ID: 1165570826

View in Genome Browser
Species Human (GRCh38)
Location 19:36773251-36773273
Sequence CTCGCCCTCAGAATGCAGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165570821_1165570826 16 Left 1165570821 19:36773212-36773234 CCTGGCTGTTAGTTTGGAACTCA 0: 1
1: 0
2: 1
3: 13
4: 109
Right 1165570826 19:36773251-36773273 CTCGCCCTCAGAATGCAGAGGGG 0: 1
1: 0
2: 1
3: 8
4: 93
1165570818_1165570826 27 Left 1165570818 19:36773201-36773223 CCAAGCCTGGTCCTGGCTGTTAG 0: 1
1: 0
2: 0
3: 23
4: 230
Right 1165570826 19:36773251-36773273 CTCGCCCTCAGAATGCAGAGGGG 0: 1
1: 0
2: 1
3: 8
4: 93
1165570819_1165570826 22 Left 1165570819 19:36773206-36773228 CCTGGTCCTGGCTGTTAGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1165570826 19:36773251-36773273 CTCGCCCTCAGAATGCAGAGGGG 0: 1
1: 0
2: 1
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165570826 Original CRISPR CTCGCCCTCAGAATGCAGAG GGG Exonic
900461860 1:2805496-2805518 GTAGCCCCCAGAATGCAAAGGGG - Intergenic
903755133 1:25655354-25655376 CTCGCCCTCACCTTGCAGAAGGG - Intronic
906143253 1:43545981-43546003 CTCCCCCTCAGCCTGCAGATTGG - Intronic
909242893 1:73237801-73237823 CCCACCCTCAGAACACAGAGAGG + Intergenic
912686597 1:111772776-111772798 CTCCCCCTCTTAATGCTGAGTGG + Intronic
915917510 1:159949895-159949917 CAGGCCCTCAGAAAGTAGAGGGG + Intergenic
921903012 1:220467841-220467863 CCAGCCCTCAGAACACAGAGAGG - Intergenic
923200235 1:231704207-231704229 CTTGCCCTCTGAATGCATGGAGG + Intronic
1063519903 10:6731729-6731751 CACTCTCTCAGCATGCAGAGAGG - Intergenic
1063558861 10:7107732-7107754 ATCGCCCTCATAATGTAGATGGG + Intergenic
1066233995 10:33468003-33468025 CACTCCCTCAGCTTGCAGAGAGG + Intergenic
1073447587 10:103590633-103590655 TTAGCCCTCAGCATGCAGAGAGG - Exonic
1078736711 11:14026980-14027002 CTCTCCCAGAGACTGCAGAGTGG - Intronic
1080782356 11:35441509-35441531 CTTGCCAGCAGAATGGAGAGTGG - Exonic
1084312650 11:68325843-68325865 CTCGTCCTGAGGCTGCAGAGAGG + Intronic
1084416305 11:69034791-69034813 CTTGCCCGCAGAAAGCAGTGAGG - Intergenic
1084702378 11:70795860-70795882 CTCCCCCACAGATTGCAGAAAGG + Intronic
1086072483 11:82814407-82814429 TTAGCCCTCAGCATTCAGAGGGG + Intergenic
1088923642 11:114280092-114280114 CATGGCCTCAGAATGCAGAATGG - Intronic
1089388948 11:118086934-118086956 CTTGCCGTCAGCTTGCAGAGTGG - Intronic
1090635703 11:128689461-128689483 ATCTCCCTCAGAATGCAGCCTGG - Intronic
1097817425 12:64090201-64090223 CTTGCCCTGTGACTGCAGAGAGG - Intronic
1099018551 12:77374829-77374851 CTTGGCCTGAGAATACAGAGAGG - Intergenic
1100017652 12:90030905-90030927 CCAGCCCCCACAATGCAGAGTGG - Intergenic
1102752116 12:115304115-115304137 CTGGCCTTCAGAAGGCAGACTGG - Intergenic
1102755666 12:115338035-115338057 CTCCCCATCAGAATGCAGCAGGG + Intergenic
1104625879 12:130354113-130354135 CTCACCGTGAGAATACAGAGGGG - Intronic
1107675299 13:42790206-42790228 GTAGCCCTCATAAAGCAGAGAGG + Exonic
1108831455 13:54484509-54484531 CTTGCTATCAGAATGCAGGGTGG + Intergenic
1111577560 13:90176150-90176172 CTCTCCCTCAGAAGACAGAGGGG - Intergenic
1113510048 13:110846601-110846623 TTGGCCCACAGATTGCAGAGAGG - Intergenic
1113594268 13:111520310-111520332 CTTGCTGTCAGAATTCAGAGGGG - Intergenic
1115855214 14:37622909-37622931 CTGGGCCTCGGACTGCAGAGAGG - Intronic
1117479618 14:56129660-56129682 ATCGCCCTCAGGAGGCAGAATGG + Intronic
1121622441 14:95359961-95359983 CTTGCCCTGAGAATGTGGAGTGG + Intergenic
1122097998 14:99385470-99385492 CTCGCCAACAGAATGCAAGGTGG + Intergenic
1122351594 14:101097596-101097618 CACACCCTCAGCATGCTGAGAGG + Intergenic
1122495299 14:102149801-102149823 CTCTGCCTCAGACTCCAGAGTGG + Intronic
1126489931 15:49225681-49225703 CACACCCTCAGAAGACAGAGAGG - Intronic
1128852451 15:70973437-70973459 CTCCCCATCAGAAGGCAGGGGGG + Intronic
1132851316 16:2026309-2026331 CTGGCCCCCAGGATGCAGGGAGG + Intronic
1135655839 16:24248686-24248708 CTTGAACTCAGAAGGCAGAGAGG - Intergenic
1136544914 16:30949324-30949346 CTCGCCCTCAGGGTTCAGCGGGG - Exonic
1140785009 16:78332381-78332403 CGTGCCCTCAGATTGCACAGAGG - Intronic
1142244316 16:88962551-88962573 CGTGCCCTCAGGGTGCAGAGTGG - Intronic
1148642928 17:49201686-49201708 CTCGGCCTTAGAAGGCAGGGAGG - Intergenic
1151814763 17:76466341-76466363 GTGGGCCTCAGAGTGCAGAGGGG + Intronic
1156950836 18:42895786-42895808 CTCTCAGTCACAATGCAGAGTGG + Intronic
1159958540 18:74537618-74537640 CTGGACCACAGGATGCAGAGGGG + Intronic
1160567029 18:79792613-79792635 CTTCCCCTCAGCACGCAGAGAGG + Intergenic
1165570826 19:36773251-36773273 CTCGCCCTCAGAATGCAGAGGGG + Exonic
1168029447 19:53668054-53668076 CTGTCCCCCAGACTGCAGAGCGG - Intergenic
941858568 2:170254724-170254746 CTCACTCTCAGAACACAGAGAGG + Intronic
945895104 2:215472544-215472566 CTCTCCCTGAAAAAGCAGAGTGG + Intergenic
946046055 2:216821907-216821929 CTGGCTCTCAGGACGCAGAGTGG + Intergenic
948736129 2:240006429-240006451 CTCACCCTCCCAATGCTGAGAGG + Intronic
948739329 2:240032714-240032736 CTGGCCGTGAGACTGCAGAGGGG + Intergenic
1183180581 22:36257441-36257463 CTCGCACTTAGAATGGAGGGTGG + Intronic
1183729760 22:39611445-39611467 CTAGCCCTCAGAAAGCAGTGAGG + Intronic
950356373 3:12413485-12413507 CTCTTCTTCAGAATGCAGAAAGG + Intronic
951739554 3:25905471-25905493 CTTGGCAACAGAATGCAGAGGGG + Intergenic
957046844 3:75382334-75382356 CTTGCCCTCACATGGCAGAGAGG - Intergenic
958929158 3:100190721-100190743 CTGACCCTTAGAAAGCAGAGGGG + Intronic
961176645 3:124841248-124841270 CTCACCCTCTGACTTCAGAGTGG + Intronic
961737443 3:129010866-129010888 CAGGCCCTCAGGATGCACAGGGG + Intronic
962299199 3:134222804-134222826 CTGGCCCTCAGAAGACAGAGTGG - Intronic
966196681 3:177320783-177320805 CTCGCAGTCAGACTGCAGAGAGG - Intergenic
968585412 4:1414028-1414050 CGCGCCCTCCGAACCCAGAGCGG - Intergenic
969313351 4:6367030-6367052 CTCACCCTCAGAATGGAAAGAGG - Intronic
969946803 4:10791480-10791502 CACCCCCTCAGAATGCAGAGAGG - Intergenic
971748845 4:30619960-30619982 CTCACCCTCAGAGTTCAGACTGG + Intergenic
977994036 4:103481431-103481453 CATGCCCTGAGAATCCAGAGTGG - Intergenic
984770522 4:183433145-183433167 CTCTCCCTCAGCTTGCAGGGAGG + Intergenic
995061690 5:107817464-107817486 CTCCGCCTCAGAATACAGGGAGG + Intergenic
998737733 5:145161897-145161919 CTCTCTCTCAAAATGCAAAGTGG - Intergenic
999461168 5:151758602-151758624 CCCGCCCTCCGAATCCAGAGAGG - Exonic
1002559241 5:180070570-180070592 GTCACCCTGAGAATGCTGAGAGG - Intronic
1002963687 6:1941686-1941708 CTTTCCCTCAGCATGCAAAGAGG - Intronic
1006441883 6:34058269-34058291 CTCTGCCTCAGTATGAAGAGAGG + Intronic
1006746599 6:36347096-36347118 CTCCCCCTCAGAGTGCCCAGAGG + Intergenic
1006948873 6:37805112-37805134 CTCTCCCTCAGAGTTCTGAGTGG + Intergenic
1009502337 6:64430754-64430776 CTAGCCAACAGAATGCAGAAAGG + Intronic
1010597518 6:77782094-77782116 CTGGGACTCAGAATGGAGAGAGG + Intronic
1018914445 6:168124459-168124481 CTCACCCTCAGAATCCACACGGG + Intergenic
1019477481 7:1251037-1251059 CACCCCCTCAGCATTCAGAGTGG - Intergenic
1019656116 7:2196976-2196998 CTCGCCCTGCGAATTCAGTGAGG + Intronic
1019686369 7:2384278-2384300 CTGGCCCTCAGAATAGGGAGTGG + Intergenic
1020789907 7:12614643-12614665 TTAGCCCTCAGAAGGCTGAGTGG + Intronic
1021166936 7:17353901-17353923 CTCCCCCTCAGGAGGCACAGGGG + Intergenic
1023913723 7:44573182-44573204 GCCCGCCTCAGAATGCAGAGTGG + Intronic
1026567913 7:71504981-71505003 CTTGCCCTAAGATTGCAGTGTGG - Intronic
1026847696 7:73706938-73706960 CCCGCCCTCAGAAGGCAAAATGG - Intronic
1039284819 8:36028797-36028819 CACTCCCTCAGATTGCAGGGAGG + Intergenic
1039536414 8:38318186-38318208 TTCTCCCCGAGAATGCAGAGAGG + Intronic
1050077055 9:1876195-1876217 CTGGCGCTCAGAAGGCAGGGAGG - Intergenic
1055783667 9:79847967-79847989 CTCCCCCTCAAACTGGAGAGAGG - Intergenic
1060458176 9:123820405-123820427 CTGGACTTCTGAATGCAGAGAGG + Intronic
1062530667 9:136998181-136998203 CACGCCCACAGAACGCAGTGGGG - Intergenic
1185767431 X:2737025-2737047 ACCTCCCTCAGAATGCAGAGAGG - Intronic
1195694038 X:107653667-107653689 CTGGTCCTGAGAATGCAGGGAGG + Intergenic
1196582646 X:117394651-117394673 CACTCCCTCAGCTTGCAGAGAGG + Intergenic
1196781515 X:119387975-119387997 CACTCCCTCAGCTTGCAGAGAGG - Intergenic
1200027222 X:153271493-153271515 CTTGCCTTCAGACTGCAAAGGGG - Intergenic