ID: 1165592645

View in Genome Browser
Species Human (GRCh38)
Location 19:36983423-36983445
Sequence ACATTAACACGACTGCCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165592645 Original CRISPR ACATTAACACGACTGCCTTA TGG (reversed) Intronic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
919600794 1:199619919-199619941 ACATTAACACTACTCCATTAAGG + Intergenic
920749978 1:208664741-208664763 ACATTATCTCAACTGCCTTTTGG + Intergenic
1064685818 10:17860080-17860102 ACATTAATACCACAGCCTTTAGG + Intronic
1069917232 10:71795158-71795180 ACATTACAATGACTGCCTGAGGG + Intronic
1073421509 10:103427401-103427423 ACATTAGCAGCACTGTCTTACGG + Intronic
1078634015 11:13031966-13031988 ACATTGGCAAGATTGCCTTATGG - Intergenic
1088637523 11:111837522-111837544 ACATTCACAGGTCTGCCTTCTGG + Exonic
1094274070 12:28648733-28648755 ACATTAACACAACTATCTTTTGG - Intergenic
1096496431 12:52041874-52041896 ACATTATCCCGTCTGCCTTCAGG - Exonic
1104216436 12:126738579-126738601 AGATTAACGCAACTACCTTAAGG - Intergenic
1108014547 13:46060819-46060841 AAATTAACATGACTGCTTAATGG - Intronic
1108824318 13:54393138-54393160 ACATTAACACAATTGTGTTAAGG + Intergenic
1110689112 13:78411279-78411301 ACATTAACATGAATGCCAGAAGG + Intergenic
1115456626 14:33611570-33611592 ACTCTAACACTACTGCCTCAAGG + Intronic
1130434607 15:83885346-83885368 TCATTAACACGATTGCATTCAGG - Intronic
1143025112 17:3937088-3937110 ACACACACACGACTGCCTAAAGG + Intronic
1151466471 17:74288996-74289018 TCACTACCACGACTGACTTAGGG + Intronic
1159273363 18:66182607-66182629 ACATAAACACCCCAGCCTTAAGG + Intergenic
1160183366 18:76655292-76655314 ACATTCACACCACAGCCTTGTGG + Intergenic
1163933800 19:20423786-20423808 ACAAAAACAAAACTGCCTTAGGG - Intergenic
1165592645 19:36983423-36983445 ACATTAACACGACTGCCTTATGG - Intronic
929110106 2:38399112-38399134 ACACTAACCCGATTTCCTTATGG - Intergenic
937788327 2:125928717-125928739 ACTTGAACACTACTGCCTCATGG + Intergenic
938664719 2:133522826-133522848 ACATTAACACTACTCGGTTATGG - Intronic
942273450 2:174300194-174300216 ACAATAACCTGACTGCCTTGCGG - Intergenic
943196345 2:184755416-184755438 ATATGAACATGATTGCCTTAGGG - Intronic
943726336 2:191255444-191255466 ACATTCACACAGCTGCCTGAAGG + Intronic
1179161192 21:38900817-38900839 CTTTTAACACCACTGCCTTATGG - Intergenic
1179368621 21:40782910-40782932 ACTTTAACATGACTGCCCTGAGG + Intronic
1182554635 22:31122666-31122688 GCATTAACACACCTGCCTTAAGG - Intergenic
959860949 3:111214333-111214355 ACATTAACAGCACTCCTTTATGG + Intronic
964414327 3:156431573-156431595 ACATTCATAGGAATGCCTTAAGG + Intronic
971273916 4:25177363-25177385 ACATTAAAAAGACTGCTTTCAGG + Intronic
972416612 4:38847251-38847273 ACTTTAACAGGAATGCCTTGGGG - Intronic
985244026 4:187961359-187961381 ACATTATCCCCACTCCCTTAAGG + Intergenic
990293069 5:54374618-54374640 ACTTTAAAACAACTGTCTTAAGG - Intergenic
991443142 5:66672382-66672404 ACATTAAAATGACTGCCTGTGGG - Intronic
993325310 5:86527019-86527041 ACATTATCTCTACTGCCTTTTGG + Intergenic
995072277 5:107938162-107938184 ACATGAAAACAACTGCTTTATGG + Intronic
995505401 5:112855030-112855052 ACTTTAAAACAACTGTCTTAAGG - Intronic
996959584 5:129230956-129230978 CAATTAACACGACTACGTTAAGG - Intergenic
998893752 5:146774916-146774938 ACATTACCAAAACTGACTTAAGG + Intronic
999406404 5:151310835-151310857 ACCTAAACAAGACTACCTTAAGG - Intergenic
1010435405 6:75824298-75824320 ACATTAACACTGCTGCCATCTGG - Intronic
1011982704 6:93403045-93403067 ACATAAACAAGACTGTCTTCTGG - Intronic
1033491844 7:141852061-141852083 ACATTAAAATCACTGCCTTAAGG - Intergenic
1044444786 8:92263049-92263071 AAATTAACACTAATTCCTTATGG - Intergenic
1049763836 8:144343717-144343739 ACATTTACAAGACTGCCCTAGGG - Intergenic
1052490599 9:29161698-29161720 ACTTTAAAACCACTCCCTTATGG + Intergenic
1186236865 X:7521593-7521615 ACATTAAAATGACTCCCATAGGG + Intergenic
1201893944 Y:18973583-18973605 AAATTAACATGAATGCCTTTTGG - Intergenic