGAGCAGAAGCAAGCTGTAGG - Intronic
1078470219 11:11580465-11580487 GTTCAGTAGCAGGATGCGGAAGG - Intronic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1080923985 11:36737185-36737207 GTTAAGCAGCAGTACCCTGTAGG - Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1082935428 11:58652094-58652116 GCTCAGCAGCACCATGCTATAGG - Intronic
1082984716 11:59158481-59158503 GTTCAGCAACTGCTTCCTGTGGG + Intergenic
1083732707 11:64661364-64661386 GCCCAGCTGCAGAATGCTGTGGG + Intronic
1085688913 11:78649925-78649947 GTACAGGAGCAGAATTCTGTTGG - Intergenic
1086035960 11:82414702-82414724 TTTTAGCAGCACCATGCTGTAGG + Intergenic
1086600053 11:88622567-88622589 GCTCAGGAGCTGCATGCTGGAGG + Intronic
1087700239 11:101429244-101429266 CTTCAGCAGGATCATGCTATAGG - Intergenic
1088744532 11:112794565-112794587 GTCCAACAGCCGCATGCTGCCGG + Intergenic
1088907680 11:114167025-114167047 TAACAGCAGCAGCATTCTGTGGG + Intronic
1091672996 12:2466637-2466659 CTGCACCAGCAGCATCCTGTGGG - Intronic
1092574493 12:9764955-9764977 CTGCAGCAGCAGGATGCTTTTGG + Intergenic
1092671570 12:10867713-10867735 GTTCAATAGCACCATGCTTTAGG - Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1096245419 12:49982358-49982380 GTTCTGGAGCAGCAGGCTGGAGG + Intronic
1097487080 12:60216369-60216391 GCATAGCAGCAGCATGCTGAGGG - Intergenic
1097646236 12:62237908-62237930 GTTCAGCAACACCAAGATGTAGG - Intronic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1100100062 12:91092201-91092223 GTCAAGCAGCATCATTCTGTAGG - Intergenic
1100804463 12:98266800-98266822 GTTCAGGAGCCCTATGCTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1101379413 12:104201542-104201564 TTTCAGGAGCATGATGCTGTAGG - Intergenic
1101792611 12:107941592-107941614 GTTCAGCTGCACCATGCAGAAGG + Intergenic
1102097161 12:110249853-110249875 GTGCAGGAGCAGCATACTGGAGG - Intergenic
1102619455 12:114182507-114182529 GGTCAGCACCAACTTGCTGTAGG + Intergenic
1104209577 12:126675632-126675654 GTTCAGCAGCAGCAACATGTAGG + Intergenic
1105968388 13:25405118-25405140 GTTCAGCAGCAAGAGGCTGTTGG + Intronic
1105981963 13:25526677-25526699 GCTTAGCAGCACCATGCTGTAGG - Intronic
1107527902 13:41251529-41251551 CCTGAGCAGCAGCATGCTGGTGG - Intronic
1108165588 13:47689813-47689835 GTTCTGCAGCAGCACACTGGAGG + Intergenic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109318684 13:60782583-60782605 GGTCAGCTGCAGCTTGCTGAAGG + Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1111914985 13:94351389-94351411 TTTCAGAATCAGCATGGTGTAGG - Intronic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1115897835 14:38109954-38109976 GTACAGAAGCAGATTGCTGTTGG - Intergenic
1116514007 14:45784434-45784456 GTTTAGCAGCCCTATGCTGTAGG - Intergenic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1117618067 14:57554473-57554495 GTTCAGCAGCTCCAAGCTATAGG - Intergenic
1117960695 14:61158997-61159019 ATTCACCAGCTGCTTGCTGTTGG + Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1118717280 14:68569358-68569380 GGTCAGCAGCAGCAAACTGAGGG + Intronic
1119684258 14:76618514-76618536 GTTCTGCGGCATCATGTTGTAGG + Intergenic
1125365537 15:38911479-38911501 GTTCAGCAGCAGTATGGTGTAGG - Intergenic
1126815858 15:52452561-52452583 GTTCAGCAGTATCATACTGTAGG + Intronic
1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG + Intergenic
1127521390 15:59746468-59746490 GTTGAGCCCCAGCATGCTGTTGG + Intergenic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1127849656 15:62901647-62901669 GTTCCGCTGCAGCATGAGGTGGG + Intergenic
1129297971 15:74610216-74610238 CTGCAGCAGCAGGATCCTGTGGG + Intronic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1132224282 15:100128409-100128431 GTCCAGCAGCATCGTCCTGTGGG - Intronic
1132397394 15:101483928-101483950 GTCCAGAAGCACCATGCGGTAGG + Intronic
1138182861 16:54954479-54954501 GTTCCTCTGCAGCAAGCTGTGGG - Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1141239090 16:82248458-82248480 GTGCAGAAGCAGCAAGATGTGGG + Intergenic
1141783482 16:86181599-86181621 GTTCAGCAACAGCAGGCTGAGGG - Intergenic
1142407473 16:89898787-89898809 GATGAGCAGCAGCATGCAGAGGG - Exonic
1142640714 17:1284348-1284370 GTGCCGTAGCAGCACGCTGTAGG + Intronic
1143323106 17:6080744-6080766 CTGCAGCAGCAGCAGGCTGCCGG - Exonic
1143732879 17:8890894-8890916 GTTCAGCAGCAGCACGGTGCTGG + Exonic
1144233343 17:13231272-13231294 GTTCAGCACCAGCTCTCTGTGGG + Intergenic
1144853294 17:18254783-18254805 GTTCAGCACCAGCATGTTCTTGG + Exonic
1145795361 17:27652354-27652376 GATGAGCAGCAGCATGCTGAAGG + Intergenic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1149553971 17:57559972-57559994 GTTCTTCAGCAGGATGCTGCGGG + Intronic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1150358434 17:64507299-64507321 GTGGAACAGCAGTATGCTGTGGG + Intronic
1151490062 17:74427549-74427571 GTTTACCAGCAGCCGGCTGTGGG + Intronic
1151524803 17:74657671-74657693 GAACAGCAGCTGCAGGCTGTGGG - Intergenic
1151756690 17:76079306-76079328 GTTCAGCATTACCTTGCTGTTGG + Exonic
1155011917 18:21787319-21787341 GTTCAGCAGCACTATACTGCAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1156045488 18:32872754-32872776 GTGCTGGAGAAGCATGCTGTAGG - Intergenic
1157887240 18:51380692-51380714 GTTCAGCTGGAACATGATGTTGG + Intergenic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1159837209 18:73352708-73352730 GTTCAGCAGCAACACTCTGCAGG - Intergenic
1160089831 18:75816393-75816415 GGACAGCAGCAGCCTCCTGTTGG - Intergenic
1160239260 18:77111496-77111518 GGGCAGCAGCAGAAGGCTGTGGG + Intronic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1162298582 19:9830186-9830208 TTTTAGCAGCTGCATGCTGATGG - Intergenic
1162379506 19:10323218-10323240 GTTGAGCAGCTGCAGGATGTTGG + Exonic
1162762139 19:12895083-12895105 GTTAAGCAGGAGGAGGCTGTGGG - Intronic
1163368642 19:16889792-16889814 GTTCATCAGCAGCATGGTGGAGG - Exonic
1164740829 19:30574394-30574416 GCTCAGCAGCAGGAGGCAGTGGG - Intronic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1165825715 19:38704717-38704739 GCTCAGCAGCAGGAGGCTCTGGG + Intronic
1166623122 19:44322856-44322878 GTTCAGCATCACTATACTGTAGG - Intergenic
1166974736 19:46599313-46599335 GTTCGTTAGCACCATGCTGTGGG - Intronic
1167306534 19:48713290-48713312 CTCCAGCAGCAGCCGGCTGTGGG - Exonic
925346382 2:3174951-3174973 GCTCTGCAGCTGCATGCTGGAGG + Intergenic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
925483555 2:4303262-4303284 GTTCACCATCAGCATCATGTTGG - Intergenic
926132469 2:10312937-10312959 GTTGAGAAGCACCATGATGTTGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927187167 2:20490213-20490235 CTCCAGCAGCAGCATCCTCTGGG - Intergenic
927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG + Intergenic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
931213464 2:60219676-60219698 GGTCAGAAGCAGCACGATGTTGG + Intergenic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
932688175 2:73891295-73891317 GTGCAGCAGCAGCATGATATGGG - Intergenic
933319730 2:80758131-80758153 GCTCAGCCGCAGGATGCTCTTGG + Intergenic
933460214 2:82573659-82573681 ATTCAGCTGTACCATGCTGTAGG - Intergenic
936851567 2:116905229-116905251 ATTAAGCAGCACCATCCTGTAGG - Intergenic
937019402 2:118636417-118636439 ATGCAGCTGCAGCAAGCTGTGGG + Intergenic
937051447 2:118894626-118894648 GTGCAGAAGCAGCAAGCTCTTGG - Intergenic
937838456 2:126498139-126498161 CCTCAGCAGCAGAATGCAGTTGG + Intergenic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
939870985 2:147525604-147525626 TTTCAGCGGCAGAATGCTTTGGG - Intergenic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
941589913 2:167406761-167406783 ACTCAGCAACACCATGCTGTCGG + Intergenic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
943602563 2:189939210-189939232 TTTCAGTGGCACCATGCTGTAGG + Intronic
943659505 2:190543260-190543282 GTTCATCAGCACTGTGCTGTCGG - Intergenic
944277691 2:197858002-197858024 GTTCAACAGCCCCATGATGTAGG - Intronic
944999078 2:205329599-205329621 GTTAAGAAGCAACATGCGGTAGG + Intronic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
947305386 2:228740634-228740656 GTACAGCAGCACCATGCTCTAGG - Intergenic
947702564 2:232246663-232246685 ACTCAGCAGCAGCATGGTGCAGG - Intronic
948000741 2:234565013-234565035 GTACAGCAGCAGGAAGCTGAAGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
949009524 2:241670606-241670628 GTCCAGCACCTGCATGCTGGGGG + Intronic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1170933302 20:20788631-20788653 GTACAGCACCCGAATGCTGTAGG + Intergenic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1175540607 20:59745397-59745419 GTTCACCAGCAAGATGCTCTGGG + Intronic
1176616047 21:9028926-9028948 GGTGAGCAGCAGGATGCAGTAGG - Intergenic
1179451075 21:41468835-41468857 GTTCAGCAGAACCAAGCCGTTGG - Intronic
1180607975 22:17075547-17075569 GTTAAGCAGCACCATGTGGTAGG - Intergenic
1181803147 22:25360129-25360151 GTCCAGCTGCAGCACGATGTCGG + Exonic
1184327470 22:43800124-43800146 TTTCAGCAGTCACATGCTGTAGG + Intronic
1185068099 22:48642029-48642051 GTGGACCAGCAGCATGCTGAGGG + Intronic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
950912230 3:16606153-16606175 GTAGAGCAGGAGCAAGCTGTGGG + Intronic
951233996 3:20212951-20212973 CTTCAGCAGCAGGATTCTATTGG - Intergenic
951946981 3:28149500-28149522 ATTACTCAGCAGCATGCTGTGGG - Intergenic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
953415348 3:42712406-42712428 GAGCAGCATCAGCATCCTGTGGG - Intronic
954946997 3:54434641-54434663 GCTCAGCAGTAGCAGGCTGGTGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
956380514 3:68659983-68660005 GTTCAGCATCAGCATTTTGGGGG + Intergenic
959191168 3:103113238-103113260 GTAAAGCAGCAGCAGGCTCTTGG + Intergenic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
960749171 3:120927326-120927348 GTTCAGCAGTATCATGCTATAGG - Intronic
961518589 3:127454177-127454199 GCACAGCAGCTGCAGGCTGTGGG - Intergenic
961602687 3:128073352-128073374 CTTCAGCAGGAGCAGGCTGGGGG - Intronic
962200731 3:133399382-133399404 GTTCATCAGCTGCTTGCTGTTGG - Intergenic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
964612206 3:158626975-158626997 GATCAGCTGCAACATGTTGTCGG - Intergenic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
966684398 3:182678327-182678349 GTTCAGCTGCAGCTGACTGTAGG - Intergenic
967688822 3:192449461-192449483 GTTCCACAGCACCCTGCTGTCGG + Intronic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
968317656 3:197737567-197737589 AGTGAGCAGCAGCATGGTGTGGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970866938 4:20770095-20770117 GTTCAGAAGAAGCAGGCTGTGGG - Intronic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
972692722 4:41415491-41415513 GTTTTGAAGCAGCATGCTGCAGG + Intronic
973950425 4:56007449-56007471 GTTCAGTAACAACATGCTGTAGG - Intronic
974964063 4:68738235-68738257 GCTTAGCAACAGCATGCTGTAGG - Intergenic
975932373 4:79540360-79540382 GATAAGCATCAGGATGCTGTGGG + Intergenic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
979439035 4:120729152-120729174 CTTCAGCATCAGCATGGTTTTGG + Intronic
979632117 4:122915090-122915112 GTTCTGGAGAAGCATGCTGCAGG + Intronic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980630207 4:135421578-135421600 GTTCTGCAGCAGAATTCTGTGGG + Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
982114233 4:152083939-152083961 TTTCAGCAATGGCATGCTGTGGG - Intergenic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
983738431 4:171093115-171093137 ATTCAGCAAAAGCATGATGTTGG + Intergenic
984379620 4:178974852-178974874 ATTCAGCAGAAGCACCCTGTTGG + Intergenic
984521249 4:180803753-180803775 TTCCAGCAGCACAATGCTGTTGG - Intergenic
984742444 4:183178758-183178780 GTTCAGAAGCAGCAGGCTTCAGG + Intronic
986719151 5:10547713-10547735 GGTCAGCAGCAGCATGGTGGGGG - Intergenic
987260176 5:16195270-16195292 GATCAGCAGCATCAGTCTGTGGG + Intergenic
988412975 5:30910922-30910944 ATTCAGCAGGAACAAGCTGTTGG - Intergenic
988706669 5:33733321-33733343 GTTCTGGACCAGCATGCTCTAGG - Intronic
989390339 5:40894066-40894088 ATTCAGCAGCAGCACACTATAGG - Intergenic
989481511 5:41935918-41935940 GATAGGCAGCAGCATGCTGCTGG + Intronic
990532350 5:56687071-56687093 GCTCAGCAGCAGCATGCATGAGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
993241020 5:85385463-85385485 ATTTAGCAGCAGCATGCTGTAGG - Intergenic
994317561 5:98349724-98349746 GCTTAGCAGTACCATGCTGTAGG + Intergenic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
995091326 5:108181133-108181155 GTCCAGAAGCAGCATGTTTTGGG - Intronic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995534844 5:113124857-113124879 GTTCACAAGAAGGATGCTGTGGG + Intronic
995553124 5:113300016-113300038 GTGCACCAACACCATGCTGTGGG + Intronic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
997420444 5:133762883-133762905 GTCCAGCAGCTTCATGCTTTGGG - Intergenic
997714449 5:136031551-136031573 GTTCAGACACAGAATGCTGTTGG + Intronic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999038974 5:148385593-148385615 TTTCAGCACCATCATCCTGTTGG + Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1002202246 5:177536471-177536493 CTTCAGGAGCGGCATGCTGGTGG + Exonic
1002319692 5:178367649-178367671 GTTCAGCAGCAGAATCCCATGGG - Intronic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003155357 6:3589227-3589249 GTTCTGCAGCAGTATGCTTTGGG + Intergenic
1006275330 6:33000783-33000805 CTTCAGCAGCAACAGGCTGCAGG - Intergenic
1006290258 6:33129482-33129504 ACTCAGCAGCAGCATCCTCTTGG - Intergenic
1007040805 6:38720357-38720379 GTTTGGCAGTACCATGCTGTGGG + Intronic
1010527563 6:76922536-76922558 GTTCAGCAGCTACTTGCTATAGG + Intergenic
1014308745 6:119772236-119772258 GTTCAGCAGCAATGTGCTTTGGG + Intergenic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017886655 6:158605665-158605687 GTGCAGATGCAGCATGCTCTTGG + Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1018337586 6:162810669-162810691 GCTCAACAGCAGAATGCAGTAGG + Intronic
1018839057 6:167506048-167506070 GTTCAGCAGCTGCCTGATGTGGG - Intergenic
1019131338 6:169879117-169879139 GTTCAGCAGCACGAGGCTATAGG - Intergenic
1021438007 7:20643610-20643632 CTTCAGCGGCAGCATGTTCTAGG + Exonic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1024011862 7:45273912-45273934 GTTCAGCAGCAGATGGCTTTTGG - Intergenic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1028754561 7:94420534-94420556 GTTGACCAGCAGCACCCTGTTGG - Exonic
1030200888 7:106902311-106902333 GGTCAGCTGCAGCTTGCTGGAGG + Intronic
1032867092 7:135936732-135936754 AATCAGCAGAATCATGCTGTAGG - Intronic
1033398537 7:140999528-140999550 ATCCAGCAGCAGAATGCTGGGGG - Intergenic
1035435364 7:158855666-158855688 GGTCAGAAGCAAGATGCTGTGGG + Intergenic
1036056311 8:5258817-5258839 GTCCAGCAGCTGCATGCCTTGGG + Intergenic
1036669788 8:10775350-10775372 TTTGAGAAGCAGCATGCTGGAGG - Intronic
1036908048 8:12724398-12724420 GTTCTTCAGAAGCACGCTGTTGG + Intronic
1037282772 8:17261814-17261836 ATTCAGCAGCTCCATGTTGTAGG - Intronic
1037758253 8:21725314-21725336 GGTCAGCAACAGCATGCTGAAGG + Intronic
1038751770 8:30302726-30302748 GTTCAGCAGCAGCATGGAGGAGG - Intergenic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1041501091 8:58539574-58539596 CTTCAGTGGAAGCATGCTGTTGG + Intergenic
1041996126 8:64060515-64060537 GTTCAGGAGCACCGTTCTGTAGG + Intergenic
1043033125 8:75164249-75164271 GTTCGGCAGCACCATGCTGAAGG - Intergenic
1043464088 8:80487419-80487441 CTGCAGCAGCAGCAGGCGGTCGG + Exonic
1043932672 8:86108537-86108559 GTTCAGCAGCAGCAGAGTGTGGG + Intronic
1044407584 8:91846564-91846586 ATTCAGCAGTATCATGCTATAGG + Intergenic
1048080114 8:131117764-131117786 GTTGAGCTGCACCATGCTATAGG - Intergenic
1049755979 8:144311498-144311520 GTTCAGCATCAGGGGGCTGTGGG - Exonic
1049766666 8:144358301-144358323 CAGCACCAGCAGCATGCTGTCGG + Exonic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1053607892 9:39679388-39679410 GGACAGCTGCAGCATGCTGGAGG - Intergenic
1053623407 9:39843707-39843729 GTTCAGCTTGAGGATGCTGTTGG + Intergenic
1053881461 9:42599521-42599543 GTTCAGCTTGAGGATGCTGTTGG - Intergenic
1053891202 9:42694791-42694813 GTTCAGCTTGAGGATGCTGTTGG + Intergenic
1054220492 9:62406992-62407014 GTTCAGCTTGAGGATGCTGTTGG - Intergenic
1054230223 9:62502180-62502202 GTTCAGCTTGAGGATGCTGTTGG + Intergenic
1054245642 9:62663021-62663043 GGACAGCTGCAGCATGCTGGAGG + Intergenic
1054559769 9:66697552-66697574 GGACAGCTGCAGCATGCTGGAGG + Intergenic
1054953512 9:70881459-70881481 GCTCAGCCACAGCAGGCTGTAGG + Intronic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1056927422 9:90846791-90846813 AGCCAGCAGCAGAATGCTGTGGG + Intronic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1058913080 9:109539106-109539128 GTTCTGCAGCAGCAAGATCTTGG - Intergenic
1060059585 9:120447231-120447253 GCTCAGCTGCATCATTCTGTGGG + Intronic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1060918641 9:127405550-127405572 GTTCAGCAGCCTCATGGTGAGGG + Exonic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1187045780 X:15646705-15646727 GCTCAGCAGCGGCAGCCTGTTGG - Intronic
1187051780 X:15703074-15703096 GCTCAGCAGCGGCAGCCTGTTGG - Intronic
1187714226 X:22086212-22086234 GTTCAGCAGCATTATGCTATAGG - Intronic
1187819837 X:23275648-23275670 GTTCAGCAGCATCAGCATGTTGG - Intergenic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG + Intergenic
1188553361 X:31384596-31384618 CTTCAACAGCAGCATACTGTTGG - Intronic
1188717401 X:33476866-33476888 GGACAGCTGCAGCATGCTGGAGG - Intergenic
1188901218 X:35734562-35734584 GCTGAGCAGCATCATTCTGTGGG - Intergenic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1191701507 X:64047556-64047578 GCTAAGCAGCATCATTCTGTAGG + Intergenic
1191802799 X:65099600-65099622 GTTCTGCTGCAGTATGCTGGAGG - Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1194613656 X:96074847-96074869 ATTCAGCAGCATCATGTTGTAGG + Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196980928 X:121212942-121212964 GGTCAGCAGCACCATGCTACAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1199095662 X:143735691-143735713 TTCCAGCAGCATGATGCTGTTGG - Intergenic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic
1199440851 X:147866439-147866461 CTGCAGCAGCAGCATGGGGTGGG + Intergenic
1200182543 X:154159480-154159502 GATCAGCATCAGCATGGTGCAGG + Intergenic
1200188197 X:154196594-154196616 GATCAGCATCAGCATGGTGCAGG + Intergenic
1200193847 X:154233734-154233756 GATCAGCATCAGCATGGTGCAGG + Intergenic
1200199602 X:154271538-154271560 GATCAGCATCAGCATGGTGCAGG + Exonic