ID: 1165585794

View in Genome Browser
Species Human (GRCh38)
Location 19:36915117-36915139
Sequence CTCATGTGTGGTGGGTAATG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 164}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165585794_1165585805 2 Left 1165585794 19:36915117-36915139 CCCCATTACCCACCACACATGAG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1165585805 19:36915142-36915164 ATGGAGATCAGAGGAGAATGGGG 0: 1
1: 0
2: 3
3: 50
4: 471
1165585794_1165585804 1 Left 1165585794 19:36915117-36915139 CCCCATTACCCACCACACATGAG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1165585804 19:36915141-36915163 AATGGAGATCAGAGGAGAATGGG 0: 1
1: 0
2: 3
3: 29
4: 366
1165585794_1165585802 -7 Left 1165585794 19:36915117-36915139 CCCCATTACCCACCACACATGAG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1165585802 19:36915133-36915155 ACATGAGGAATGGAGATCAGAGG 0: 1
1: 0
2: 3
3: 25
4: 312
1165585794_1165585803 0 Left 1165585794 19:36915117-36915139 CCCCATTACCCACCACACATGAG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1165585803 19:36915140-36915162 GAATGGAGATCAGAGGAGAATGG 0: 1
1: 0
2: 4
3: 64
4: 625
1165585794_1165585807 29 Left 1165585794 19:36915117-36915139 CCCCATTACCCACCACACATGAG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1165585807 19:36915169-36915191 CTGTCCAATTCCAGTGGCTCAGG 0: 1
1: 0
2: 2
3: 17
4: 157
1165585794_1165585808 30 Left 1165585794 19:36915117-36915139 CCCCATTACCCACCACACATGAG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1165585808 19:36915170-36915192 TGTCCAATTCCAGTGGCTCAGGG 0: 1
1: 0
2: 0
3: 9
4: 161
1165585794_1165585806 23 Left 1165585794 19:36915117-36915139 CCCCATTACCCACCACACATGAG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 1165585806 19:36915163-36915185 GGCATTCTGTCCAATTCCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165585794 Original CRISPR CTCATGTGTGGTGGGTAATG GGG (reversed) Exonic
902811273 1:18889397-18889419 CCCATGCGTGGTGGGGGATGAGG - Exonic
904067699 1:27767139-27767161 CATATATGAGGTGGGTAATGTGG - Intergenic
908556106 1:65257572-65257594 TTCATGTGTGGAGGGAGATGTGG - Intronic
908834149 1:68211705-68211727 CTCATGAGTGGTGAGAAATGGGG - Intronic
909107932 1:71435941-71435963 TACATGTGTGGTGGGTCATGAGG + Intronic
909799142 1:79783706-79783728 CTCAGGGGTGGTGGGCATTGTGG - Intergenic
915138921 1:153754120-153754142 CTCATGTCAGGCAGGTAATGTGG + Intronic
916517792 1:165536188-165536210 TACATATGTGGTGGGGAATGAGG - Intergenic
920578318 1:207079765-207079787 CTCCTGGGTGGTTGGGAATGTGG + Intronic
920588294 1:207190428-207190450 GTCCTGTGTGGTGAGTACTGAGG + Intergenic
921819281 1:219598161-219598183 TTCATGTGTGGTGGGTGGTAAGG - Intergenic
923657663 1:235932263-235932285 CTGCGGTGTGGTGGGGAATGAGG - Intergenic
1072039724 10:91595425-91595447 CTGAGGTGGGGTGGGTAGTGGGG - Intergenic
1072537937 10:96377460-96377482 CTCTTCTGTGGTGGGCACTGTGG + Intronic
1073452037 10:103615851-103615873 CTCATGGCTGGTGGGTGATTGGG + Intronic
1075706735 10:124506712-124506734 TTCAAGTGGGGTGGGTAAGGAGG + Intronic
1075706750 10:124506761-124506783 TTCAAGTGGGGTGGGTAAGGAGG + Intronic
1075855361 10:125625175-125625197 CTCATGTCTGGTGGGAGATTAGG - Intronic
1076409561 10:130236191-130236213 CTTATCCGTGATGGGTAATGGGG + Intergenic
1076874481 10:133209095-133209117 CCCATGTATGGTGTGTGATGTGG + Intronic
1076879711 10:133234212-133234234 CTCCTGTGTGCTGTTTAATGGGG + Intergenic
1078459115 11:11499829-11499851 CTCACAGGTGATGGGTAATGTGG + Intronic
1078581536 11:12542945-12542967 CTCAGGTGTGTTGGGGAATGGGG - Intergenic
1079389600 11:20010052-20010074 CTCATGTGGCTTGGGTAATGAGG - Intronic
1082816317 11:57512171-57512193 ATATTGTGTGGTGGGTACTGAGG + Intronic
1085473237 11:76771473-76771495 CAGATGTGTGGTGGGCAGTGAGG + Intergenic
1087108223 11:94433420-94433442 CTAATGTGTGGTGGAAAAGGAGG - Intronic
1089529612 11:119118023-119118045 CTCATATTTGGTGAGTAGTGTGG - Exonic
1091023962 11:132125665-132125687 GTCATGTGTAGTGCGTAGTGGGG + Intronic
1100351424 12:93787229-93787251 CTCATGGGTGGTGGTTAAACTGG + Intronic
1100907920 12:99322348-99322370 CTGTTGTGGGGTGGGGAATGAGG + Intronic
1102980580 12:117237868-117237890 CTCAGGTGGGGTTGGTGATGTGG + Intronic
1104694709 12:130854385-130854407 CTCATGTGTGTCGGGTATGGTGG - Intergenic
1105292536 13:19061993-19062015 CTCAGGTGTGGTGGGTTCTGGGG - Intergenic
1107127089 13:36857511-36857533 GTCCTGTGTTGTGGTTAATGAGG + Intronic
1107185703 13:37517260-37517282 CACATGTTTGGTGGGTACTATGG + Intergenic
1111733972 13:92114238-92114260 CACACGTGGGGTGGGAAATGAGG - Intronic
1113081947 13:106529460-106529482 CTCATTGGTGGTGGATAATATGG - Intronic
1113678535 13:112225517-112225539 ATCCTGGGAGGTGGGTAATGAGG - Intergenic
1116891184 14:50270329-50270351 TTCAAGTGTGGTGGTGAATGCGG - Intronic
1117101242 14:52350462-52350484 CTTATGTGTGGTGGGGGACGGGG + Intergenic
1118313707 14:64711092-64711114 CTCATCTGGGGTGGGTGAAGTGG - Intronic
1119641702 14:76320107-76320129 ATCATTTAAGGTGGGTAATGAGG + Intronic
1120878170 14:89393587-89393609 CTGAGGTGTGGTGGTTTATGGGG - Intronic
1122229712 14:100299699-100299721 CTCCTGTGAAATGGGTAATGAGG - Intronic
1122526773 14:102391735-102391757 CCCATGTATAGTGGGTAATGGGG - Intronic
1125838171 15:42772448-42772470 CTCATGTGTGGTCTCTCATGAGG - Intronic
1127859912 15:62985282-62985304 CTCCTTTGTGAAGGGTAATGAGG - Intergenic
1128464784 15:67901109-67901131 CTTATGTGTGGTGGGAGATAGGG + Intergenic
1130201080 15:81827456-81827478 CTCATGTGGACTGGGTAAAGAGG - Intergenic
1132767184 16:1540373-1540395 CTCAGGGGTGGTGGGGGATGCGG - Intronic
1133104151 16:3495744-3495766 CTCATCTGGGGTGGGAAATGAGG + Intergenic
1135315165 16:21438827-21438849 CTCTTGTGTGGTGGGGGAGGGGG + Intronic
1135368091 16:21871095-21871117 CTCTTGTGTGGTGGGGGAGGGGG + Intronic
1135443726 16:22500054-22500076 CTCTTGTGTGGTGGGGGAGGGGG - Intronic
1135499041 16:22977943-22977965 CCCATGAGTGGTGGGTACAGAGG + Intergenic
1136311830 16:29417488-29417510 CTCTTGTGTGGTGGGGGAGGGGG + Intergenic
1136325272 16:29519284-29519306 CTCTTGTGTGGTGGGGGAGGGGG + Intergenic
1136368025 16:29818135-29818157 GGCATGTGGGGTGGGAAATGGGG - Intronic
1136439959 16:30259266-30259288 CTCTTGTGTGGTGGGGGAGGGGG + Intergenic
1142675849 17:1512743-1512765 GTCAGGTGTGGTGGGTACTTTGG - Intronic
1142936390 17:3336812-3336834 ATCATGTGTGCTGGGTTCTGAGG - Intergenic
1143185364 17:5006987-5007009 ATTATGTGTGGTGGGTGATGAGG - Exonic
1148320679 17:46749427-46749449 CACATGTATGGTGGGAATTGGGG - Intronic
1150437998 17:65168899-65168921 CTTCTGTGTGCTGGGGAATGAGG - Intronic
1152037108 17:77880321-77880343 GTCCTGTGTGGTGGGGAAAGGGG + Intergenic
1152852033 17:82642595-82642617 CTCATGCATGGTGGGGACTGGGG + Intronic
1153916536 18:9750564-9750586 CTTACGTGTGGTGGGCACTGTGG + Intronic
1155313933 18:24552435-24552457 GACATGTGTGGTGGGTGATAGGG + Intergenic
1156430125 18:37063323-37063345 CTTATGTGGGGTGGGGGATGAGG + Intronic
1158364352 18:56715103-56715125 CTCATGAGGGGTTGATAATGCGG + Intronic
1158366456 18:56742853-56742875 GACAGGTGTGGTGGGAAATGAGG + Intronic
1158882340 18:61792552-61792574 CTCATGTGTGGAAGGCACTGTGG - Intergenic
1158959437 18:62576608-62576630 CTCAAGTGTGGGGAGTCATGGGG + Exonic
1159165940 18:64700283-64700305 GTCTTGTGTGGTGAGTATTGAGG - Intergenic
1162009621 19:7804354-7804376 CTCTTGTGTGTTGGGGAGTGGGG - Intergenic
1164290202 19:23861386-23861408 CCTCTGTGTGGTGGGTAGTGGGG - Intergenic
1165585794 19:36915117-36915139 CTCATGTGTGGTGGGTAATGGGG - Exonic
925634382 2:5928569-5928591 CACATGTCTGGTGGTTCATGGGG + Intergenic
926099287 2:10103708-10103730 CTTTTGAGTGGTGGGTAAAGAGG + Intergenic
926165779 2:10521663-10521685 CTGATGTGGGGTGGGTTTTGTGG + Intergenic
926245139 2:11117749-11117771 CTCATGTCTAGTGGGTGGTGAGG - Intergenic
928443946 2:31316474-31316496 CTAATTTGTGGTGGGTACAGTGG - Intergenic
929231933 2:39568956-39568978 CTCATCTGAGATGGGGAATGAGG - Intergenic
929597884 2:43187474-43187496 TTCATGTGTGGTGGGAGATGGGG - Intergenic
931844901 2:66193521-66193543 CTCATGGGTGGTGGGGGCTGGGG - Intergenic
936154504 2:110039546-110039568 CGCATGTGTGGTTGTTATTGAGG - Intergenic
936190178 2:110331868-110331890 CGCATGTGTGGTTGTTATTGAGG + Intergenic
937880729 2:126862659-126862681 CTTATGAGTGGTTGGAAATGTGG - Intergenic
940320913 2:152375375-152375397 CTCATGCCTGGTAGGTTATGAGG + Intronic
943221930 2:185120563-185120585 CTGTTGTGGGGTGGGGAATGGGG + Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
948568745 2:238903281-238903303 CTAATGTGAGGTGTGTGATGTGG + Intronic
948996877 2:241585381-241585403 CAGATGTGTGGGGGGTCATGTGG + Intronic
1168875996 20:1172684-1172706 CTCCAGTGTGGTGGGTGAGGGGG + Intronic
1172079296 20:32326683-32326705 CTCATGCATGGTGAGTAATCAGG - Intronic
1172703597 20:36866850-36866872 CACATGTCTGGTGGTTAGTGGGG - Intergenic
1174186332 20:48708795-48708817 CACATGTCTGGTATGTAATGAGG + Intronic
1174218074 20:48932434-48932456 TTCATTCGTGGTGGGTAATTGGG + Intronic
1178134195 21:29608241-29608263 CTCATGTGTATAAGGTAATGGGG + Intronic
1178381990 21:32117868-32117890 CTCAGGTGTGGAGGGAAATGGGG - Intergenic
1178817211 21:35942460-35942482 CAAATGTGTGATGTGTAATGAGG - Intronic
1178817214 21:35942505-35942527 CAAATGTGTGATGTGTAATGAGG - Intronic
1178817225 21:35942687-35942709 CAGATGTGTGATGTGTAATGAGG - Intronic
1179370630 21:40803361-40803383 CAGACTTGTGGTGGGTAATGGGG - Intronic
1179409395 21:41150672-41150694 GTGATGTGTGGTGTGTAGTGTGG + Intergenic
1182482305 22:30617088-30617110 ATCTTGGGTGGTGGGGAATGAGG + Intronic
949257194 3:2062534-2062556 CCCATGTTTTGTGGTTAATGTGG - Intergenic
949732795 3:7133350-7133372 CTCATGTGTGCGTGGTATTGGGG - Intronic
954750970 3:52813533-52813555 CTCAGGTGTGGTGCGAAAAGAGG + Intronic
958453494 3:94302287-94302309 CTCATGTGTGCTGGGTAAGCTGG + Intergenic
961869787 3:129978929-129978951 TTCAGGTGGGGTGGGGAATGGGG + Intergenic
962269522 3:133967820-133967842 TTCATGTGTGGGGGGTATGGAGG - Intronic
962269556 3:133967920-133967942 CACATGTGTGGGGGGTATGGAGG - Intronic
962624261 3:137209947-137209969 GTCATGTATGGTGCCTAATGAGG + Intergenic
964330628 3:155598346-155598368 CTCGTGTGAGATGGTTAATGTGG - Intronic
969638923 4:8385240-8385262 GTCATGTGAGGTGGGCAGTGGGG - Intronic
969881149 4:10175128-10175150 CTCGTCTGAGATGGGTAATGTGG + Intergenic
970253373 4:14140820-14140842 CTGTTGTGGGGTGGGGAATGGGG + Intergenic
970723378 4:19014280-19014302 CACATGTGTGGTGTGGAAGGTGG + Intergenic
971043721 4:22782055-22782077 CTCAAGTGGCGTGGGTAAGGGGG + Intergenic
973930670 4:55790403-55790425 CTAAGGTCTGGGGGGTAATGGGG + Intergenic
975426202 4:74230908-74230930 CAGATGGGTGGAGGGTAATGTGG - Intronic
976035925 4:80820756-80820778 CTAATGTGTGCTGGGCAATATGG - Intronic
977033604 4:91920376-91920398 TTCATGTGTGGTGAGAAATAGGG + Intergenic
977147169 4:93458386-93458408 CACATGTCTGGTGGTTGATGCGG + Intronic
980715337 4:136620117-136620139 CTCATGTAAGGTGGCTTATGCGG - Intergenic
983136890 4:164095218-164095240 CTATTGAGTGGTGGCTAATGAGG - Intronic
987946432 5:24615073-24615095 ATCATGGATTGTGGGTAATGTGG - Intronic
988149035 5:27351918-27351940 CTAATATGTGGTGGGAATTGTGG + Intergenic
990024523 5:51169193-51169215 ATGATGTGAGGTGGGGAATGAGG - Intergenic
990926232 5:61027671-61027693 CTCAAGTGGGGTGGGCAAGGAGG - Intronic
992264981 5:75009508-75009530 GTTATGTGAGGTGGGAAATGAGG + Intergenic
997384175 5:133459337-133459359 TTCATGGGTGGTGGCTGATGGGG - Intronic
999561607 5:152809549-152809571 GTAATGTGTGGTGGGTTGTGGGG - Intergenic
1001439584 5:171731373-171731395 CTTGTGTGTGGTGGGAAATAGGG - Intergenic
1004880704 6:20004355-20004377 CTCCTATGTGGTGGGTGAGGTGG + Intergenic
1009418454 6:63440654-63440676 CTCAGGTGTGGTGGGTTGGGTGG + Intergenic
1009566375 6:65316430-65316452 TTCATGTGTGGTGGGTGGTAAGG + Intronic
1010491758 6:76485353-76485375 TTTATGGGTGGAGGGTAATGAGG + Intergenic
1011467439 6:87673029-87673051 ATCATGTGTGGTTGGTTATTTGG + Intergenic
1019880886 7:3859750-3859772 CACAGGTGTGGTGGGCAGTGTGG - Intronic
1024599035 7:50963343-50963365 CTCATCTTTGCTGGATAATGAGG + Intergenic
1025009341 7:55383307-55383329 CCCATGTGTGGTGGATGAGGAGG + Intronic
1025154600 7:56593142-56593164 CTTCTGTGTGGTGGATAGTGGGG - Intergenic
1028625054 7:92868614-92868636 CACATGTGTGGTGTGGCATGTGG - Intergenic
1029489805 7:100864692-100864714 CTCATATCTGGTAGGTACTGGGG - Intronic
1029623366 7:101703914-101703936 CTCATATGTGGTAAGTAATTAGG - Intergenic
1029999122 7:105039260-105039282 CTCAAGTGTGGTGTGTACTGAGG + Intronic
1030011567 7:105173651-105173673 TTCTTGTGTGCTGGGCAATGTGG - Intronic
1031419129 7:121528635-121528657 CTCATGTGTAATTGGTAATTTGG + Intergenic
1032708032 7:134439114-134439136 CTCATGGGTGGAGGGGAATGTGG + Intergenic
1033141884 7:138834555-138834577 CTCATGTCTGCTGGGTTATTTGG + Intronic
1033197859 7:139342447-139342469 CTAAGGTGTGGTGGGTGAAGTGG + Intronic
1036077075 8:5513873-5513895 CTCAGGTTTGGTGGTGAATGGGG + Intergenic
1037950659 8:23017109-23017131 CTCATGTGCCGTGGGTCATGGGG + Intronic
1037971149 8:23172837-23172859 CTCATCTGAGGTGGGAAAAGTGG + Intergenic
1041577168 8:59411522-59411544 CTGATGTGTTGTGGGAAACGAGG + Intergenic
1044739233 8:95308622-95308644 ATGATGTGGGGTGGGAAATGAGG - Intergenic
1044776510 8:95694430-95694452 GTGATGTGTGGTTGCTAATGAGG - Intergenic
1048441263 8:134460828-134460850 GGCGTGTGTGGTGTGTAATGTGG + Intergenic
1049232142 8:141489932-141489954 CTGAGGGGTGGTGGGCAATGGGG + Intergenic
1049570745 8:143369232-143369254 CTCATGTGAGCCGGGAAATGCGG + Intronic
1050203966 9:3178130-3178152 CTCATGTGTACTTGGTATTGTGG + Intergenic
1050288383 9:4128290-4128312 CACATGTGTGATGGGAGATGTGG - Intronic
1052461166 9:28765434-28765456 CCAATGTGTGGTGGGGAAGGTGG + Intergenic
1054952463 9:70868245-70868267 GTCATGTGTGATGTGTAATAGGG + Intronic
1056811865 9:89771316-89771338 CTTATCTGTGGTGGGCAATTTGG + Intergenic
1059326248 9:113505551-113505573 CACATGTGTGGTGGGCAAGTGGG - Intronic
1062452622 9:136621889-136621911 CGCAGGTGGGGTGGGTAACGGGG + Intergenic
1062730626 9:138106271-138106293 CTCCTCTGTGGTGGGGAAGGTGG - Intronic
1186404096 X:9286450-9286472 CACAAGTGTGTTGGGTAATGAGG + Intergenic
1186443420 X:9605208-9605230 CTCATGTGTGGGCTCTAATGAGG - Intronic
1186846374 X:13534743-13534765 CTCATGTTTGGGGGAGAATGAGG + Intergenic
1187664980 X:21597218-21597240 CTAACTTGGGGTGGGTAATGAGG - Intronic
1189164434 X:38846716-38846738 CTCATCTGTGGTGGGTTTTGGGG + Intergenic
1192330811 X:70173866-70173888 TGCATGTGTGTTGGGTTATGGGG - Intergenic
1193004736 X:76602945-76602967 TTCATGCCTGTTGGGTAATGGGG + Intergenic
1198949063 X:142049401-142049423 CTCAAGTGTGGTTAGTAAGGGGG - Intergenic
1200093357 X:153646201-153646223 CTCAGGTGTGGTGAGCACTGAGG - Intronic
1201949580 Y:19549311-19549333 CTCATCTGTAGTGAGTAGTGGGG + Intergenic