ID: 1165570821

View in Genome Browser
Species Human (GRCh38)
Location 19:36773212-36773234
Sequence TGAGTTCCAAACTAACAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165570821_1165570825 15 Left 1165570821 19:36773212-36773234 CCTGGCTGTTAGTTTGGAACTCA 0: 1
1: 0
2: 1
3: 13
4: 109
Right 1165570825 19:36773250-36773272 ACTCGCCCTCAGAATGCAGAGGG 0: 1
1: 0
2: 1
3: 6
4: 83
1165570821_1165570826 16 Left 1165570821 19:36773212-36773234 CCTGGCTGTTAGTTTGGAACTCA 0: 1
1: 0
2: 1
3: 13
4: 109
Right 1165570826 19:36773251-36773273 CTCGCCCTCAGAATGCAGAGGGG 0: 1
1: 0
2: 1
3: 8
4: 93
1165570821_1165570824 14 Left 1165570821 19:36773212-36773234 CCTGGCTGTTAGTTTGGAACTCA 0: 1
1: 0
2: 1
3: 13
4: 109
Right 1165570824 19:36773249-36773271 AACTCGCCCTCAGAATGCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165570821 Original CRISPR TGAGTTCCAAACTAACAGCC AGG (reversed) Exonic
902251418 1:15156111-15156133 TGAGGCCCAAACTGCCAGCCTGG + Intronic
906153565 1:43601417-43601439 TGAGTGCCAAGCTCAGAGCCTGG - Intronic
906456867 1:46004861-46004883 GGAGTTCCAAAAGACCAGCCTGG + Intronic
907031353 1:51175403-51175425 TGAGTTCCCGACTTACTGCCTGG - Intergenic
910617918 1:89219838-89219860 TGAGCTCCAAACAAAGAGTCTGG + Intergenic
912760872 1:112366175-112366197 TGAGCCACAAACTAACTGCCTGG - Intergenic
912790970 1:112650318-112650340 TGAGTTCCAAAAAAGCAGCATGG - Intronic
913112949 1:115672312-115672334 TGAATTTCAAACCAAAAGCCAGG + Intronic
916163839 1:161946529-161946551 TGAGTTCCATAGTTACAACCAGG + Intronic
916613527 1:166416806-166416828 TGTCTTCCAAACTATCAGACAGG + Intergenic
917343044 1:173999939-173999961 AGAGTTTCAAAGTACCAGCCTGG - Intronic
919201172 1:194357199-194357221 AGAGTTTCTAACTGACAGCCAGG + Intergenic
924071439 1:240284353-240284375 TGAGTTAGAAACAAACAGTCAGG + Intronic
924460614 1:244255333-244255355 TGAGGTCCTAACTGACAGCTGGG + Intergenic
1064730161 10:18322231-18322253 TGATTTCCAAATTAACATCTTGG + Intronic
1066716757 10:38295028-38295050 TTATTTCCAAACAAAGAGCCAGG - Intergenic
1073364514 10:102927551-102927573 GGAGTTCCAGACTGACAGTCTGG + Intronic
1081107608 11:39090393-39090415 TGAGATCAATAATAACAGCCTGG - Intergenic
1082843786 11:57711338-57711360 CGAGTTCCAAACTCAAACCCTGG + Intronic
1085618110 11:78017216-78017238 TGAGTTCCACACCACCACCCTGG - Exonic
1087572090 11:99941776-99941798 TAAGTTGGAAACTAACAGCAGGG + Intronic
1090666957 11:128920736-128920758 TGCCTCCCAAACAAACAGCCGGG + Exonic
1090956665 11:131519159-131519181 TGAGTTTCAAATTGAGAGCCAGG + Intronic
1091718866 12:2797888-2797910 TGAGATCCAGGCTAAGAGCCAGG + Intronic
1091982991 12:4881686-4881708 AGAGCTCCGAAATAACAGCCGGG - Intergenic
1097265525 12:57742225-57742247 TGAGTTTCAAACCCACAGCCTGG + Intronic
1099437624 12:82662480-82662502 TGAGTTCTAAACTTCCAGCTTGG + Intergenic
1099668610 12:85661368-85661390 TGAGTTCAAAACTCACAGAAAGG + Intergenic
1105775824 13:23659208-23659230 TGAGCTCAAAACTTACAGCTGGG - Exonic
1107873565 13:44769050-44769072 TCACTTCCAAACGACCAGCCTGG + Intergenic
1110658341 13:78027534-78027556 TGAGTTCCAAAATAACCCCATGG + Intergenic
1113809472 13:113129630-113129652 TGAGCTCCTTACCAACAGCCAGG - Intronic
1114081083 14:19201750-19201772 TGATTTCTGAACTAACACCCGGG + Intergenic
1114405346 14:22451177-22451199 TGAGTGCCAAAGTCCCAGCCAGG - Intergenic
1114889201 14:26895608-26895630 AGAATTCCAAACTTATAGCCTGG - Intergenic
1117331846 14:54720472-54720494 TGAGTCCCACAAAAACAGCCAGG - Intronic
1121856787 14:97277735-97277757 TGAGTGCTAAACATACAGCCAGG + Intergenic
1127509757 15:59628955-59628977 TGAGTCTCACTCTAACAGCCAGG + Intronic
1127687011 15:61356057-61356079 TCATTCCCAAACTCACAGCCAGG - Intergenic
1128233857 15:66053927-66053949 GGAGTTCAAGACCAACAGCCTGG - Intronic
1129982776 15:79889526-79889548 TGGGTCCCAAACTAAAAGTCAGG - Intronic
1133608754 16:7413477-7413499 TGAGGTCAACACTACCAGCCTGG + Intronic
1134438640 16:14284179-14284201 TGAGTCCAAAACTAACGGGCAGG - Intergenic
1135031038 16:19038917-19038939 TTAGTTCAAAAATAACAGTCAGG - Intronic
1135510883 16:23081887-23081909 TCAGATACAAACTAAGAGCCAGG + Intronic
1143645134 17:8225064-8225086 GGAGTTCCAGACCAGCAGCCTGG - Intergenic
1152395313 17:80029358-80029380 TCAGCTCCAACCCAACAGCCTGG - Intronic
1155043675 18:22085710-22085732 TGGCTTCCAAACATACAGCCTGG + Intergenic
1155270655 18:24138829-24138851 TGATTTCCCAACAAATAGCCAGG - Intergenic
1158226329 18:55205302-55205324 TGAGTCACAAAATAACAGCTTGG - Intergenic
1160115609 18:76076394-76076416 TGAATTCCAAACAAGCAGCTTGG + Intergenic
1160591849 18:79949363-79949385 TGACTTAAAAACTAACAGGCGGG + Intronic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1162915724 19:13873412-13873434 TGAGGCCCAAAATAACCGCCTGG - Intronic
1163130265 19:15268057-15268079 TCAGTTCTAAACTGAGAGCCTGG + Intronic
1163635910 19:18437215-18437237 TCAGTTCCAGGCTCACAGCCAGG + Intronic
1165309327 19:35021113-35021135 TGAGTCCCAAACTGACCTCCTGG - Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1168564765 19:57413777-57413799 TGGGTTCCAAACTCAGTGCCTGG + Intronic
925626163 2:5843723-5843745 TGAGTTTCAAAGTAAGTGCCTGG + Intergenic
927384611 2:22518568-22518590 TTAAGTCCAAACTAAAAGCCTGG + Intergenic
928289933 2:30028121-30028143 TGAGTTGCAAAATAAAATCCCGG - Intergenic
928338566 2:30421357-30421379 TGAATACCAAACTCAGAGCCAGG - Intergenic
929005576 2:37390008-37390030 AGAGATCCAAGCTCACAGCCAGG + Intergenic
930866986 2:56131378-56131400 GGAGTTCCTAACTCACTGCCAGG + Intergenic
940312998 2:152298106-152298128 TGAGTTACAAAATAACAACAAGG + Intergenic
940435823 2:153652678-153652700 TTATTTTCAAACTAACAGCAAGG - Intergenic
941578974 2:167271329-167271351 TGTGTTCCAAGCTCACAGCAAGG + Intergenic
944004496 2:194887066-194887088 TGATTTCCAAACTTAGAGTCTGG + Intergenic
946125938 2:217562724-217562746 TGACTTGCAAATTAACAGCCTGG - Intronic
948709625 2:239817722-239817744 TGAGGTCCAGGCTAATAGCCAGG - Intergenic
1168852070 20:983910-983932 TGAGTGGCAAACTCAAAGCCAGG + Intronic
1171992739 20:31708944-31708966 TGAGTCCCAAAATAACAACCAGG + Intronic
1173643158 20:44617429-44617451 GGAGTGCCAAACTCACACCCAGG - Intronic
1173821710 20:46023846-46023868 TGAGTTCCAGACCCAGAGCCTGG + Intronic
1175645895 20:60671391-60671413 TGAGTCACAAACTCACAGCCGGG - Intergenic
1176942467 21:14940534-14940556 TCAGTGCCACAGTAACAGCCAGG + Intergenic
1177315278 21:19452459-19452481 TGAGTTGCAAACTAAAAGTCTGG - Intergenic
1177357090 21:20022287-20022309 TGAGTTACAATGTAACTGCCTGG - Intergenic
1180499690 22:15920936-15920958 TGATTTCTGAACTAACACCCGGG - Intergenic
950658214 3:14450463-14450485 TGAGTACCAAGCTGGCAGCCAGG - Intronic
951913349 3:27774110-27774132 TGAGTCCCTAATTAACTGCCTGG - Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954253241 3:49384852-49384874 GGAGTTCGAAACCAGCAGCCTGG + Intronic
955488637 3:59460487-59460509 TGGGTTCAAACCTACCAGCCTGG - Intergenic
964481761 3:157145678-157145700 TCAGTTCTAAAATAACAGTCTGG + Intergenic
967398467 3:189033189-189033211 TTTGTACCAAACTAAAAGCCAGG + Intronic
969252786 4:5980649-5980671 AGAGTCCCAGAATAACAGCCTGG + Intronic
977256309 4:94744306-94744328 TTTGTTTAAAACTAACAGCCAGG - Intergenic
977325505 4:95570675-95570697 TGAGTTCAAACCTTACAGGCTGG - Intergenic
982198722 4:152938965-152938987 TGAGCTCCAAACTGACGGCCAGG + Intronic
982212658 4:153051575-153051597 AGATTTCCAAACCAACACCCTGG - Intergenic
982325306 4:154123784-154123806 TGGGTTCCAAAGAAACTGCCAGG + Intergenic
984072917 4:175138839-175138861 TAAGCTGCAAAATAACAGCCTGG - Intergenic
987522875 5:19010000-19010022 TCATTTCCAAAATCACAGCCTGG + Intergenic
988448539 5:31315556-31315578 TTAATTCCAAATGAACAGCCTGG + Intronic
992121549 5:73598731-73598753 TGAGTTTGGAACTAACAGACAGG + Intergenic
996964813 5:129295149-129295171 AGAGTTCCCAACTAAGAGCATGG - Intergenic
998557766 5:143142346-143142368 GGAGTTCGAGACTAGCAGCCTGG - Intronic
999213752 5:149914150-149914172 TGAGTCCCAATCTCACAGCCAGG - Intronic
1001648697 5:173300417-173300439 TGAGTTCTAGACTAACAGCTGGG + Intergenic
1001720020 5:173849263-173849285 TGAGTTCCTACCTGACAGCCAGG - Intergenic
1002183637 5:177443905-177443927 TGAGTACCAAACTAACCACCTGG + Intergenic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1007123368 6:39401958-39401980 TGACTCCCAAAATACCAGCCAGG - Intronic
1007589171 6:43011253-43011275 AGAGTTCCTAACTGCCAGCCAGG + Exonic
1016205516 6:141463318-141463340 TTAATTCCAAACTCACAGCCTGG + Intergenic
1018186831 6:161272916-161272938 TGAGTAACAAATTAACTGCCGGG - Intronic
1019294434 7:266469-266491 TGAGTCCCAAAAGGACAGCCTGG - Intergenic
1021182282 7:17520539-17520561 GAAGTTCCAAACTAGCAGCATGG - Intergenic
1028042159 7:86066478-86066500 TGAGTTCCAAACAAAGAGGCTGG + Intergenic
1030248078 7:107407735-107407757 TGAATACAAAACAAACAGCCAGG + Intronic
1030285022 7:107817128-107817150 GGAGTTCTAGACTAGCAGCCTGG - Intergenic
1031069261 7:117143699-117143721 TGAGTACTAAACTAGCACCCTGG - Intronic
1032696101 7:134337707-134337729 TGAGTACCTAATTACCAGCCAGG + Intergenic
1034878541 7:154746205-154746227 TGAGTTCCAAAGACACAACCTGG + Intronic
1034910115 7:154989468-154989490 TGAGCACCAAAATGACAGCCTGG + Intronic
1039708507 8:40031921-40031943 TGAATTTCAAAGTAACAGCAAGG - Intergenic
1042872365 8:73410540-73410562 TCAGCTCCAAACTCACCGCCGGG - Intergenic
1044831903 8:96258890-96258912 TCAGTTACAAACCAACAGACAGG + Intronic
1052747118 9:32451765-32451787 TAAATTACAAACAAACAGCCAGG + Exonic
1058480694 9:105391444-105391466 TGAGTTGCAAATTAATTGCCAGG + Exonic
1192592127 X:72369048-72369070 TGAGAACCAAACTGAGAGCCTGG - Intronic
1199851019 X:151725029-151725051 TGAGTTGCAAACAAACAGCACGG + Intergenic