ID: 1165570824

View in Genome Browser
Species Human (GRCh38)
Location 19:36773249-36773271
Sequence AACTCGCCCTCAGAATGCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165570821_1165570824 14 Left 1165570821 19:36773212-36773234 CCTGGCTGTTAGTTTGGAACTCA 0: 1
1: 0
2: 1
3: 13
4: 109
Right 1165570824 19:36773249-36773271 AACTCGCCCTCAGAATGCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 78
1165570819_1165570824 20 Left 1165570819 19:36773206-36773228 CCTGGTCCTGGCTGTTAGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1165570824 19:36773249-36773271 AACTCGCCCTCAGAATGCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 78
1165570818_1165570824 25 Left 1165570818 19:36773201-36773223 CCAAGCCTGGTCCTGGCTGTTAG 0: 1
1: 0
2: 0
3: 23
4: 230
Right 1165570824 19:36773249-36773271 AACTCGCCCTCAGAATGCAGAGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165570824 Original CRISPR AACTCGCCCTCAGAATGCAG AGG Exonic
902282802 1:15386690-15386712 AACTTGAGCTCATAATGCAGAGG - Intronic
908024678 1:59938274-59938296 AACTGGCGCTCAGCATGCGGAGG + Intergenic
912131346 1:106605010-106605032 AACTCTCCCTAACTATGCAGGGG - Intergenic
913290268 1:117265325-117265347 AACACGCCCTCACTATGCAAGGG - Intergenic
920914914 1:210251785-210251807 GACTCGCCCGGAGAATGCAGTGG + Intergenic
1066614351 10:37280689-37280711 AACTGGGAGTCAGAATGCAGGGG + Intronic
1066620061 10:37339006-37339028 AATTCACCCTGAGAATACAGAGG - Intronic
1067932532 10:50577087-50577109 GGCTGGCCCTCAGAATTCAGAGG + Intronic
1069137114 10:64780856-64780878 AACTGGGAGTCAGAATGCAGGGG + Intergenic
1074055731 10:109921961-109921983 AAGTCTCCCTGAGAATGAAGCGG + Intronic
1075581135 10:123619489-123619511 AAATGGCTCTCAGAATGCTGAGG + Intergenic
1076559901 10:131355319-131355341 AAATCGCTTTCAGAATGAAGGGG + Intergenic
1082050495 11:47767062-47767084 GACTCGCCTTCAGAAGGCAAGGG - Exonic
1091806698 12:3361987-3362009 AACTAGCACTCAGCATTCAGGGG + Intergenic
1097546319 12:61005598-61005620 AACTTGAACTCAGAAGGCAGAGG - Intergenic
1100028317 12:90155224-90155246 CACAAGCACTCAGAATGCAGGGG - Intergenic
1102584515 12:113913907-113913929 ATCTAGCTCTCAGAATGCAAAGG - Intronic
1104008999 12:124915497-124915519 ACCTGGCCCTCAGAATGTACAGG - Intronic
1104296305 12:127517657-127517679 AACTAGGCCTCAGAATTAAGAGG - Intergenic
1105688664 13:22813765-22813787 AACTGGCGCTCAGCATACAGAGG + Intergenic
1111577562 13:90176152-90176174 AGCTCTCCCTCAGAAGACAGAGG - Intergenic
1112519365 13:100082224-100082246 AACTGGGAATCAGAATGCAGGGG - Intergenic
1114528141 14:23378985-23379007 AACAGGACCTCAGAAGGCAGGGG - Intronic
1115495233 14:33997481-33997503 ATATCACCCTCAGAATGCATGGG - Intronic
1119611828 14:76069889-76069911 AACTGGACCTCAGGATGCAAAGG - Intronic
1121903829 14:97721656-97721678 CACTCACCCTCAGAAAGCAAAGG - Intergenic
1128852449 15:70973435-70973457 ATCTCCCCATCAGAAGGCAGGGG + Intronic
1138160577 16:54749357-54749379 AAGAAGCCATCAGAATGCAGGGG + Intergenic
1145776323 17:27531532-27531554 CACTCGCCCACAGAACACAGGGG - Intronic
1145848050 17:28061131-28061153 AACTGGCCCTCAGGAGGCTGTGG - Intronic
1146281009 17:31544507-31544529 AAATTGCCCTGAGAATGCTGTGG - Intergenic
1150060133 17:62060576-62060598 ATCTCGCTCTCTGAGTGCAGTGG - Intronic
1165570824 19:36773249-36773271 AACTCGCCCTCAGAATGCAGAGG + Exonic
925565899 2:5253801-5253823 AACTCACATTCAGCATGCAGTGG - Intergenic
930038761 2:47104536-47104558 AACTGGGAGTCAGAATGCAGGGG - Intronic
934165344 2:89289116-89289138 AACTGCCCATCAGAGTGCAGGGG - Intergenic
934201930 2:89893346-89893368 AACTGCCCATCAGAGTGCAGGGG + Intergenic
940716740 2:157234711-157234733 AATTAGCACACAGAATGCAGTGG - Intergenic
1174639152 20:52028071-52028093 CTCTCTCCCCCAGAATGCAGTGG + Intergenic
1175790746 20:61738530-61738552 ACCTCTGCCTCAGAATGCAGGGG - Intronic
1177703841 21:24674537-24674559 AACTGGCCCTCAGCAGGAAGGGG - Intergenic
1177865614 21:26509569-26509591 AACTGGCCCTCAGATCTCAGTGG + Intronic
1183748569 22:39706154-39706176 CACTGGCCCTCAGAAGGCAGGGG - Intergenic
1184870740 22:47236525-47236547 ATCCCGCCCTCAGAATGAAAGGG - Intergenic
949647144 3:6108850-6108872 AACTGGCGCTCAGGAGGCAGAGG - Intergenic
949882138 3:8670175-8670197 AACTGGCCCTGAGAGAGCAGCGG + Intronic
952851155 3:37730683-37730705 AACGCGCCCTGAGCATGCACTGG - Intronic
953622713 3:44546979-44547001 AACTGGGCGTCAGAGTGCAGGGG + Intergenic
954762791 3:52889059-52889081 AAATGGCCCTTAGAATGAAGAGG + Intronic
959153157 3:102631957-102631979 AATTCTCCCTCAGCCTGCAGAGG - Intergenic
959195386 3:103174050-103174072 AACTCATACTCAGAATGTAGGGG + Intergenic
959751346 3:109840072-109840094 AACTCCCCTTTTGAATGCAGAGG + Intergenic
960419658 3:117428221-117428243 CACTTGCACTCAGAAGGCAGAGG - Intergenic
961461106 3:127050936-127050958 AACTCGCCCCAGGAATGAAGTGG - Intergenic
963696969 3:148574775-148574797 AACTGGGAGTCAGAATGCAGGGG - Intergenic
966953955 3:184853933-184853955 AACTCAGGCTTAGAATGCAGAGG - Exonic
969702895 4:8777449-8777471 AACCAGCCCCCACAATGCAGAGG + Intergenic
974174720 4:58308302-58308324 AACTGGGAGTCAGAATGCAGGGG - Intergenic
979215009 4:118152863-118152885 AATTCGACCTGAGAATCCAGCGG - Intronic
987818080 5:22930064-22930086 AACTGGGAGTCAGAATGCAGGGG - Intergenic
988427963 5:31085821-31085843 ACCTCGCCCTTTGATTGCAGTGG - Intergenic
988987775 5:36637609-36637631 AAATCTCCTTCAGAATGCTGTGG + Intronic
989638435 5:43559922-43559944 AACTAGCCCTCTGAAGACAGAGG + Intergenic
993462133 5:88196049-88196071 AATTCACCCTGAGAATACAGAGG + Exonic
998687781 5:144549503-144549525 AAGTTGGCCTCAGAATACAGAGG - Intergenic
1000980651 5:167813171-167813193 ACATCTCCCTCAGAATGCAGAGG - Intronic
1002322026 5:178381986-178382008 AACCTGCCCTCAGAATGCCTAGG - Intronic
1002391229 5:178913528-178913550 AACTCTCTCACACAATGCAGAGG - Intronic
1002667912 5:180840117-180840139 AACACGCCCTCATGATGCAATGG - Intergenic
1005130822 6:22505686-22505708 ACCTCTACCTCTGAATGCAGAGG - Intergenic
1005343271 6:24863446-24863468 AACTGACCAGCAGAATGCAGGGG - Intronic
1005631734 6:27714433-27714455 AACTTCCTCTCAGAAGGCAGTGG - Intergenic
1009471008 6:64028578-64028600 AACTGGGACTCAGAGTGCAGGGG - Intronic
1017055567 6:150432744-150432766 AACTCGCCCTGAGCATTCACAGG + Intergenic
1023093664 7:36639411-36639433 AACTGGGCCTGAGAATGCAAAGG - Intronic
1036047269 8:5157863-5157885 ACCTGGCCTTCAGAATGCAGAGG - Intergenic
1037794041 8:21976607-21976629 AATTCTCCCTCAGAATACACAGG - Intronic
1041861383 8:62517244-62517266 AACTTGCCCTTAAAATGCAGTGG + Intronic
1043257252 8:78151522-78151544 AACTGGGCGTCAGAGTGCAGGGG - Intergenic
1044089934 8:87987597-87987619 AAGATGTCCTCAGAATGCAGAGG + Intergenic
1053043470 9:34893893-34893915 AAATAGCTCTCAGAATGCAGAGG - Intergenic
1057956986 9:99418036-99418058 TACTCACCCTCAGAATGTAAGGG - Intergenic
1060527422 9:124328388-124328410 AAATAGCCCTGAGAAAGCAGGGG - Intronic
1185821135 X:3205879-3205901 AACTTGCGCCCAGAAAGCAGAGG - Intergenic
1187701024 X:21964458-21964480 TCCTCCCCCTCAGAATGCAGGGG - Intronic
1192482562 X:71498255-71498277 AACTGGAAGTCAGAATGCAGGGG + Intronic
1201981925 Y:19917773-19917795 AATTGGGCCTCAGCATGCAGTGG - Intergenic