ID: 1165568029

View in Genome Browser
Species Human (GRCh38)
Location 19:36749118-36749140
Sequence CAACATCAACAAATCCATAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 2, 2: 8, 3: 95, 4: 407}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165568029_1165568030 3 Left 1165568029 19:36749118-36749140 CCAGTATGGATTTGTTGATGTTG 0: 1
1: 2
2: 8
3: 95
4: 407
Right 1165568030 19:36749144-36749166 AAGTCGTAAACGAAGTCTAAAGG 0: 1
1: 0
2: 0
3: 2
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165568029 Original CRISPR CAACATCAACAAATCCATAC TGG (reversed) Exonic
901326677 1:8370525-8370547 AAACAACAACAAATCCAGGCCGG + Intronic
906197819 1:43939892-43939914 CAAGCTTAACATATCCATACTGG + Intergenic
906837576 1:49100493-49100515 CAAGATCACCAAATCCGGACTGG + Intronic
906902030 1:49845545-49845567 AAACACCAGCAAATCCACACAGG + Intronic
909961533 1:81850804-81850826 CAACAACAACAAAGCCTTACAGG - Intronic
911550570 1:99274577-99274599 CAACAACAACAAATATTTACTGG + Intronic
912272157 1:108222275-108222297 TAACATCAACAAAGAAATACAGG + Intergenic
912745483 1:112242283-112242305 CAACAACAACAAACTCACACTGG + Intergenic
914146371 1:144998702-144998724 CATCTTCAAAGAATCCATACAGG + Intronic
914371101 1:147025048-147025070 CCACAACAACAAACTCATACTGG + Intergenic
915248180 1:154570587-154570609 CCACATCATCAAATACATACTGG - Intronic
915726849 1:158024243-158024265 CAACAACAACAAAACCAGGCCGG - Intronic
915873474 1:159587302-159587324 CAACATCAAGTAATACATCCAGG - Intergenic
916140919 1:161696995-161697017 CAACATACACAAATCAATAAAGG + Intergenic
918304458 1:183233391-183233413 CTACATCAAGAAAATCATACTGG - Intronic
918592796 1:186258897-186258919 CAACATACACAAATCAATAAAGG - Intergenic
918612472 1:186508694-186508716 CAACATATACAAATCAATAAAGG - Intergenic
919166745 1:193905193-193905215 CAACAACAACAAAAACCTACTGG + Intergenic
921070386 1:211653421-211653443 CAACAACAACAAAAACACACTGG - Intergenic
922139310 1:222866313-222866335 CAACAACAACAAAACTATCCCGG - Intergenic
922877896 1:228954781-228954803 TACCAACAGCAAATCCATACAGG - Intergenic
924536239 1:244938121-244938143 CAACAACAACAAACAGATACTGG - Intergenic
1063573189 10:7235951-7235973 CAACATCAACAGCTCCAGATAGG + Intronic
1066426369 10:35311324-35311346 CAACAACAACAAAAAAATACAGG + Intronic
1066637442 10:37519936-37519958 CAACAACAACAAAACCAAAATGG - Intergenic
1066676700 10:37895455-37895477 AAACATCAAAGAATCCATACAGG + Intergenic
1066700066 10:38118097-38118119 AAACATCAAAGAATTCATACAGG + Exonic
1067122113 10:43482210-43482232 CAACATCAAGAAACACATATAGG + Exonic
1067136862 10:43616902-43616924 GAACATCAGAAAATCCATACTGG + Exonic
1067300470 10:45003582-45003604 CAACACCAGAAGATCCATACTGG + Exonic
1067300479 10:45003666-45003688 CAGCATCGACGGATCCATACGGG + Exonic
1067664770 10:48267934-48267956 CAGAATAAACAAATCCATAGAGG + Intronic
1068482280 10:57607344-57607366 CAACATCATCAAAAGCATAAGGG + Intergenic
1069353991 10:67562331-67562353 CAACATACACAAATCAATAAAGG + Intronic
1070936300 10:80298892-80298914 CAACATCAGAAAATCCATACTGG + Intergenic
1071074936 10:81738744-81738766 CAACATACACAAATCAATAAAGG + Intergenic
1071213880 10:83376196-83376218 CAACATATGCAAATCCATAAAGG + Intergenic
1071852625 10:89590194-89590216 CACCACAAACAAATCCAAACGGG + Intronic
1071880739 10:89895325-89895347 CAAAGTCAACAAATAAATACTGG - Intergenic
1072545991 10:96439506-96439528 TAGCAGCAGCAAATCCATACAGG - Intronic
1073915130 10:108394178-108394200 AAACAAGAACAAATCCAGACAGG + Intergenic
1074706557 10:116138099-116138121 CACCATTAAAAAATACATACAGG - Intronic
1074809728 10:117091690-117091712 CAGCATGAGCAAATGCATACTGG - Intronic
1075467076 10:122659635-122659657 CTACATCAATAATTTCATACAGG + Intergenic
1078599417 11:12717061-12717083 GAAGATCTACAAATCCATGCAGG - Intronic
1078916761 11:15785615-15785637 CAACATCCACAAAGCCATGGAGG + Intergenic
1080097432 11:28425745-28425767 CAACAACAAAAAATATATACAGG - Intergenic
1080128973 11:28770711-28770733 CAAGCCCAACAAAACCATACAGG + Intergenic
1084307100 11:68293144-68293166 CAATATCCACAAATCCATGTTGG + Intergenic
1085316817 11:75550272-75550294 CAACAACAACAAATCTTTGCTGG + Intergenic
1090694049 11:129218742-129218764 CAACAACAACAAAACTATTCAGG + Intronic
1094743633 12:33317334-33317356 CAACAATAAAAAATCAATACAGG - Intergenic
1095426883 12:42084381-42084403 TTACATAAACAAATTCATACTGG + Exonic
1095853582 12:46836700-46836722 CAACAACAACAAATCAACAAAGG - Intergenic
1096130989 12:49158853-49158875 CATCAGCAGTAAATCCATACAGG + Intergenic
1098322417 12:69259028-69259050 CACCACCAACAGATCCATATGGG + Exonic
1099336768 12:81370577-81370599 CCACAGCAACAAATCAATGCAGG - Intronic
1099339071 12:81404074-81404096 TAGCAGCAGCAAATCCATACAGG - Intronic
1101801656 12:108027712-108027734 CTACATCAACAAATGCAGGCAGG + Intergenic
1101880856 12:108624508-108624530 CAACATGAATAAAGCCATCCAGG + Intronic
1102652610 12:114452873-114452895 CAACAACAAAACATACATACAGG - Intergenic
1102776862 12:115527264-115527286 CTAATTCAACAAATACATACTGG - Intergenic
1106276158 13:28209554-28209576 CCACATGACCAAATCCCTACTGG + Intronic
1107510300 13:41077010-41077032 CAACAACAACAAAAAAATACAGG + Intronic
1109317044 13:60762240-60762262 CAACATACACAAATCAATAAAGG - Intergenic
1109486445 13:63027674-63027696 CAACAACAACAAAAAAATACGGG + Intergenic
1109547648 13:63848451-63848473 AATCATCAACAAATCCCCACAGG - Intergenic
1109993648 13:70092341-70092363 CAACATGAACAAAGTCATATAGG - Intronic
1111235015 13:85398476-85398498 AAAGAGCAACAAATCCATAAGGG - Intergenic
1111401052 13:87735395-87735417 AAACATCAGCAAACCCAGACAGG - Intergenic
1111482798 13:88853848-88853870 CAAAATCAACAAATACAAATCGG + Intergenic
1112263470 13:97900132-97900154 CACCGTGAACACATCCATACTGG + Intergenic
1112528554 13:100178181-100178203 CAACATCGAAATAACCATACAGG - Intronic
1114830078 14:26129997-26130019 CAACAACAAAAAAGCCATTCGGG - Intergenic
1116552892 14:46265094-46265116 CAACATACACAAATCAATAAAGG + Intergenic
1117456098 14:55898358-55898380 CAGCATCACAAAATCCAGACAGG - Intergenic
1118330400 14:64810696-64810718 CAACAACAACAAATCAATCATGG + Intronic
1118797373 14:69155037-69155059 CAAACTCAACATATCCAAACCGG - Intergenic
1120726049 14:87942617-87942639 AAACACCAAGAAATCCATTCTGG + Intronic
1122215430 14:100200507-100200529 CAGAATCAACAAATCCATAGAGG - Intergenic
1122451461 14:101811895-101811917 CAACAGCAACAAATACAAACTGG - Intronic
1122838080 14:104441163-104441185 CAACACCCACAAATCCATGGTGG + Intergenic
1123214875 14:106798870-106798892 CAACATACACAAATCAATAAAGG - Intergenic
1123502367 15:20900998-20901020 CAACATCAGAGAATACATACTGG - Intergenic
1123502378 15:20901167-20901189 TAACATCAGAGAATCCATACTGG - Intergenic
1123502385 15:20901251-20901273 CAACATCAGAGAATCCATACTGG - Intergenic
1123559617 15:21474682-21474704 CAACATCAGAGAATACATACTGG - Intergenic
1123559628 15:21474851-21474873 TAACATCAGAGAATCCATACTGG - Intergenic
1123559635 15:21474935-21474957 CAACATCAGAGAATCCATACTGG - Intergenic
1123595853 15:21911979-21912001 CAACATCAGAGAATACATACTGG - Intergenic
1123595864 15:21912148-21912170 TAACATCAGATAATCCATACTGG - Intergenic
1123595871 15:21912232-21912254 CAACATCAGAGAATCCATACTGG - Intergenic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1124393590 15:29281567-29281589 CCACATCAACACATCGAAACTGG + Intronic
1125139617 15:36389385-36389407 CAACATCAGCAATCCCACACAGG - Intergenic
1125293127 15:38171955-38171977 CAACAACAACAACTCCAGTCAGG + Intergenic
1126127792 15:45311789-45311811 CAACAACAACAAACCCTAACAGG + Intergenic
1128287026 15:66445758-66445780 GAATAACAACAAATCCATAGTGG + Intronic
1202967962 15_KI270727v1_random:201842-201864 CAACATCAGAGAATACATACTGG - Intergenic
1202967973 15_KI270727v1_random:202011-202033 TAACATCAGAGAATCCATACTGG - Intergenic
1202967980 15_KI270727v1_random:202095-202117 CAACATCAGAGAATCCATACTGG - Intergenic
1133465548 16:6023710-6023732 CATCATCCACAAATTAATACTGG + Intronic
1135906245 16:26514444-26514466 CAATATAAACATATACATACAGG - Intergenic
1136644719 16:31602430-31602452 CAACATCAAATAATTCATACTGG - Intergenic
1136660455 16:31754844-31754866 CAACATCAAATAATTCATACTGG + Intronic
1136660483 16:31755348-31755370 CAACATCAAAGAATTCATACCGG + Intronic
1136676718 16:31915774-31915796 CAACATCGGAAAATTCATACTGG + Exonic
1136676727 16:31915942-31915964 CGACATCATCGAATTCATACTGG + Exonic
1136866087 16:33755871-33755893 CCACATGAATAAATCCATAAAGG + Intergenic
1137810006 16:51343717-51343739 AAATATCCACAAACCCATACTGG + Intergenic
1138995800 16:62451707-62451729 AACCATCAGCTAATCCATACAGG + Intergenic
1139139204 16:64240532-64240554 AAACAACAACAAAACCACACAGG + Intergenic
1140047178 16:71448526-71448548 GATCATCACCGAATCCATACTGG - Exonic
1140047230 16:71449030-71449052 CAACATCAGAGAATCCATACTGG - Exonic
1140050358 16:71475321-71475343 CAGCATCAAAGAATCCATACTGG - Exonic
1140812948 16:78595629-78595651 CATCATCAAGACATCCACACTGG - Intronic
1141402026 16:83757279-83757301 CAAAATCAACAAATCCAGGCTGG + Intronic
1144248495 17:13392349-13392371 AAACATCCACAAATTCCTACTGG - Intergenic
1144594152 17:16552547-16552569 CAGCATCAAAAAATACATACTGG - Exonic
1144601828 17:16622643-16622665 GAACATCAGAAAATCCATAGTGG - Exonic
1146456816 17:33015159-33015181 TAATATCAACAAATCCAAAATGG - Intronic
1147763827 17:42819364-42819386 CTACAGGAAAAAATCCATACTGG + Intronic
1148584356 17:48766912-48766934 CAACAACAACAAAAACATACGGG - Intronic
1150316779 17:64175569-64175591 CAACACCAACAAAACCAAACTGG - Intronic
1151176623 17:72294010-72294032 CAACATCAATAAATGCAACCAGG + Intergenic
1152828863 17:82485009-82485031 CCACATGCACAGATCCATACAGG - Intronic
1153454530 18:5265516-5265538 CAACATACACAAATCAATAAAGG + Intergenic
1154407240 18:14104837-14104859 CAACATTAGAAAATCAATACTGG - Exonic
1154407253 18:14105005-14105027 CAACATCAGAGAATTCATACTGG - Exonic
1154407259 18:14105089-14105111 CAACATCAGAGAGTCCATACTGG - Exonic
1154407266 18:14105173-14105195 CGACATCAAAGAATCCATACTGG - Exonic
1154407274 18:14105257-14105279 CAACATCAGAGAATCCATACTGG - Exonic
1154407287 18:14105425-14105447 CAACACCAGAGAATCCATACCGG - Exonic
1154407296 18:14105509-14105531 CAACATCAGAGAATCCATACTGG - Exonic
1154407303 18:14105593-14105615 CAACATCAGAGAATCCATACTGG - Exonic
1154466311 18:14645307-14645329 AAACAGCAACCAATCCATTCTGG - Intergenic
1155309171 18:24507417-24507439 CAACATCAAAGAACCCATATTGG - Intergenic
1155792553 18:29992487-29992509 CAATATTAACAAAACCATTCTGG - Intergenic
1156240130 18:35245609-35245631 CAACATCAGAGAATCCATACTGG + Exonic
1156246667 18:35306502-35306524 AAACATCAGAGAATCCATACTGG + Intergenic
1156246671 18:35306582-35306604 AAACATCAAAGAATCCACACTGG + Intergenic
1156252942 18:35369315-35369337 CAGCATCGACGAACCCATACTGG - Exonic
1156985158 18:43342070-43342092 CAACACCAACAAAGGCTTACTGG - Intergenic
1158143900 18:54288734-54288756 CAAAACCAACAAATCACTACAGG - Intronic
1160369898 18:78363378-78363400 CAACAACAACAAATCCATCGCGG + Intergenic
1162239917 19:9342811-9342833 CAACATAAAAGAATACATACAGG + Exonic
1163930511 19:20386077-20386099 CAACTTAAACAAATCCCTTCAGG - Intergenic
1163971925 19:20806672-20806694 AAACATAAAATAATCCATACTGG + Exonic
1163989979 19:20989133-20989155 CAACATCAACAAAAACATAAAGG + Intergenic
1164045611 19:21537209-21537231 CGACATAAAAAAATTCATACTGG + Exonic
1164045646 19:21537629-21537651 CAACATAAGAAAATTCATACTGG + Exonic
1164045652 19:21537713-21537735 CAACATAAGAAAATTCATACTGG + Exonic
1164067162 19:21726620-21726642 AAACATAAAAAAATTCATACTGG - Exonic
1164104067 19:22089176-22089198 CAACATAAAATAATTCATACTGG + Exonic
1164174342 19:22756302-22756324 CAACATAAAACAATTCATACTGG - Intronic
1164215776 19:23145612-23145634 CAACATAAAAAAATTCATACTGG + Exonic
1164269013 19:23653254-23653276 AAACATAAAAAAATACATACTGG - Exonic
1165182765 19:33987026-33987048 GAGCAGCAGCAAATCCATACAGG - Intergenic
1165251694 19:34542715-34542737 CAACATCACAGAATTCATACTGG - Intergenic
1165251714 19:34543062-34543084 CACCATCAGAAAATCCATACTGG - Intergenic
1165268700 19:34685025-34685047 CACCATCAGAAAAGCCATACTGG + Exonic
1165274969 19:34741477-34741499 CACCATCAGAAAATCCATACTGG + Exonic
1165274991 19:34741813-34741835 CAACATCACAGAATTCATACTGG + Exonic
1165278828 19:34779648-34779670 CAGCATCAGCAAATCCACATTGG - Intergenic
1165298051 19:34944551-34944573 CAGCATCAAAGAATTCATACTGG + Exonic
1165500163 19:36182722-36182744 CAACATCAAAGAATTCATACAGG - Exonic
1165500237 19:36183394-36183416 CAACATCAGAAAATTCACACTGG - Exonic
1165536291 19:36449230-36449252 AAACATCAAAGAATCCATACAGG - Exonic
1165536299 19:36449314-36449336 CAACATCAGAGAATTCATACTGG - Exonic
1165536322 19:36449566-36449588 CATCATCAGAAAATTCATACTGG - Exonic
1165543649 19:36514676-36514698 AAACATCAGAACATCCATACTGG - Exonic
1165543682 19:36515171-36515193 CAGCATGATCAAATTCATACTGG - Exonic
1165546984 19:36547137-36547159 CAACATCAAAGAATTCATAGTGG - Exonic
1165556657 19:36638867-36638889 CAACATCAAAGAATTCATACTGG - Exonic
1165565168 19:36719868-36719890 CTACATCAGAGAATCCATACAGG + Exonic
1165567933 19:36747942-36747964 CAACATAAACGAATCCATACTGG - Exonic
1165567962 19:36748278-36748300 CAACATCAACGAATCCATACTGG - Exonic
1165567991 19:36748698-36748720 CAACATCAGCAAATACACACTGG - Exonic
1165567997 19:36748782-36748804 CAACATCAGCAAATTCACACTGG - Exonic
1165568029 19:36749118-36749140 CAACATCAACAAATCCATACTGG - Exonic
1165568036 19:36749202-36749224 CAACATCAGCAAATTCACACTGG - Exonic
1165568042 19:36749286-36749308 CAACATCAGCGAATTCACACTGG - Exonic
1165568055 19:36749454-36749476 CAACATCAGCGAATTCACACTGG - Exonic
1165568076 19:36749706-36749728 CAACATCAGCGAATTCACACTGG - Exonic
1165568108 19:36750126-36750148 CAACATCAGCAAATTCACACTGG - Exonic
1165568137 19:36750462-36750484 CAACAGCAAGAAACCCATACTGG - Exonic
1165576011 19:36818923-36818945 CGACATCAGAAAATTCATACTGG - Exonic
1165576024 19:36819091-36819113 CGACATCAGCGAATTCATACTGG - Exonic
1165582252 19:36877065-36877087 CGACATCAGCGAATTCATACTGG + Exonic
1165582316 19:36877653-36877675 CGACATCAAAGAATTCATACTGG + Exonic
1165582329 19:36877821-36877843 CAGCATCAAAGAATGCATACTGG + Exonic
1165582337 19:36877905-36877927 CAACATCACAGAATTCATACTGG + Exonic
1165582348 19:36877989-36878011 CAACACCAGCTAATCCATACTGG + Exonic
1165594056 19:36997009-36997031 CGACATCAAAGAATCCATACGGG + Intronic
1165594072 19:36997177-36997199 CTACATCAAAGAATTCATACTGG + Intronic
1165594131 19:36997681-36997703 CAACATCAAAGAATTCATTCAGG + Intronic
1165608362 19:37127457-37127479 CAACATCAAAGTATTCATACTGG + Exonic
1165608384 19:37127709-37127731 CGACATCAAAAAGTTCATACTGG + Exonic
1165608401 19:37127961-37127983 CAACATCAGAAAATTCATAATGG + Exonic
1165608454 19:37128465-37128487 CAACATCAGAGAATCCATACTGG + Exonic
1165608468 19:37128633-37128655 CAACATCAGAGAATTCATACTGG + Exonic
1165608475 19:37128717-37128739 CAACATCAGCGAATTCACACTGG + Exonic
1165608483 19:37128801-37128823 CTACATCAGAGAATCCATACTGG + Exonic
1165620521 19:37242963-37242985 CAACATCAGAGAATCCATACCGG + Exonic
1165620545 19:37243215-37243237 CAACATCAGAGAATTCATACTGG + Exonic
1165641271 19:37389424-37389446 CAACATCAGAGAATTCATACCGG + Exonic
1165641291 19:37389676-37389698 CAACATCAAAGAATTCATACTGG + Exonic
1165650554 19:37484829-37484851 CAACATCAGAGAATTCATACTGG + Exonic
1165650569 19:37484997-37485019 CAACATCAGCGAGTTCATACTGG + Exonic
1165650578 19:37485081-37485103 CAACATCAGAGAATTCATACTGG + Exonic
1165659602 19:37565184-37565206 CAACATCAAAGAATTCATACCGG - Exonic
1165664170 19:37612142-37612164 CAACATAAAAGAATTCATACTGG + Exonic
1165664242 19:37612982-37613004 GAACATCAGAAAATTCATACGGG + Exonic
1165666563 19:37635156-37635178 CAACATCAAAGTATTCATACTGG - Exonic
1165669967 19:37668475-37668497 CAACATCAAAGAATTCCTACTGG - Exonic
1165669990 19:37668721-37668743 CAACATCAAAATATTCATACTGG - Exonic
1165670040 19:37669476-37669498 CAACATCAAAGAATTCATACTGG - Exonic
1165670057 19:37669811-37669833 CGACATCAAAGAATTCATACTGG - Exonic
1165677400 19:37738673-37738695 CAACATCAGAAAATTCATACTGG - Exonic
1165677420 19:37738925-37738947 CAACATCAGAAAATTCATACTGG - Exonic
1165677439 19:37739177-37739199 CAACATCAGAAAATTCATACTGG - Exonic
1165677448 19:37739261-37739283 CAACATCAGAAAACTCATACTGG - Exonic
1166019607 19:40014306-40014328 GAACATCAAAGAATTCATACTGG + Exonic
1166019615 19:40014390-40014412 CAACATCAGAAAATTCATACTGG + Exonic
1166019624 19:40014474-40014496 CAACATCAGAAAATTCATACTGG + Exonic
1166019684 19:40015230-40015252 CAACATCACAGAATTCATACTGG + Exonic
1166021554 19:40035453-40035475 CAACATTGCCAAATTCATACTGG - Exonic
1166576701 19:43847523-43847545 CAACATCAGAAAATTCATACTGG + Exonic
1166576718 19:43847691-43847713 CAGCATCAGAAAATCCATACTGG + Exonic
1166576734 19:43847859-43847881 CAACATGAAAGAATTCATACTGG + Exonic
1166576741 19:43847943-43847965 CAACATCAGAAAATCCATACTGG + Exonic
1166576770 19:43848195-43848217 CAACATGAAAGAATCCATACAGG + Exonic
1166576781 19:43848279-43848301 CAACATCAGAAAATTCATACCGG + Exonic
1166587782 19:43966397-43966419 GAACATCAGAGAATCCATACTGG + Exonic
1166589003 19:43978979-43979001 AAACAACAACAAATCTATCCAGG - Intronic
1166600122 19:44086304-44086326 GAACATCAAAGAATCCATACTGG + Exonic
1166602233 19:44106989-44107011 GAACATCAGAGAATCCATACGGG + Exonic
1166604795 19:44131443-44131465 GAACATCAAAGAATCCATACTGG + Exonic
1166618623 19:44274317-44274339 GACCATCAGCAAGTCCATACTGG + Exonic
1166903472 19:46085890-46085912 CAACAACAAAGAAACCATACAGG + Intergenic
1167819648 19:51915430-51915452 TTACATCAAAAAATCCATACCGG - Intronic
1167832267 19:52034489-52034511 GAACATCAACGAACTCATACAGG - Exonic
1167865426 19:52322328-52322350 CGACATCAGAAAATTCATACTGG + Exonic
1167870555 19:52366207-52366229 CGACATCAAAGAATTCATACTGG + Exonic
1167872528 19:52384265-52384287 CAACATCAAAGAATTCATACTGG + Exonic
1167872557 19:52384685-52384707 AGACATCAAAGAATCCATACTGG + Exonic
1167876279 19:52415624-52415646 CAACATCAAAGAATTCATACTGG + Exonic
1167876282 19:52415708-52415730 CAACATCAAAGAATTCATACTGG + Exonic
1167876286 19:52415792-52415814 CGACATCAAAAAATTCATACTGG + Exonic
1167878857 19:52438151-52438173 CAACATCAACGAATCCATACTGG + Exonic
1167878862 19:52438235-52438257 CAACATCAGAAAATTCATACTGG + Exonic
1167882702 19:52474819-52474841 CAACATCGAAGAATTCATACTGG - Intronic
1167899991 19:52613375-52613397 CAACATCACAGAATCCATACTGG - Exonic
1167900017 19:52613711-52613733 CAACATCAGAGAATCCACACTGG - Exonic
1167900037 19:52613963-52613985 CAACATCAAAGAATTCATACCGG - Exonic
1167935761 19:52905846-52905868 AGACATCAAAGAATCCATACTGG - Intergenic
1167965472 19:53141806-53141828 CAACATCAGAAAATTCACACTGG - Exonic
1167977110 19:53237195-53237217 CAGCATAAGAAAATCCATACTGG - Exonic
1167977133 19:53237531-53237553 CAACATAAGAGAATCCATACTGG - Exonic
1168016399 19:53577002-53577024 CAACATCAGAAAATCCATACTGG + Exonic
1168016408 19:53577086-53577108 CAACATCAAAAAATTCATACTGG + Exonic
1168442014 19:56377094-56377116 CAGCATCAAAGAATCCACACGGG + Intronic
1168446716 19:56424099-56424121 CAACATCAGAGAATTCATACTGG + Exonic
1168448220 19:56441595-56441617 GAACATCAAAGAATTCATACTGG - Exonic
1168457482 19:56524902-56524924 CAGCATCAAAGAATTCATACTGG + Exonic
1168457543 19:56525661-56525683 CAACATCAGAAAACTCATACAGG + Exonic
1168457550 19:56525745-56525767 CAACATCAAAGAATTCATACTGG + Exonic
1168460715 19:56554769-56554791 CAGCATCAGAAAACCCATACAGG + Exonic
1168460760 19:56555273-56555295 CATCATCAGCGAATTCATACTGG + Exonic
1168463089 19:56578005-56578027 CAACATCAGAAAATACACACTGG + Exonic
1168463139 19:56578509-56578531 CATCATCAGCGAATTCATACCGG + Exonic
1168528942 19:57111327-57111349 CAACACCAGGAAATCCATAGTGG - Intergenic
1168531717 19:57135177-57135199 CAACATAAAAAAATCCATACTGG - Exonic
1168557732 19:57357343-57357365 CAACACCAAAAAATCCACACTGG + Exonic
1168574055 19:57493467-57493489 CAGCATCACAAAATCCACACTGG + Exonic
1168574077 19:57493719-57493741 CAACATCAAAAAGTTCACACTGG + Exonic
1168587624 19:57606459-57606481 CAACATCAACGAGTTCACACTGG + Exonic
1168589480 19:57620780-57620802 CAGCATCAGAGAATCCATACTGG + Exonic
1168605321 19:57754475-57754497 CAACATCAGCAGATCCACTCTGG + Exonic
1168616500 19:57841533-57841555 CAACATCAGCAATTTCACACTGG + Exonic
1168618699 19:57859265-57859287 CAACATCAGCGAGTCCACACTGG + Exonic
1168624807 19:57909403-57909425 CAACATCAGCGAGTCCACACTGG - Exonic
1168647291 19:58067931-58067953 CAACACCAGCGAATCCACACAGG + Exonic
1168647303 19:58068015-58068037 AAACATCAGCGAATCCACACTGG + Exonic
1168653373 19:58108520-58108542 GTACATCAAAAAATCCACACAGG - Intronic
929015505 2:37489782-37489804 CAACATTCACAAAGCCATAAGGG - Intergenic
930859992 2:56061951-56061973 CAACATACACAAATCAATAAAGG - Intergenic
931096868 2:58950372-58950394 CAACATCAAGAAACACATAAGGG - Intergenic
933777905 2:85782669-85782691 CAACAACAACAAATAAATACTGG - Intronic
934545810 2:95214998-95215020 CAACATCAGCGAATTCATACTGG + Exonic
936170841 2:110172309-110172331 CAATATCAACAAAGCCAAACTGG - Intronic
937151827 2:119691530-119691552 CAACATCAATAAAACCGTACTGG - Intergenic
938061339 2:128257176-128257198 CAACAACAACAAAACAATATAGG + Intronic
939080933 2:137661513-137661535 CAGCAGCAGCGAATCCATACAGG + Intronic
940006147 2:149010883-149010905 CAAAATGCCCAAATCCATACAGG - Intronic
941578530 2:167266793-167266815 TAACAACAACAAATCAATGCAGG - Intergenic
941887241 2:170540691-170540713 CAACAACAACAACTCTATAAAGG + Intronic
943516196 2:188890339-188890361 CTAAATCAACAAATACCTACAGG + Intergenic
944963057 2:204898661-204898683 GAACATCAACAAAGAAATACTGG - Intronic
945051845 2:205831335-205831357 AAACACCAACAAAACCATATAGG - Intergenic
945824447 2:214703461-214703483 CAACATAGACAAATCAATAAAGG + Intergenic
948561837 2:238859338-238859360 CCAAATAAGCAAATCCATACAGG + Intronic
1168892282 20:1302777-1302799 AAACCACAACAAATCCAAACCGG - Intronic
1169440978 20:5633691-5633713 CAACAACAACAAAACCTAACTGG - Intergenic
1169832016 20:9835961-9835983 CAACATCAACAAATCAACTGGGG + Intronic
1169880923 20:10345542-10345564 CAACAGCAACAAACACATACAGG - Intergenic
1169980502 20:11379320-11379342 CACCAGCAACAAAGGCATACAGG + Intergenic
1170197806 20:13708095-13708117 AAATATCAACACATACATACAGG - Intergenic
1170300782 20:14882047-14882069 TCACATGAACAAATCCCTACAGG + Intronic
1172204413 20:33152698-33152720 CAACATCAACCATTTCATTCAGG - Intergenic
1173889198 20:46491621-46491643 CGCCACCAACAAATCCATACCGG + Intergenic
1173889223 20:46491873-46491895 CAACATAAAAAAATTCATACTGG + Intergenic
1173889241 20:46492185-46492207 CGCCACCAACAAATCCATACTGG + Intergenic
1173889265 20:46492437-46492459 CAACATAAAAAAATTCATACTGG + Intergenic
1174995496 20:55563074-55563096 CAACATATACAAATCAATAAAGG - Intergenic
1176808277 21:13513294-13513316 AAACAGCAACCAATCCATTCTGG + Intergenic
1177095425 21:16826186-16826208 CAACAACAACAAAACCTGACTGG + Intergenic
1177654259 21:23997564-23997586 CAACAACAACAAACCCATAAAGG - Intergenic
1178800268 21:35788161-35788183 CAACATACACAAATCAATAAAGG + Intronic
1181566922 22:23744482-23744504 CAACACCAAAAGATCCACACCGG - Exonic
1184768576 22:46585491-46585513 CAACATCAAGAAAACAAGACAGG - Intronic
949286321 3:2409924-2409946 AGACACCAACAAACCCATACTGG - Intronic
949713788 3:6904017-6904039 CAACATTAAAAAATCAATAATGG - Intronic
950522212 3:13504164-13504186 GAACATCAAGAAATCCCTCCAGG + Exonic
951164557 3:19469407-19469429 CAACAACAAAAAAAACATACTGG - Intronic
952500350 3:33955966-33955988 CCACCTCAAGAAAACCATACAGG - Intergenic
953062137 3:39435833-39435855 AGGCATCAACAAATCCACACAGG + Intergenic
953440763 3:42914950-42914972 CAACATCAACGGATCCACACTGG + Exonic
953440794 3:42915202-42915224 CGACATCAAAGAATCCATACTGG + Exonic
953633736 3:44643801-44643823 GTACATCAAAGAATCCATACTGG + Exonic
953642419 3:44721415-44721437 CAACATCAAAGAATTCACACTGG + Exonic
954528894 3:51300701-51300723 CAACATACACAAATCAATAAAGG - Intronic
954739160 3:52733328-52733350 CAACATCAAAGAATTCATCCTGG + Intronic
955639785 3:61069901-61069923 CAACAACAACAAAACCAAAATGG - Intronic
959312095 3:104751773-104751795 CAAAATACAGAAATCCATACTGG + Intergenic
959725973 3:109542008-109542030 CAACCTACACAAATCCATAAAGG + Intergenic
960219232 3:115084961-115084983 CAACAACAACAAAACAAAACAGG - Intronic
960867442 3:122216193-122216215 CCACATCATCAAATCCTAACTGG + Intronic
965524726 3:169703634-169703656 CAACAACAACCAAACCCTACTGG - Intergenic
966313780 3:178623765-178623787 AGATATCTACAAATCCATACTGG + Intronic
967459890 3:189733516-189733538 CAACATCCAAAGATCCAAACGGG - Intronic
967806539 3:193719241-193719263 TACAATCAACAAATCCACACTGG - Intergenic
968399045 4:272285-272307 CAACATCAAGGAATTCATGCTGG - Exonic
968409333 4:373587-373609 GAACATAAAAAAATTCATACTGG + Exonic
971014723 4:22476133-22476155 CAACAACAACAAATCCTTTGTGG - Intronic
972121261 4:35707022-35707044 CAACAACAACAAATCAAAGCTGG - Intergenic
972355223 4:38274297-38274319 CAACCTCAACAAATTCAACCTGG + Intergenic
972868551 4:43267145-43267167 CAACATCACCAAATACACCCAGG - Intergenic
972892150 4:43570926-43570948 CAAAATGAACATATACATACGGG + Intergenic
973795549 4:54422366-54422388 CAACCTCATAAAATTCATACAGG + Intergenic
975092465 4:70420206-70420228 CAACATACACAAATCAATAAAGG - Intergenic
975796752 4:78014226-78014248 CAACATCATCCAATCCATTGAGG + Intergenic
976079456 4:81338634-81338656 CAACAACAACAAACACATGCTGG - Intergenic
977721455 4:100244404-100244426 CAGCAGGAACAAACCCATACTGG + Intergenic
977869193 4:102070006-102070028 TACCAGCAGCAAATCCATACAGG + Intronic
978766557 4:112411215-112411237 CAACAACAACAAAACTATATAGG - Intronic
979602014 4:122596089-122596111 TAAAATCAACAAATCCAGACTGG - Intergenic
979639573 4:122998158-122998180 CAACAACAACAAAAAGATACTGG - Intronic
980032303 4:127845042-127845064 TACCGGCAACAAATCCATACAGG + Intergenic
981156877 4:141448023-141448045 GAACAGCAACAAAGCCATTCTGG - Intergenic
981294360 4:143114148-143114170 CAACAACAACAAAACACTACAGG + Intergenic
981313958 4:143323403-143323425 CAACAACAACAAATGCAAGCTGG - Intergenic
982041367 4:151400075-151400097 CAAAATAGACAAATCCATACAGG - Intergenic
982130065 4:152221044-152221066 CAACATCAAGAAATGCATGATGG + Intergenic
982725211 4:158899147-158899169 CAACATACACAAATCAATAAAGG - Intronic
984636379 4:182114884-182114906 CAAAATCCACAAATCCAGCCAGG + Intergenic
987104451 5:14623573-14623595 CAAAATTAACAAATGCATAATGG + Intergenic
987389839 5:17365527-17365549 CAACTTCTAGAAATCCAAACAGG - Intergenic
987493103 5:18606396-18606418 CAACAACAACAAAACCAAAATGG + Intergenic
987499367 5:18687441-18687463 CAATATCAAAAAATGAATACAGG - Intergenic
987599467 5:20047282-20047304 GAACATCAATAAATCCTTAAGGG + Intronic
988036424 5:25833015-25833037 CAACAACAACAAAAACCTACAGG - Intergenic
991657613 5:68919840-68919862 CACCAGCAGCATATCCATACAGG + Intergenic
993208437 5:84917383-84917405 CTACATACACAAATCAATACAGG + Intergenic
993308389 5:86297714-86297736 TAACATCAACAAAGAAATACAGG - Intergenic
993443678 5:87986222-87986244 CAACCTGAACAAATCCAAATAGG + Intergenic
993580163 5:89651687-89651709 AAACAACAAAAAATCCAGACTGG + Intergenic
994172894 5:96677872-96677894 CCACCTTAACAAATACATACAGG - Intronic
994455660 5:100003949-100003971 CAACAACAACAAAAGGATACTGG + Intergenic
994777330 5:104050669-104050691 CAACAACAACAAAAACACACTGG + Intergenic
995725101 5:115173626-115173648 CAACATCTACAAAAGCATAGAGG - Intronic
995926622 5:117382701-117382723 TACCAGCAGCAAATCCATACAGG + Intergenic
998661460 5:144243468-144243490 CAACATAAACAAATACACATGGG - Intronic
998721609 5:144958001-144958023 CAACTTCAACAAATGCCTTCAGG + Intergenic
1000219121 5:159194980-159195002 CAACAACAAAAAATCCATAGGGG - Intronic
1000613876 5:163406659-163406681 GAAGATCAACCAATCCTTACAGG + Intergenic
1001154157 5:169258509-169258531 CAACATGACCAAAACCAGACAGG - Intronic
1002366078 5:178712409-178712431 CAACATCAGAGAATGCATACTGG - Exonic
1002366135 5:178713081-178713103 CAACATCAAATAACGCATACTGG - Exonic
1002387893 5:178883227-178883249 CAACATCAAAGAACTCATACAGG + Exonic
1002387953 5:178883899-178883921 CAACATCAGAGAATGCATACTGG + Exonic
1002393223 5:178932508-178932530 GAACATCAAAGAATTCATACTGG + Exonic
1002397022 5:178965689-178965711 CAACATCAGAGAATTCATACTGG + Exonic
1002406106 5:179033197-179033219 CAACATCAAAGAATTCACACTGG + Exonic
1002881036 6:1253021-1253043 CAACAACAACAAAACCACACGGG - Intergenic
1003819570 6:9881292-9881314 CAACATACACAAATCAATAAAGG + Intronic
1003853733 6:10251447-10251469 TAACATCAACAAATACTTACTGG + Intergenic
1003998281 6:11566495-11566517 TACCAGCAGCAAATCCATACAGG + Intronic
1005593912 6:27359332-27359354 CAACATCAAAGAATGTATACAGG - Intergenic
1005593918 6:27359416-27359438 CTACATCAGAGAATCCATACTGG - Intergenic
1005598341 6:27400914-27400936 CTACATCAGAGAATCCATACTGG + Exonic
1005598356 6:27401082-27401104 CAGCATCAACGAATACACACTGG + Exonic
1005603508 6:27451562-27451584 CAGCATCAACGAATTCACACTGG - Exonic
1005603563 6:27452234-27452256 CAGCATCAAAAAACTCATACTGG - Exonic
1005603580 6:27452402-27452424 CAACATCAAAAAATTCATACTGG - Exonic
1005603586 6:27452486-27452508 GAACATCAGAAAATTCATACGGG - Exonic
1005603603 6:27452654-27452676 CAACATCAAAGAATTCATACTGG - Exonic
1005677206 6:28166991-28167013 AAACATCAGAGAATCCATACTGG + Intergenic
1005679143 6:28188311-28188333 CAACATCTTAAAATCCACACTGG + Intergenic
1005683847 6:28232804-28232826 CGACATCAAAGAATTCATACTGG + Exonic
1005684937 6:28245222-28245244 GAACATCAGAAAATCCACACTGG - Exonic
1005684967 6:28245471-28245493 GAACATCACAAAATTCATACTGG - Exonic
1005693077 6:28326179-28326201 AAACATCAGAAAATCCACACTGG - Exonic
1005697660 6:28366157-28366179 GAACATCAAAAAATCCACACTGG + Exonic
1005880160 6:30051237-30051259 CAAAATAGGCAAATCCATACAGG + Intergenic
1008015001 6:46508632-46508654 CAACAACAAAAAAACCACACAGG + Intergenic
1008215793 6:48786859-48786881 CAACAACAACAAATACTTAAAGG - Intergenic
1010343803 6:74788261-74788283 CAACGTAAACAAATCAATAAAGG - Intergenic
1010362296 6:75008909-75008931 CAACATACACAAATCAATAAAGG + Intergenic
1010648473 6:78422845-78422867 CAACATACACAAATCAATAAAGG + Intergenic
1012314956 6:97774579-97774601 CAACAACAAAAAATCCTTAGGGG + Intergenic
1013163277 6:107566676-107566698 CAACATGTACAAATCCATCATGG + Intronic
1013856012 6:114572793-114572815 CAACAACAAAAAATCCCTTCTGG - Intergenic
1013898099 6:115116797-115116819 CAACAGCTACAAATACACACTGG - Intergenic
1014123174 6:117749428-117749450 CAACATACACAAATCAATAAAGG + Intergenic
1014360995 6:120473477-120473499 CAACATGAATAAATCCAAAAAGG - Intergenic
1015102513 6:129498105-129498127 CATTATCTACAAATCCACACAGG - Intronic
1015291507 6:131542730-131542752 CAACATACACAAATCAATAAAGG + Intergenic
1015316652 6:131824432-131824454 CAACAACAACAAATCCTGCCTGG - Intronic
1015690566 6:135917585-135917607 AAACAACAACAAATCAATAGAGG - Intronic
1017920266 6:158865992-158866014 CTAAATCAACTAATCCACACAGG + Intergenic
1018108875 6:160515745-160515767 CAACATACACAAATCAATAAGGG + Intergenic
1018621928 6:165737491-165737513 CAACATGTGCAAATCCATAAAGG + Intronic
1019939414 7:4277347-4277369 CACCATCAACCCATTCATACAGG + Intergenic
1020337999 7:7078560-7078582 CAGCATCAAAAAATTCACACAGG - Intergenic
1020358067 7:7299445-7299467 CAACATACACAAATCAATAAAGG - Intergenic
1024594977 7:50925009-50925031 AGCCATCAACAAATCCATATTGG - Intergenic
1024736445 7:52309910-52309932 TAACATCAACAAATACAAAAAGG + Intergenic
1025148482 7:56525696-56525718 CAACATCAGAAAATTAATACTGG - Intergenic
1025863446 7:65356277-65356299 CAACATCAGAGAATCAATACCGG + Intergenic
1027811711 7:82910149-82910171 CATCATCAACAAATCTTTAAAGG - Intronic
1027827120 7:83130120-83130142 CAACAACAACAAAAACATAATGG - Intronic
1029294774 7:99531425-99531447 CAACATCAAAGAATACACACTGG + Exonic
1029294847 7:99532097-99532119 CAACATCAGAGAATCCATACTGG + Exonic
1029358566 7:100071309-100071331 CAGCATCAAAGAATCCACACCGG - Exonic
1029358640 7:100071813-100071835 CAACATCAGAGAATCCACACTGG - Exonic
1030280318 7:107767864-107767886 CACCATCAAAAAATTCATACCGG + Exonic
1030340340 7:108372368-108372390 CAACAACAAAAAATCTGTACAGG + Intronic
1030991655 7:116308421-116308443 CAAAATGTACAAATCCCTACAGG + Intronic
1031638379 7:124130499-124130521 CAACAACAACAAACCCGCACTGG + Intergenic
1032406790 7:131661933-131661955 CAAGATCTAAAAATCCATCCTGG - Intergenic
1032493371 7:132341913-132341935 CAACTTTACCAAATTCATACAGG + Intronic
1035267222 7:157696809-157696831 CACCATCTACACATGCATACTGG + Intronic
1035596207 8:859928-859950 CAACAGCAACACCTCAATACTGG - Intergenic
1036991817 8:13606900-13606922 CAACAACAACAAAACGATAGAGG - Intergenic
1037017939 8:13931816-13931838 CAAAATTAAAAAATCCACACAGG - Intergenic
1037544471 8:19905366-19905388 CAGCATCAACATTTGCATACAGG - Intronic
1037586295 8:20278673-20278695 TAGCAGCAGCAAATCCATACAGG - Intronic
1041639051 8:60177236-60177258 CAACAACAACAAATTTATAAAGG + Intergenic
1042090653 8:65155481-65155503 CAACATTCACAAGTACATACAGG + Intergenic
1043885170 8:85590459-85590481 TACCAGCAGCAAATCCATACAGG - Intergenic
1044678588 8:94754363-94754385 CAACAGCAATAAATCCAACCAGG - Intronic
1046534425 8:115490968-115490990 CAACATCAACAACAAAATACTGG + Intronic
1048451893 8:134540871-134540893 CAAGATGAACAAATACCTACAGG - Intronic
1048895027 8:138984381-138984403 CAACATAAATGAATACATACTGG - Intergenic
1049852712 8:144841990-144842012 CAGCATCAAAGAATCCACACTGG + Exonic
1049852781 8:144842563-144842585 CAGCATCAGCGAATCCACACTGG + Exonic
1049865317 8:144931753-144931775 CAACATCAAAGAATCCATTCTGG - Exonic
1049871127 8:144977716-144977738 CAACATCTAAAAATTCATACAGG - Intergenic
1051259373 9:15247510-15247532 CAACATCAGCAATTCCCTATAGG - Intronic
1051598777 9:18851397-18851419 TAGCAGCAGCAAATCCATACAGG + Intronic
1055082114 9:72277692-72277714 CAACAACAACAAAACCTTATAGG + Intergenic
1055116375 9:72609549-72609571 CAACAACAACAAAAACAAACTGG + Intronic
1055234301 9:74101435-74101457 CAACAGCAACAAAAACATTCTGG - Intergenic
1057411727 9:94822228-94822250 CAAGATCAACACATCCTTAAAGG - Intronic
1058145666 9:101408261-101408283 CAACATCAAAGGGTCCATACTGG + Exonic
1058145712 9:101408765-101408787 CAACACCAAAAAATTCACACTGG + Exonic
1058145745 9:101409185-101409207 CAACATCAAAGAATCCACACTGG + Exonic
1058312303 9:103519074-103519096 CAAAAACAAACAATCCATACTGG + Intergenic
1059109561 9:111542553-111542575 CAACATCAGCGAATTCATACTGG + Exonic
1059263042 9:112997562-112997584 CAACATCAAAGAATTCATACTGG - Intergenic
1059263067 9:112997814-112997836 CAACATCATAGAATTCATACTGG - Intergenic
1059263086 9:112997982-112998004 CAGCATCAAAGAGTCCATACTGG - Intergenic
1059263090 9:112998066-112998088 CAACATCAAAGAATACATACTGG - Intergenic
1059871692 9:118585465-118585487 CAACATTATTAAATCCTTACTGG - Intergenic
1061745964 9:132740641-132740663 CATCATCCCCAAATCCAAACGGG - Intronic
1186761845 X:12731396-12731418 CATCACCCAGAAATCCATACAGG + Intergenic
1187605543 X:20878431-20878453 CAACATACACAAATCAATAAAGG + Intergenic
1187899442 X:24013607-24013629 CTACATACACAAATGCATACTGG + Intronic
1188855706 X:35192964-35192986 CAACAACAACAAATACAACCAGG - Intergenic
1189980041 X:46500678-46500700 AAACATCAACGAACTCATACAGG - Exonic
1190092168 X:47448718-47448740 ACACATCAAAAAATTCATACCGG - Exonic
1191125649 X:56951036-56951058 CAACATACACAAATCAATAAAGG - Intergenic
1191744411 X:64470300-64470322 AAACATCAACAAATATAAACAGG - Intergenic
1192962333 X:76144105-76144127 CAAGGTCATCAAAGCCATACAGG + Intergenic
1192963200 X:76150982-76151004 CAAGGTCATCAAAGCCATACAGG - Intergenic
1193266070 X:79471285-79471307 CAACCTCAAAAAATCAATATAGG - Intergenic
1193514716 X:82449229-82449251 CAACATACACAAATCAATACAGG + Intergenic
1194148888 X:90298934-90298956 TAACAGCCACAAATCCATATAGG + Intergenic
1194419667 X:93657970-93657992 CAACATCAACCTATTGATACAGG + Intergenic
1194563750 X:95455442-95455464 CAACAACAACAAATACCTACAGG + Intergenic
1194848650 X:98844101-98844123 CAACATATGCAAATCCATAAAGG - Intergenic
1194867714 X:99089030-99089052 AAAGATCAACAAATCCAGAGGGG + Intergenic
1195084199 X:101398817-101398839 CAACATCAACAATTCTCTCCTGG + Exonic
1195136423 X:101911539-101911561 CAACAACAGCGAATCCACACAGG + Intronic
1196209568 X:112980861-112980883 ATCCATCAACAAATCCATTCTGG + Intergenic
1196850920 X:119938049-119938071 GAATATTAACAAAACCATACTGG + Intronic
1197349468 X:125365630-125365652 CAACATATGCAAATCAATACAGG - Intergenic
1199337602 X:146638663-146638685 TAACATCAATAATTCCATATTGG + Intergenic
1199655148 X:149987110-149987132 TAACATCAACAAAACCAATCAGG + Intergenic
1199812297 X:151361903-151361925 CAACATAGAAATATCCATACTGG + Intergenic
1200495256 Y:3875668-3875690 TAACAGCCACAAATCCATATAGG + Intergenic
1202015056 Y:20396301-20396323 CAACATCAAAAAATCCATATAGG + Intergenic