ID: 1165567924

View in Genome Browser
Species Human (GRCh38)
Location 19:36747859-36747881
Sequence CAGTGTGAACACTCTGATGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 1, 2: 6, 3: 38, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165567919_1165567924 9 Left 1165567919 19:36747827-36747849 CCCACATGTCTTACATTCATAGG 0: 2
1: 5
2: 63
3: 231
4: 533
Right 1165567924 19:36747859-36747881 CAGTGTGAACACTCTGATGTCGG 0: 1
1: 1
2: 6
3: 38
4: 187
1165567921_1165567924 8 Left 1165567921 19:36747828-36747850 CCACATGTCTTACATTCATAGGG 0: 2
1: 12
2: 118
3: 342
4: 706
Right 1165567924 19:36747859-36747881 CAGTGTGAACACTCTGATGTCGG 0: 1
1: 1
2: 6
3: 38
4: 187
1165567918_1165567924 13 Left 1165567918 19:36747823-36747845 CCTTCCCACATGTCTTACATTCA 0: 1
1: 1
2: 38
3: 91
4: 353
Right 1165567924 19:36747859-36747881 CAGTGTGAACACTCTGATGTCGG 0: 1
1: 1
2: 6
3: 38
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165567924 Original CRISPR CAGTGTGAACACTCTGATGT CGG Exonic
902687320 1:18086904-18086926 CAGTGAGCACACTCTGATGGTGG - Intergenic
903385788 1:22925336-22925358 CTGTGTGTACACGCGGATGTGGG - Intergenic
903535246 1:24062553-24062575 CACTGGGAAAACTCTGCTGTTGG + Intronic
906943041 1:50272651-50272673 CAGTGTGAACAGTATAATGATGG + Intergenic
909873900 1:80779218-80779240 CAGTGGGAATACTCAGATGGGGG - Intergenic
912719623 1:112008807-112008829 CATAGTGAACAAGCTGATGTGGG - Intergenic
923285533 1:232491367-232491389 CTGTGTGAACCTTCTCATGTGGG - Intronic
1066010238 10:31188117-31188139 CAGTGAGAAGATTCTGATGGAGG - Intergenic
1066039137 10:31527633-31527655 CAGTATTATCACTCTTATGTTGG + Exonic
1066929135 10:41734951-41734973 CACTTTGAACACACTGATTTTGG + Intergenic
1069694690 10:70377886-70377908 CAGTGGGAAAACACTGATTTTGG + Intronic
1078352491 11:10605891-10605913 CAGTGAGAACACTTGGATCTAGG + Intronic
1079306050 11:19323642-19323664 CAGTTTGAACACTTTGACCTTGG - Intergenic
1080648151 11:34202325-34202347 CAGTGTGAAGGCTCTGGAGTGGG + Intronic
1081198006 11:40185098-40185120 CAGTGTGAACACTTTTAGGAGGG + Intronic
1087867540 11:103249695-103249717 CAGAGTGACCTCTCTGATGTTGG - Intronic
1088867725 11:113864696-113864718 CAGTTTGAACTCCCTAATGTGGG - Intronic
1092966873 12:13652469-13652491 AAGTGCTAACAGTCTGATGTAGG + Intronic
1098308488 12:69124782-69124804 CAGGGTAAGCACTCAGATGTGGG - Intergenic
1099590723 12:84585438-84585460 CAGTTTGAACACTCTGTATTTGG + Intergenic
1100432313 12:94541771-94541793 CCATGTGAACACTCTCATGGGGG + Intergenic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1104133332 12:125915463-125915485 CATTGTTAACACTAAGATGTTGG - Intergenic
1104847848 12:131855752-131855774 CAGCGGGCACACTCTGAGGTCGG + Intergenic
1107194021 13:37625511-37625533 CAGAGTCAAAACTCTGATTTGGG + Intergenic
1108520293 13:51241019-51241041 CAGTGTGAACCCTCTGCTCTAGG + Intronic
1108695085 13:52896038-52896060 GATGGTGAACACTCTGATGCAGG - Intergenic
1109257968 13:60107086-60107108 CAGTGTTAACTTTCTGATTTTGG + Intronic
1110832850 13:80051577-80051599 CAGTGTGAACATGATGATGGAGG - Intergenic
1112520577 13:100091185-100091207 CAGTGGGAAGACATTGATGTTGG + Intronic
1113180621 13:107621186-107621208 CAGTGTTAACACTGTAATTTAGG - Intronic
1114082018 14:19209570-19209592 AAGTTTGAACACTCAGATGCAGG + Intergenic
1114152573 14:20060769-20060791 CAGAGTGACCACAATGATGTGGG - Exonic
1114990939 14:28288681-28288703 CAGTGTGAAGATTCTCATGCTGG - Intergenic
1117493003 14:56271153-56271175 CACTGTGCACACTGTGATGTCGG - Intronic
1124010720 15:25836431-25836453 CAGTGTTGCCACTCTGTTGTTGG - Intronic
1127324605 15:57883057-57883079 CATTATGAACACTCTGCTGTGGG + Intergenic
1127984260 15:64057085-64057107 CAGTGAGAGCCCTCTGAAGTTGG - Intronic
1128230811 15:66033681-66033703 CAGTCTGGACACACTGGTGTGGG - Intronic
1129999021 15:80031425-80031447 GAGTGTGAAGACTCTGAGGCAGG + Intergenic
1131305863 15:91242612-91242634 CAGTGTGAAGACTCTGAGGTGGG + Intronic
1134819644 16:17236468-17236490 CAGTGTGGAAAAACTGATGTGGG + Intronic
1137369210 16:47889090-47889112 CTGTCTGAAAACTCTGATGAAGG + Intergenic
1137526055 16:49237346-49237368 TAGTGTGAACACTTTGACATTGG + Intergenic
1138902514 16:61290683-61290705 CAGAGTCAACACTGTTATGTAGG - Intergenic
1139172547 16:64648842-64648864 TAGTGTGATCATTTTGATGTAGG - Intergenic
1140047207 16:71448779-71448801 CTGTGTGAATTCTCTGGTGTTGG + Exonic
1140050378 16:71475574-71475596 CTGTGTGAATACGCTGATGTTGG + Exonic
1140987082 16:80168293-80168315 CAGTGTGATCACAATGCTGTGGG - Intergenic
1142280151 16:89143712-89143734 CAGTGAGACCACTCTCCTGTCGG + Intronic
1142774284 17:2124044-2124066 CAGTGTGTGCAGTCTGATTTGGG - Intronic
1143198182 17:5092983-5093005 TACAGTGAACACTTTGATGTCGG - Exonic
1143210481 17:5183386-5183408 CAGTGTGAATTCTCTGATGTGGG + Exonic
1143343427 17:6232017-6232039 GACTGTGACCACTCTGGTGTTGG - Intergenic
1144487073 17:15675610-15675632 CAGTATGAACCCTCTGATGCTGG - Intronic
1144487084 17:15675694-15675716 CAGTGTGGATCCTCTGATGTTGG - Intronic
1144601807 17:16622476-16622498 CAGTATGAATTCTCTGATGTAGG + Exonic
1144913944 17:18706622-18706644 CAGTGTGGATCCTCTGATGTTGG + Intronic
1144913955 17:18706706-18706728 CAGTATGAACCCTCTGATGCTGG + Intronic
1149031394 17:52086883-52086905 CATTTTGAAGACTCTGTTGTAGG + Intronic
1151030268 17:70729758-70729780 CAGTGTGAGCATTCTGAATTAGG + Intergenic
1151092146 17:71453688-71453710 CAGTGTGAAAACTCTACTTTCGG - Intergenic
1153110635 18:1582151-1582173 CAGAGTGAACACTCCAAGGTTGG + Intergenic
1153658327 18:7304958-7304980 CCGTGTGAACTCCCTGGTGTGGG - Intergenic
1153801374 18:8673569-8673591 TTGTGTGAGCACTCTGATTTTGG - Intergenic
1156015993 18:32547608-32547630 CAGTTTCTACACTGTGATGTAGG - Intergenic
1156240966 18:35253542-35253564 CAGTGTGAATTCTCTGGTGCTGG + Exonic
1156246736 18:35307506-35307528 CAGTGTGGATTCTCTGGTGTAGG - Intergenic
1156481083 18:37436816-37436838 CCCTGTGATCACACTGATGTGGG - Intronic
1156666857 18:39419333-39419355 CAGTTTTAACACACTGATGTTGG - Intergenic
1159082840 18:63754754-63754776 CAGTGTGAAAACAGTGATGGTGG - Intronic
1159778099 18:72626980-72627002 CAGTGTGTACTCTTTCATGTTGG + Intronic
1160557267 18:79734358-79734380 TCGTGTAAACACACTGATGTGGG - Intronic
1162567946 19:11454357-11454379 CAGGGTGAGCACTCTGGGGTGGG - Exonic
1164334875 19:24305597-24305619 CAGTTTGAACACACTGTTTTTGG + Intergenic
1165297956 19:34943710-34943732 CAGTGTGAGTACTCTGATGCCGG - Exonic
1165524302 19:36340400-36340422 CAGTGTGAATACTCTGATGTTGG + Exonic
1165556671 19:36639036-36639058 CAGTATGAATCCTCTGATGTAGG + Exonic
1165567924 19:36747859-36747881 CAGTGTGAACACTCTGATGTCGG + Exonic
1165567970 19:36748363-36748385 CAGTGTGAATTCGCCGATGTTGG + Exonic
1165568020 19:36749035-36749057 CAGTGTGAATTCTGTGATGTTGG + Exonic
1165582245 19:36876980-36877002 CAGTATGAATTCTCTGATGCTGG - Exonic
1165594092 19:36997344-36997366 CAGTATGAGCTCTCTGATGTCGG - Intronic
1165608383 19:37127708-37127730 CAGTATGAACTTTTTGATGTCGG - Exonic
1165608460 19:37128548-37128570 CAGTGTGAAGTCTTTGATGTTGG - Exonic
1165650577 19:37485080-37485102 CAGTATGAATTCTCTGATGTTGG - Exonic
1165666564 19:37635157-37635179 CAGTATGAATACTTTGATGTTGG + Exonic
1165677401 19:37738674-37738696 CAGTATGAATTTTCTGATGTTGG + Exonic
1166576700 19:43847522-43847544 CAGTATGAATTTTCTGATGTTGG - Exonic
1166582337 19:43913400-43913422 CTGTGTGAATCCTCTGATGAAGG + Exonic
1166582502 19:43914706-43914728 CAGTGGGAACTCTCTGATGATGG + Exonic
1166615081 19:44236542-44236564 CCGTGTGGACCCTCTGATGATGG - Exonic
1167535283 19:50046681-50046703 CAGTGTGAATTCTCTGGTGGCGG - Exonic
1167536813 19:50058889-50058911 CAGTGTGGACCTTCTGATGTTGG + Intergenic
1167536824 19:50058973-50058995 CAGTGTGAATCCTTTGGTGTTGG + Intergenic
1167536915 19:50059561-50059583 CAGTGTGAATTCGCTGATGCTGG + Intergenic
1168171686 19:54594124-54594146 CAGTGTGGACACTCGGAGGCTGG - Intronic
1168446665 19:56423510-56423532 CAGTATGAACTCTCTGATGTTGG - Exonic
1168448202 19:56441428-56441450 CAGTGTGAATTCTTTCATGTTGG + Exonic
1168460654 19:56554177-56554199 CAGTGTGACATCTCTGGTGTCGG - Exonic
1168628890 19:57941517-57941539 CAGTATGAACTCTCTGGTGTTGG + Exonic
928314151 2:30232761-30232783 CAGGGTGAAGAGTCTGACGTAGG - Intronic
929673988 2:43905750-43905772 CAGTGTGAAGCCCTTGATGTGGG + Exonic
932293807 2:70607778-70607800 CAGTGTGAAGAGTCTGCTATTGG + Intronic
932727923 2:74195574-74195596 CAGTGTTGACACTCTGACCTTGG + Intergenic
933570903 2:84010528-84010550 CAGTGTTAACTTTCTGATTTTGG - Intergenic
933988219 2:87611860-87611882 CGGTGGGTACAATCTGATGTGGG + Intergenic
934541794 2:95181395-95181417 CAGTGTGAGTCCTCTGATGGCGG - Exonic
935635312 2:105245309-105245331 CAGTCTGAACAAACTGATATAGG - Intergenic
935748139 2:106207389-106207411 CAGTGTGAGTTCTCTGTTGTTGG - Intergenic
936061962 2:109300706-109300728 GAGTGTGCTCAGTCTGATGTTGG - Intronic
936305621 2:111338948-111338970 CGGTGGGTACAATCTGATGTGGG - Intergenic
937959993 2:127450539-127450561 CAGTGAAAACAATGTGATGTTGG - Intronic
938494564 2:131787013-131787035 AAGTTTGAACACTCAGATGCAGG - Intergenic
943760580 2:191603916-191603938 CTTTGTTAAAACTCTGATGTTGG - Intergenic
944397845 2:199289757-199289779 CAGTGAGAACTCTCAGATGTTGG - Intronic
945918304 2:215728161-215728183 CACTTTGAACACTCTGAATTGGG - Intergenic
946460120 2:219861507-219861529 CAGTGCCAACAATCTAATGTTGG + Intergenic
948586003 2:239020214-239020236 CAGTGTGAAGGCCCTGCTGTGGG + Intergenic
1170427349 20:16247864-16247886 CAGCCTGAACACTCTGACCTCGG + Intergenic
1170554204 20:17502832-17502854 GTGTCTGAACACTCTGGTGTGGG - Intronic
1174716339 20:52762696-52762718 CAGTTGGGAGACTCTGATGTAGG + Intergenic
1178452152 21:32712058-32712080 CAATGTCAACATTCTGCTGTGGG + Intronic
1180498756 22:15913100-15913122 AAGTTTGAACACTCAGATGCAGG - Intergenic
1184217140 22:43075279-43075301 CAGGGTGAACACAGTGATGTGGG + Intronic
1184616539 22:45641664-45641686 CAGAGGGAACACACGGATGTAGG + Intergenic
1185168205 22:49275228-49275250 CACTGGGACCACTCTGAAGTTGG + Intergenic
951287261 3:20828445-20828467 CAGTGTGAATACTTTGAGTTCGG - Intergenic
953168578 3:40487170-40487192 TAGTGTGAACTCTCTGATGCAGG - Exonic
953170276 3:40500862-40500884 CAGGGTAAATTCTCTGATGTTGG - Intergenic
953611004 3:44447231-44447253 GAGAGTGAATCCTCTGATGTCGG + Exonic
953611124 3:44448314-44448336 CACTATGAATTCTCTGATGTAGG + Exonic
953642410 3:44721330-44721352 CAGTATGAGTTCTCTGATGTTGG - Exonic
954423349 3:50430391-50430413 CAGTGTGAACAATCTCTTGAAGG - Intronic
956404128 3:68910252-68910274 ATGTGAGAACACTCAGATGTGGG + Intronic
959188305 3:103075630-103075652 CCCTGTAAACACTGTGATGTGGG - Intergenic
960300655 3:115999067-115999089 CAGTATTAACACTCTGAGCTGGG - Intronic
961219875 3:125191378-125191400 CACTGTGAATGCTCTTATGTAGG + Intronic
963841036 3:150106653-150106675 CAGAATGAACACTGTGAGGTAGG + Intergenic
964010920 3:151890507-151890529 CAGTGGGAAAACACTGATATGGG + Intergenic
965634163 3:170764174-170764196 CAGTTTGAGACCTCTGATGTAGG + Intronic
966478862 3:180382449-180382471 AGGTGGGAACACTCTGGTGTAGG + Intergenic
967237400 3:187399294-187399316 TATTGGCAACACTCTGATGTGGG + Intergenic
967373467 3:188774662-188774684 CAGTGCTAACACCCTGATCTCGG - Intronic
968155445 3:196377324-196377346 CAGTGTGAGCATACTGATGTTGG - Intronic
968888624 4:3353311-3353333 CAGTGTGCACACACTGATCTAGG - Intronic
971272811 4:25166578-25166600 CAGTGTGAAGACCTTCATGTGGG - Intronic
974602001 4:64095364-64095386 CAGTGTGAACAGTTTGAGATTGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
980576645 4:134691033-134691055 AAGAGTGTACACTTTGATGTAGG + Intergenic
981011311 4:139928130-139928152 CAGCATGAACCCTGTGATGTTGG - Intronic
983315549 4:166128300-166128322 CAGTGTGCATAATCTTATGTTGG - Intergenic
985484748 5:141787-141809 AAATGTGAACATACTGATGTAGG + Intronic
985782908 5:1880374-1880396 CAGTGTGGACACTCGGAAGGAGG + Intronic
985965024 5:3333057-3333079 CACTGTGCCCACTCTGATGAAGG + Intergenic
986848711 5:11785213-11785235 AAATGTGAACACTATAATGTTGG - Intronic
988717633 5:33843620-33843642 CAGAATGAATACTATGATGTTGG + Intronic
989107250 5:37875089-37875111 CACTGCCAACAGTCTGATGTGGG - Intergenic
989736303 5:44711242-44711264 CAGTCTGAACCCTCTGTTATTGG - Intergenic
991189630 5:63854517-63854539 CAGGGTCAACACACTGATGGAGG - Intergenic
994728356 5:103462844-103462866 CAGTGTGAATGCTGTGAGGTGGG - Intergenic
996142094 5:119923953-119923975 CACTGTCAACACTCTGATGGGGG + Intergenic
998001487 5:138629444-138629466 CTTTCTGAACACTCTGAGGTGGG + Intronic
998633054 5:143922107-143922129 CAGAATGAACACTGTGAAGTAGG - Intergenic
998987538 5:147777289-147777311 AAGTGTGAACACTCTCAAGTGGG + Intronic
1000828660 5:166076908-166076930 TATTTTGAACCCTCTGATGTTGG - Intergenic
1000987343 5:167875303-167875325 AAGTGTGAAGACTCTGAAGGTGG + Intronic
1001297985 5:170512265-170512287 CCGTGTGAAAACTCTGATCCTGG - Intronic
1002393197 5:178932171-178932193 CAGTGTGATTTCGCTGATGTAGG - Exonic
1002397021 5:178965688-178965710 CAGTATGAATTCTCTGATGTTGG - Exonic
1004275039 6:14228659-14228681 CAAGCTGCACACTCTGATGTGGG + Intergenic
1005018598 6:21396642-21396664 CATTGTTAACATTCTGATTTTGG + Intergenic
1005679175 6:28188646-28188668 CAGTGTGGATTCTCTGGTGTTGG - Intergenic
1005700012 6:28391230-28391252 CTGTGTGAAGTCTCTGATGTTGG + Exonic
1005925564 6:30442431-30442453 CAGAGTGAACTTTCTAATGTTGG - Intergenic
1006247711 6:32754805-32754827 CACTGTGACCCCTTTGATGTGGG - Intergenic
1007654691 6:43445121-43445143 CAGTGGGAACACTGGGATGCTGG - Exonic
1007816966 6:44531495-44531517 CAGAGTGAAACCTCTGATGAAGG - Intergenic
1009410851 6:63363118-63363140 CAGTGAGAACACTCAGCTGCAGG - Intergenic
1014666847 6:124248835-124248857 CTGTGTTAGCACACTGATGTCGG - Intronic
1017392658 6:153958283-153958305 CAGAGTGAACAGGCTGATGGGGG + Intergenic
1018424700 6:163669829-163669851 CAGTGTGAACCCTCAGGAGTAGG + Intergenic
1019348184 7:540705-540727 CACAGGGAACACTCAGATGTTGG - Intergenic
1025148470 7:56525527-56525549 CAGTATTAATTCTCTGATGTTGG + Intergenic
1026042368 7:66878697-66878719 CAGTTTAAAGACTCTGATATAGG - Intergenic
1026083986 7:67247816-67247838 ATGTGGGAACACTGTGATGTTGG + Intergenic
1026693046 7:72566211-72566233 ATGTGGGAACACTGTGATGTTGG - Intronic
1027918270 7:84355695-84355717 AAGTGGGAACAATATGATGTGGG - Intronic
1028682368 7:93551224-93551246 CAGTGTTAACACTCTGTTAATGG - Intronic
1028862474 7:95668597-95668619 CATTGTAACCACTCTGCTGTAGG - Intergenic
1029358601 7:100071562-100071584 CAGTGTGGATTCTCTGATGGTGG + Exonic
1031007290 7:116487919-116487941 CAGTGTGAACATTCTGCAATTGG - Intronic
1032444781 7:131972880-131972902 CAGAGTGATCACTAAGATGTGGG - Intergenic
1033899677 7:146120889-146120911 GAGTGTGTACTCTATGATGTTGG + Intronic
1036573732 8:10004841-10004863 CAGTATTAACATTCTGATGCTGG - Intergenic
1040375581 8:46821757-46821779 GAGTGAAAACACTCAGATGTTGG - Intergenic
1040684054 8:49849182-49849204 GAGTGTGCATGCTCTGATGTTGG - Intergenic
1041144887 8:54864102-54864124 CAGTGTCAACACTTTCATGGTGG - Intergenic
1043909939 8:85852319-85852341 TTTTGTGAACACTCTGATTTTGG - Intergenic
1048869102 8:138782741-138782763 AAGTGTGCACACTCTGCTGTGGG + Intronic
1049630319 8:143650961-143650983 CAGTGTGAATTCTCTGATGCTGG - Exonic
1049834082 8:144722207-144722229 CAGTGTGAACTCGCTGATGTAGG + Exonic
1049841207 8:144773706-144773728 CAGTGTGAATTCTCTGATGTTGG + Exonic
1049858645 8:144881859-144881881 CAGTGTGGACTCTCTGGTGCTGG + Exonic
1049865194 8:144930830-144930852 CAGTGTGAATCCTCTGGTGCTGG + Exonic
1049871019 8:144976457-144976479 CAGTGTGAATTCTCTTGTGTTGG + Intergenic
1049871026 8:144976541-144976563 CAGTGTGAATTCTCTGATGTTGG + Intergenic
1049871040 8:144976709-144976731 CAGTGTGAATTCTTTGATGGTGG + Intergenic
1049871093 8:144977213-144977235 CAGTGTGAATTCTCTGATGCTGG + Intergenic
1050777298 9:9281559-9281581 CATTGTGGACACTCTAATATAGG - Intronic
1051456309 9:17262814-17262836 CAGTATGATCAGTATGATGTTGG + Intronic
1053355426 9:37441599-37441621 CAGTGTGAAAACCCTGAGGTTGG - Exonic
1053648802 9:40142223-40142245 AAGTTTGAACACTCAGATGCAGG - Intergenic
1053756942 9:41321619-41321641 AAGTTTGAACACTCAGATGCAGG + Intergenic
1054535780 9:66233947-66233969 AAGTTTGAACACTCAGATGCAGG + Intergenic
1058825930 9:108775994-108776016 CAGTGTGGAAGCTCAGATGTTGG - Intergenic
1059109579 9:111542720-111542742 CAGTGTGAATTCTCTGATGCCGG - Exonic
1059602206 9:115791212-115791234 CAGTGTGGCTATTCTGATGTGGG - Intergenic
1059888569 9:118774945-118774967 GAGTGTGAACACTCAGAAGCTGG + Intergenic
1059894881 9:118851784-118851806 CAATGTGAACACAATGATGAAGG + Intergenic
1059924415 9:119193980-119194002 CAGTCTGGCCACTCTGCTGTAGG + Intronic
1062236040 9:135508097-135508119 CAGTGCGTACACGCTGTTGTGGG - Intergenic
1062683070 9:137794069-137794091 GAGTGTGATCACTTTGTTGTTGG - Intronic
1188205736 X:27355389-27355411 CAATGTGAATATCCTGATGTAGG + Intergenic
1192012804 X:67293413-67293435 CAGTGGGATGAATCTGATGTTGG - Intergenic
1195881711 X:109599949-109599971 CAGTGTTAACAGTTTGATGTGGG - Intergenic
1198735389 X:139779061-139779083 CAATCTGGGCACTCTGATGTTGG - Intronic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1200038320 X:153347360-153347382 AAGTGTGAAGTTTCTGATGTCGG - Exonic
1200784316 Y:7246328-7246350 CAGTGAGAACACCTGGATGTTGG - Intergenic
1202250547 Y:22866597-22866619 CAGTATTAAGTCTCTGATGTTGG + Intergenic
1202403536 Y:24500346-24500368 CAGTATTAAGTCTCTGATGTTGG + Intergenic
1202467243 Y:25169736-25169758 CAGTATTAAGTCTCTGATGTTGG - Intergenic