ID: 1165582886

View in Genome Browser
Species Human (GRCh38)
Location 19:36884439-36884461
Sequence GGGTCCAAAGATGAGTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165582882_1165582886 12 Left 1165582882 19:36884404-36884426 CCAGAGGAAGAGACACATAGAAT 0: 1
1: 2
2: 3
3: 37
4: 350
Right 1165582886 19:36884439-36884461 GGGTCCAAAGATGAGTCTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165582886 Original CRISPR GGGTCCAAAGATGAGTCTTC TGG Intronic
901066478 1:6497019-6497041 AGGGTCAAAGATGAGTCTTGGGG - Exonic
901418636 1:9135252-9135274 GGGTCCAAAGAAGATGCATCTGG - Intergenic
904848525 1:33439178-33439200 CCGGCCAAAGAAGAGTCTTCTGG + Intergenic
912632070 1:111254671-111254693 GGGGCCAAAGGAGAGTCTCCAGG - Intergenic
912726226 1:112061105-112061127 GGGGCCCAAGATGAGTGTTCAGG - Intergenic
912757151 1:112333955-112333977 GGATCCAAACACCAGTCTTCTGG - Intergenic
915097158 1:153471209-153471231 GGGGCCAACCATGAGTCTTCAGG + Intergenic
915979285 1:160410044-160410066 GGGCCCACAGACGACTCTTCAGG + Intronic
919822946 1:201484353-201484375 GGGTGCCAAGATGTGTCCTCAGG + Exonic
919988606 1:202693090-202693112 GGGTCAAAAGCTGAGTGCTCGGG - Intronic
1063900928 10:10731930-10731952 GGGTGCAAAGATGAGGAGTCTGG - Intergenic
1072693483 10:97586698-97586720 GGGTCCAGAGAAGAGTCTGGGGG - Intronic
1072710257 10:97711876-97711898 CGGTCATAAGATGAGTCCTCTGG - Intergenic
1073806023 10:107098911-107098933 GGGTCCAAAGATCTGAGTTCTGG - Intronic
1081536104 11:43997335-43997357 GGTTCCAGAGAGGATTCTTCCGG + Intergenic
1083673590 11:64313704-64313726 TGGTCCAGAGATGAGGCTTGGGG + Intronic
1084769260 11:71332021-71332043 GGGGCTACAGATGAGTCTCCAGG + Intergenic
1092782783 12:12002837-12002859 GGCTCCAGAGAGGAGTCTCCAGG + Intergenic
1094279285 12:28717416-28717438 GTATCCTAAGACGAGTCTTCGGG - Intergenic
1104525217 12:129514616-129514638 GGATGCAAAGATGAATGTTCGGG - Intronic
1106169336 13:27275540-27275562 GGGTCAAAAGATGAGTCCCAAGG + Intergenic
1106205975 13:27594978-27595000 GGGACCACAGAAGAGTATTCAGG - Intronic
1110253800 13:73409735-73409757 GGGACCAGAGAATAGTCTTCTGG + Intergenic
1112131901 13:96533846-96533868 GGGTCCAGAGATGATTTTTCTGG + Intronic
1113617703 13:111692848-111692870 GGGACCAAAGAGGAGACCTCCGG + Intergenic
1113623234 13:111778109-111778131 GGGACCAAAGAGGAGACCTCCGG + Intergenic
1115827392 14:37293272-37293294 GGGTGCAAAGATGATTATTTTGG - Intronic
1119567561 14:75641467-75641489 GGATTCCAACATGAGTCTTCTGG - Intronic
1121382496 14:93485504-93485526 GGGGCCAAAGAAGATGCTTCTGG - Intronic
1121434023 14:93906933-93906955 GAGGCCAAAGCTGAGTGTTCAGG + Intergenic
1121737609 14:96229391-96229413 CGGTCCAAGGCTGAGTGTTCTGG - Intronic
1124077649 15:26461430-26461452 GGGGCCAGGGATGAGTCTGCAGG - Intergenic
1127501267 15:59556233-59556255 GGGTCCAGTGATGAGTCTCTTGG - Intergenic
1129375729 15:75129867-75129889 GGGTCCAGGAATGAGTCTCCAGG - Intergenic
1132588923 16:717965-717987 GGGGCCAAGGATGACTCTGCGGG - Exonic
1133444604 16:5849326-5849348 GGGTCCAAACAGGAGACTTGAGG + Intergenic
1136247093 16:28982349-28982371 GAGTCCAAAGATGAGACTAGGGG - Exonic
1141577790 16:84975770-84975792 GGGTCAAAGGATGTCTCTTCCGG + Intronic
1148037738 17:44680775-44680797 GTTTCCAAAGATGAATCTCCTGG - Intronic
1148240897 17:45998813-45998835 TGGTCCCAAGATGGGGCTTCTGG - Intronic
1148329921 17:46807809-46807831 GGGTGCAAGGATGTGGCTTCAGG + Intronic
1148492623 17:48033106-48033128 GGGTCCAATGGTGAGCCTCCAGG + Intronic
1152006266 17:77683557-77683579 GGGTCCAAAGATGCCTGTGCGGG - Intergenic
1153566457 18:6423170-6423192 GGCTCCAAAGATGTGTCTCAGGG + Intergenic
1153635800 18:7112453-7112475 GCGTCTAAAGATGTTTCTTCAGG - Intronic
1154346057 18:13544460-13544482 GGGTACAAAGATGTGTTTTCAGG + Intronic
1159112179 18:64072239-64072261 AGGTCCCAAAATTAGTCTTCTGG + Intergenic
1159359876 18:67386199-67386221 GGGAAGAAAGATGAGTCATCTGG + Intergenic
1160551245 18:79694928-79694950 TGGTCCAAAGAGGAGACTTGGGG - Intronic
1161291961 19:3498901-3498923 GGTTCCAAAGGAAAGTCTTCAGG + Intronic
1163607507 19:18282958-18282980 CAGTGCAAAGATGTGTCTTCAGG + Intergenic
1163671171 19:18629537-18629559 GGGTGCGAAGAGGAGACTTCAGG + Intergenic
1164561335 19:29294183-29294205 GGGGCCAAAGAGAAGTCCTCAGG + Intergenic
1165582886 19:36884439-36884461 GGGTCCAAAGATGAGTCTTCTGG + Intronic
1165782100 19:38440924-38440946 GGGTCCAAAGAAGAGGGTTCTGG + Intronic
1166206827 19:41275588-41275610 GGATCCAAGGATGGGGCTTCAGG - Intronic
931919064 2:66993041-66993063 GGGAACAAAAATTAGTCTTCTGG - Intergenic
931946329 2:67312601-67312623 TTGTACAAAGATGAGTCCTCAGG - Intergenic
936682146 2:114786338-114786360 GGGTGCAAAGATGTGTTTTTAGG - Intronic
938681652 2:133698345-133698367 GGGTCCTAAGATCAGTTTACTGG + Intergenic
939290382 2:140186710-140186732 GGGTACAAAGCAGATTCTTCTGG + Intergenic
942844407 2:180405204-180405226 GGGACCTAAGATGAGTCTTTGGG + Intergenic
944227937 2:197366692-197366714 GGACCAAAAGTTGAGTCTTCAGG + Intergenic
945295695 2:208169178-208169200 GGGTCCATTGATGAGGCTTGCGG + Intronic
1173906760 20:46635076-46635098 GGGACCAAGGATCAGTCTCCTGG + Intronic
1176265760 20:64208511-64208533 GGGTGAAAGGATGAGTCTGCAGG - Intronic
1179573563 21:42292379-42292401 GGGACCAAAGATGACACTGCAGG + Intronic
1185087529 22:48748923-48748945 GGGTCCCATGATGAGTTTCCTGG + Intronic
952100590 3:30007996-30008018 GGGTCCAAAGATGTATTTTTAGG - Intronic
952879226 3:37972850-37972872 GGTCCCAAAGATGAGTTTTCTGG + Intronic
952978726 3:38718318-38718340 GCATCCATAGATGGGTCTTCTGG - Intronic
954317601 3:49809758-49809780 GGCTCCAAGCATGAGTCTGCAGG - Intronic
958725249 3:97897330-97897352 AGGCCCAAAGATAAGTCTTAAGG - Intronic
970208054 4:13675916-13675938 GGGTCCAAAGTTCACTCTTTGGG - Intergenic
972594457 4:40517457-40517479 GGGTGCAGAGGTGAGTGTTCTGG - Intronic
979390623 4:120122912-120122934 ACGTCAAAAGATGAGTGTTCAGG - Intergenic
980093902 4:128470190-128470212 GGGTCCTGAGATGAGGATTCTGG + Intergenic
980749958 4:137076087-137076109 GGGTCCACAATTGATTCTTCAGG - Intergenic
982605804 4:157515033-157515055 GGGTCAAAAGATGTGTTTTCTGG + Intergenic
984260700 4:177441402-177441424 GGGTCTGAAAATGACTCTTCTGG + Intronic
984421715 4:179531444-179531466 GAGTCCAAAGAGTAGTCTTAAGG + Intergenic
987849621 5:23333630-23333652 GGGTCACAATATGGGTCTTCAGG - Intergenic
990207752 5:53448426-53448448 GCCTCCAAGGTTGAGTCTTCAGG + Intergenic
995384413 5:111573105-111573127 GGGTCCAAGGATGATACTCCTGG + Intergenic
997526004 5:134553783-134553805 TGGTTCAGAGATGAGTCCTCTGG + Intronic
1003592105 6:7445199-7445221 GGATCTGAAGATGATTCTTCAGG + Intergenic
1003601493 6:7521503-7521525 GGGTCCAAAGAGGGGACTTCTGG - Intergenic
1004560284 6:16743281-16743303 AGGTCCAATGATGAATTTTCTGG - Intronic
1006219794 6:32479037-32479059 GGATCCCGAGATGAGTCTGCTGG - Intergenic
1007040460 6:38716483-38716505 GGGTCTAAAGAAGAGTTGTCAGG - Intronic
1012327096 6:97934600-97934622 GGGTTCAAAGCAGGGTCTTCAGG - Intergenic
1016446195 6:144134182-144134204 GGGTCCATCGATGAGTGTTAGGG + Intergenic
1023308775 7:38860418-38860440 GGGAGCACAGAAGAGTCTTCTGG - Intronic
1024000396 7:45185528-45185550 GGGTCCAATGAGGGGTGTTCTGG + Intronic
1031705177 7:124971934-124971956 GAGACAAAAGATGAGACTTCAGG + Intergenic
1032146164 7:129382955-129382977 AGGTCCAAGGATGAGTCTTTGGG - Intronic
1036409690 8:8487954-8487976 GGTTCCAATGAGGACTCTTCCGG + Intergenic
1038439742 8:27563154-27563176 GGGTCCAACGTTCAGTCTTTGGG - Intergenic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1045058572 8:98391846-98391868 GAGTTCTAAGATGAGTCTTTAGG - Intergenic
1046354724 8:113066995-113067017 GGCTCTAAAAATGATTCTTCAGG - Intronic
1047336985 8:123945496-123945518 GGGTTGATAGATGAGCCTTCAGG + Intronic
1047658965 8:127011688-127011710 ATGTCCCAAGGTGAGTCTTCTGG + Intergenic
1047970821 8:130082882-130082904 GTGCTCAATGATGAGTCTTCAGG + Intronic
1048786685 8:138058065-138058087 TGGTCCAAACATAAGTTTTCAGG - Intergenic
1049721305 8:144116694-144116716 CGGTCCCAGGATGAGCCTTCCGG + Exonic
1052998875 9:34566342-34566364 GGCTCCACAGATGAGTGGTCAGG - Intronic
1057637467 9:96783312-96783334 GGGTGCAAAGTTGTGTCTTGTGG + Intergenic
1058308965 9:103476914-103476936 GGATCCCAAGATGAGTCTACAGG + Intergenic
1061036564 9:128117662-128117684 GGGTCCAAAGATGAGTGGCTAGG - Intergenic
1061859722 9:133461703-133461725 GGGTCTACAGATGAAGCTTCAGG + Intronic
1187398816 X:18941390-18941412 GCGTTCAAAGCTGAGTCTACAGG - Intronic
1189480571 X:41389513-41389535 GGGTCCCAAGGTCACTCTTCTGG + Intergenic
1189501869 X:41568573-41568595 TGTTCCAAAAATGATTCTTCTGG - Intronic
1191006607 X:55716991-55717013 GGGTTCAAAGATGTTCCTTCTGG - Intergenic
1196928118 X:120654280-120654302 GGATGCAATGTTGAGTCTTCTGG + Intergenic
1198968467 X:142252417-142252439 GGGTCCAATGATGACACTTTGGG + Intergenic