ID: 1165593151

View in Genome Browser
Species Human (GRCh38)
Location 19:36988377-36988399
Sequence TCCTGAACAGCCTGTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 9, 3: 33, 4: 293}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165593151_1165593156 10 Left 1165593151 19:36988377-36988399 CCAGCTCCACAGGCTGTTCAGGA 0: 1
1: 0
2: 9
3: 33
4: 293
Right 1165593156 19:36988410-36988432 TGGCATCTGCTCCGCTTCTGGGG 0: 2
1: 308
2: 653
3: 844
4: 902
1165593151_1165593154 8 Left 1165593151 19:36988377-36988399 CCAGCTCCACAGGCTGTTCAGGA 0: 1
1: 0
2: 9
3: 33
4: 293
Right 1165593154 19:36988408-36988430 GCTGGCATCTGCTCCGCTTCTGG 0: 2
1: 283
2: 658
3: 818
4: 1108
1165593151_1165593153 -10 Left 1165593151 19:36988377-36988399 CCAGCTCCACAGGCTGTTCAGGA 0: 1
1: 0
2: 9
3: 33
4: 293
Right 1165593153 19:36988390-36988412 CTGTTCAGGAAGCATGATGCTGG 0: 4
1: 261
2: 589
3: 865
4: 1209
1165593151_1165593157 11 Left 1165593151 19:36988377-36988399 CCAGCTCCACAGGCTGTTCAGGA 0: 1
1: 0
2: 9
3: 33
4: 293
Right 1165593157 19:36988411-36988433 GGCATCTGCTCCGCTTCTGGGGG 0: 1
1: 10
2: 27
3: 62
4: 211
1165593151_1165593155 9 Left 1165593151 19:36988377-36988399 CCAGCTCCACAGGCTGTTCAGGA 0: 1
1: 0
2: 9
3: 33
4: 293
Right 1165593155 19:36988409-36988431 CTGGCATCTGCTCCGCTTCTGGG 0: 3
1: 352
2: 697
3: 780
4: 853
1165593151_1165593158 19 Left 1165593151 19:36988377-36988399 CCAGCTCCACAGGCTGTTCAGGA 0: 1
1: 0
2: 9
3: 33
4: 293
Right 1165593158 19:36988419-36988441 CTCCGCTTCTGGGGGTGCTCAGG 0: 1
1: 0
2: 3
3: 20
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165593151 Original CRISPR TCCTGAACAGCCTGTGGAGC TGG (reversed) Intronic
900434833 1:2624822-2624844 TCCTGTACAGCCTGAGGAACTGG - Intronic
900576665 1:3385945-3385967 CCCTGATCAGCCTGTGGGTCTGG - Intronic
900826296 1:4929873-4929895 ACCTGAACAGGGTGTGGAACTGG + Intergenic
901147371 1:7074946-7074968 TCTTGAAACCCCTGTGGAGCTGG + Intronic
901600448 1:10419535-10419557 TCCAGGTAAGCCTGTGGAGCAGG + Exonic
902569118 1:17335709-17335731 TCATGAAGAGCCCGTGGGGCTGG + Intronic
902934026 1:19751394-19751416 TCCAGAACAGCCTGGGCAACAGG + Intronic
903257287 1:22111342-22111364 ACCTGAGCAGCTTGGGGAGCAGG + Intergenic
904060372 1:27704981-27705003 TCCTGTATAGCCTGTAGAACCGG - Intergenic
905022580 1:34828045-34828067 TAGAGAACAGCCTGTGGAACAGG - Intronic
905055299 1:35088301-35088323 GCCTGAGCATCCTGTGTAGCTGG - Intronic
905525942 1:38639652-38639674 TCCTGTACAGCCTATGCAACTGG - Intergenic
905578159 1:39062584-39062606 TCCTGCCCAGCCTGAGTAGCTGG - Intergenic
906223706 1:44103744-44103766 TGCCGAGCAGCCTGAGGAGCTGG - Intergenic
906478272 1:46184409-46184431 TGGTCATCAGCCTGTGGAGCTGG - Intronic
907379012 1:54069922-54069944 TCCTGGACTCCCTGGGGAGCTGG - Intronic
907499972 1:54871874-54871896 TCCTGAATAGCCTCTGGGTCAGG - Intronic
910200679 1:84695385-84695407 TCCTGCACAGCCTGCAGAACCGG - Intergenic
910898248 1:92091345-92091367 TCCTGTACAGCCTGGGGAACTGG + Intronic
912554786 1:110508197-110508219 TCCTCAGCAGCTGGTGGAGCTGG + Intergenic
912968581 1:114259034-114259056 TCCTGAAAAGCCTGTCGAGGTGG - Intergenic
913147550 1:116007215-116007237 TCCAGAACAACATGGGGAGCAGG + Intronic
916142484 1:161711566-161711588 TCATCAACAGACTATGGAGCAGG + Intronic
917240679 1:172945269-172945291 TCCTGAACTGCCTGTGGAAAAGG + Intergenic
919561927 1:199132070-199132092 TCCTGTAGGGCCTGTGGAACTGG - Intergenic
920652938 1:207852283-207852305 TCCTGAAAGGACTGTGGAGATGG - Intergenic
923449499 1:234103415-234103437 TCATGCACAGCCTGTGGACTCGG - Intronic
923456488 1:234169638-234169660 GCCTGGACTTCCTGTGGAGCAGG - Intronic
923724207 1:236492478-236492500 TCCTCAACAGCCTGTAGATGAGG + Intergenic
923829515 1:237539536-237539558 TACTGTGCAGCCAGTGGAGCCGG + Intronic
923999726 1:239537286-239537308 TCCTGTACAGCCTGCAGAACCGG - Intronic
1062858291 10:790460-790482 ACCTGACGAGCCCGTGGAGCAGG + Intergenic
1064014752 10:11763274-11763296 TGCTAAGCAGCCCGTGGAGCAGG - Exonic
1064291033 10:14034236-14034258 TCCTCCACAGCCTAGGGAGCAGG - Intronic
1065436835 10:25711492-25711514 TCCTGTACAGCCTGTGGAACTGG - Intergenic
1066058473 10:31702318-31702340 TCCTGTACAGCCTGTGAAACTGG + Intergenic
1066671510 10:37845134-37845156 ACCTGAACTTCCTGAGGAGCTGG + Intronic
1066674350 10:37872792-37872814 TTCTGCACAGCCTGTGCTGCTGG + Intergenic
1067026910 10:42850606-42850628 TCCTGATCTGGCTGAGGAGCAGG - Intergenic
1067092357 10:43274453-43274475 TCCAGAGCAGCCTGTGTGGCTGG + Intergenic
1067478731 10:46582188-46582210 TCAGGTACAGCCTCTGGAGCAGG + Exonic
1068894082 10:62180447-62180469 TCCTGGCCAGCCTGGGAAGCTGG + Intergenic
1068910055 10:62369570-62369592 ACCTGTGGAGCCTGTGGAGCTGG - Intergenic
1069643540 10:69973436-69973458 TCCTGAGCTGCAGGTGGAGCAGG - Intergenic
1070725008 10:78781790-78781812 TCCTGTGGAGCCTGTGGAGATGG + Intergenic
1070978957 10:80629110-80629132 TCCTGTACAGCCTATAGAACTGG - Intronic
1071355399 10:84788863-84788885 TCCTGAAGAGCCTGTGCGGCAGG - Intergenic
1072258716 10:93646535-93646557 TCCTGTACAGCCTGCAGAACCGG - Intronic
1072636250 10:97180321-97180343 TCATGACCACCCTTTGGAGCAGG + Intronic
1074358602 10:112807218-112807240 TCCAGACCAGCATATGGAGCTGG - Intronic
1076523499 10:131095376-131095398 TCCTGAGCAGCCTGTGGGAATGG - Intronic
1076980652 11:202840-202862 TCATGGCCAGCCTGTGGACCAGG + Intronic
1077202228 11:1315949-1315971 TCCTGAACAACCACTGGATCAGG - Intergenic
1077239488 11:1503116-1503138 GCCTGCAGAGCCTGTGGAGAAGG + Intergenic
1077402904 11:2367828-2367850 TCCGGAAGAGCCTCTAGAGCGGG + Intergenic
1080056800 11:27915180-27915202 TCCTGTACAGCCTGCAGAACTGG - Intergenic
1080192886 11:29572079-29572101 TCCTGTACAGCCTAAGGAACTGG - Intergenic
1080641739 11:34162395-34162417 TCCTGAACTGGCCGTGTAGCAGG + Intronic
1081102366 11:39020858-39020880 GCCTGAACAACCTGTAGAGATGG + Intergenic
1081940083 11:46934167-46934189 TCCTGAACAGTCTATTGAGGAGG - Intergenic
1083913950 11:65727946-65727968 TGCTGAGCAGCGTGGGGAGCTGG + Intergenic
1084563059 11:69914886-69914908 TCCTTGACAGACTCTGGAGCAGG + Intergenic
1085850835 11:80117809-80117831 TCCTGATGACCCTGTGAAGCAGG - Intergenic
1086527617 11:87746948-87746970 TCCTCAGCACCCTGTGGAGAGGG + Intergenic
1087329552 11:96762930-96762952 TCTGGAACAGCCTGTGAAGTTGG + Intergenic
1089332131 11:117696950-117696972 CCCTGAAGAGTCTGTGGAGGAGG - Intronic
1089681076 11:120119325-120119347 TCCTTAGCAGCCTGTGGGGAGGG + Intronic
1089734013 11:120537269-120537291 TCCTAAAGAACCTGTGGACCAGG - Intronic
1090424277 11:126596132-126596154 TGGTGAACAGCCTATGGAGAAGG - Intronic
1091489019 12:916757-916779 TCTTGAACCGTCTGTGGAGGAGG - Exonic
1094160102 12:27381362-27381384 TCCTGCACAGCCTGTGGAACCGG - Intronic
1094291317 12:28853302-28853324 TTCTCAACAGCCTGTGGTTCTGG + Intergenic
1096617169 12:52839933-52839955 TGCTGAGCAGCGTGGGGAGCTGG - Exonic
1097405402 12:59183225-59183247 TCCTCAGCCGCCTGAGGAGCGGG - Intergenic
1097566430 12:61275230-61275252 TACTGAACAGGCTGAGGAGACGG - Intergenic
1098218643 12:68245589-68245611 CACTGCACAGCCTGTGGAGCAGG + Intergenic
1098264701 12:68706640-68706662 TGCTGAGCAGCATGGGGAGCTGG + Intronic
1102234005 12:111282871-111282893 TTCTGAACAGCCTTTGGTGGGGG - Intronic
1102566957 12:113803188-113803210 TGCCAAACAGCCTGGGGAGCGGG - Intergenic
1104262304 12:127195490-127195512 TCCTGAACTTTCTGTGAAGCCGG + Intergenic
1104311583 12:127658018-127658040 TCTTGTACATCCTGTGGAACTGG + Intergenic
1104440889 12:128792200-128792222 TCCTGGACAGCCTCAGGAGAGGG - Intergenic
1104831126 12:131752557-131752579 TCCTGCACAGCCTGTGTTGCTGG + Intronic
1105793208 13:23823530-23823552 TTCTTAACAGCATTTGGAGCTGG + Intronic
1105869890 13:24495526-24495548 TCCCAAACTGCCTGTGGAGGCGG + Intronic
1105983151 13:25539508-25539530 TGCTGAACAACCTGTTGAGGAGG + Intronic
1107142539 13:37017244-37017266 TCCTCAACAGCCAGGGGAGCAGG - Exonic
1109163098 13:59001146-59001168 TTGTGAACTGCCTGTGGAGATGG - Intergenic
1113487596 13:110665689-110665711 CCCTGAACTGTCTGAGGAGCTGG - Intronic
1115167231 14:30462876-30462898 TCCTGAAAGGCCTGTGGGGTTGG - Intergenic
1115872796 14:37824142-37824164 TCTGGATCAGCCTGGGGAGCTGG + Intronic
1116998130 14:51345697-51345719 TCCTGTCCAGCATGTGGAACTGG + Intergenic
1116999717 14:51360231-51360253 TTCTTAAAATCCTGTGGAGCAGG + Intergenic
1119007554 14:70945137-70945159 TCCTGGATAGCCTCAGGAGCCGG - Intronic
1120101707 14:80451755-80451777 TCCTGTTAAGCCTGTGGAACTGG + Intergenic
1120174146 14:81275758-81275780 CCCTGGACTGCCTGGGGAGCTGG + Intronic
1120230428 14:81835594-81835616 TCCTGTACAGCCTGTGGAACTGG + Intergenic
1120230714 14:81837577-81837599 TCCTGTACAGCTTGTGGAACTGG + Intergenic
1120678991 14:87456594-87456616 ACCTGAACCTCCTGAGGAGCTGG - Intergenic
1121318676 14:92977764-92977786 TTCTGTATAGCCTGTGGAACCGG + Intronic
1121322370 14:92999488-92999510 TCCTAAGCAGCGTGTGGAGCAGG - Intronic
1122822787 14:104355491-104355513 TTCTCAACAGCCTGGGGAGGTGG - Intergenic
1122831715 14:104400864-104400886 TCCTGTACAGCCTGCAGAACTGG + Intergenic
1126746054 15:51827739-51827761 TCCTGAGTAGCCTGAGCAGCTGG - Intergenic
1127776187 15:62265953-62265975 TCCTGACAAGCCAGAGGAGCAGG - Intergenic
1128596202 15:68952393-68952415 TCCTGTACAGCCTGTGGAACCGG + Intronic
1128722219 15:69958408-69958430 TCCTAAACAGCCTGTGAATCAGG + Intergenic
1129093735 15:73181486-73181508 TCCTGTACAGCCTGTGGAACTGG - Intronic
1129127698 15:73458679-73458701 TCCTAGACAGCTTGTGGAGGAGG + Intronic
1129347432 15:74931913-74931935 TTCTGAACAGCCTCTGGAACAGG + Intronic
1130137881 15:81197033-81197055 TCCCGGACAGCCTGTGGCCCAGG - Intronic
1131395762 15:92084732-92084754 CGTTGAACAGCCTGTGGGGCTGG - Intronic
1132164134 15:99567494-99567516 TCTTGAACAGTCTGTGGAAAAGG + Intronic
1133773634 16:8882215-8882237 GCTTGAACAGCCTTTGGAGATGG - Intergenic
1135397042 16:22139178-22139200 TCCAGGAGAGCCTGTGCAGCCGG + Intronic
1135975685 16:27107905-27107927 CCCTGAAGAGCCACTGGAGCTGG + Intergenic
1138098262 16:54230737-54230759 TCCAGAACAGCCTGGGCAACTGG + Intergenic
1138388426 16:56652339-56652361 TCCTGGACTGTGTGTGGAGCTGG + Intronic
1138454410 16:57113070-57113092 GGCTGGACAGCTTGTGGAGCAGG - Intronic
1139372547 16:66477940-66477962 TACTCAACAGCCTGAGGAGGTGG - Exonic
1139526843 16:67521979-67522001 TCCAGAACAGCCTGCATAGCAGG - Intronic
1139554339 16:67697070-67697092 TCCTGACCAGCATGTGGTGATGG - Intronic
1139962930 16:70728260-70728282 TCCTGAGCACGCTGAGGAGCTGG + Intronic
1140985792 16:80156959-80156981 TCCAGGGCAGCCTGAGGAGCTGG - Intergenic
1143617617 17:8063215-8063237 TCCTGCATAGCCTGAGGAGGAGG + Intergenic
1145781456 17:27566455-27566477 TCATGAATCGCCTGTGGAGCTGG + Intronic
1145991222 17:29080540-29080562 TCCTGGAGAGGCTGTCGAGCCGG + Intronic
1146027943 17:29339196-29339218 TCCTCAGCTGCCTGTGTAGCTGG + Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146878139 17:36429073-36429095 GCCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147467853 17:40625560-40625582 TCGTGAACAGGCAGTGAAGCTGG - Exonic
1149010643 17:51853306-51853328 TGCAGAACAGCCTGAGGATCAGG - Intronic
1149446201 17:56715101-56715123 TCCTGTAAAGCCTGTGGAACTGG + Intergenic
1149685151 17:58530969-58530991 CACTGACCAGCCTGTGGGGCGGG - Intronic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150011211 17:61505962-61505984 TCCCTAACAGCCTGTGTAGATGG + Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1151660605 17:75516276-75516298 TCCAGTAAAGCCTGAGGAGCCGG - Intronic
1151949580 17:77343151-77343173 TCCTGGACAGCCTGGGGATAAGG + Intronic
1153979283 18:10295559-10295581 GCCTGCACAGCCTGGGGACCAGG - Intergenic
1157675519 18:49565750-49565772 TCCTTAAGAGCCAGTGGAGCTGG - Intronic
1158317840 18:56231149-56231171 TCCTGTATAGCCAGTGGAACTGG + Intergenic
1159005304 18:63005305-63005327 ACCTCTACAGCCTGTGGAGAGGG + Intergenic
1159819330 18:73119839-73119861 TCCTGTACAGCCTGTGGAACTGG + Intergenic
1159988312 18:74872177-74872199 CACTGATCAGCCTGTGGAGGGGG - Intronic
1160301848 18:77688661-77688683 TTCTGTACAGCCAGTGGAACTGG + Intergenic
1160854360 19:1209721-1209743 TCCTGAACAGTCAGTGGAGGAGG + Intronic
1161646477 19:5456303-5456325 TCCTGAACCACCTGTGGCTCTGG + Exonic
1163317644 19:16552447-16552469 GCCTCAGCAGCCTGAGGAGCTGG + Exonic
1163324932 19:16597289-16597311 TCCTGCACTGCCTGTGAAGTGGG - Intronic
1165593151 19:36988377-36988399 TCCTGAACAGCCTGTGGAGCTGG - Intronic
1166113532 19:40638499-40638521 TCCTCAACCCCCTGTGTAGCTGG - Intergenic
1166164104 19:40974763-40974785 GCCTGAGTAACCTGTGGAGCTGG - Intergenic
1168037943 19:53735249-53735271 TCCTGAGCTTCCTGAGGAGCTGG + Intergenic
1168324506 19:55531065-55531087 TCCTGAGCAGCCTGGGCCGCAGG - Intronic
928099246 2:28425752-28425774 TCCTGAGCAACCTGTGGTGAAGG - Intergenic
929836210 2:45402546-45402568 TGGTTAACAGCCTGTGTAGCAGG - Intronic
933992231 2:87642019-87642041 TCCAGAAAAGCCAGTGGAGTTGG - Intergenic
935087870 2:99866239-99866261 TACTGAACACCATGTGGAGTTGG - Intronic
936301617 2:111308818-111308840 TCCAGAAAAGCCAGTGGAGTTGG + Intergenic
936349260 2:111700637-111700659 TACAGAAGAGCCCGTGGAGCTGG + Intergenic
936396590 2:112136638-112136660 TCCAGGGCAGCCTGTGGAGATGG - Intergenic
936481803 2:112891598-112891620 TTCCCAACAGCCAGTGGAGCAGG + Intergenic
936724910 2:115302007-115302029 TCCTGTTAAGCCTGTGGAACTGG - Intronic
937281326 2:120719424-120719446 TCCAGAGCAGCCTGTGGTGGGGG - Intergenic
938129951 2:128706747-128706769 TCCTGTACAGCCTGCAGAACTGG - Intergenic
939192240 2:138930637-138930659 TCCTGTACAGCCTGTGGCACTGG - Intergenic
939214431 2:139217877-139217899 TCCTGTACAGCCTGTGGAACTGG + Intergenic
941073552 2:160981838-160981860 TCCTGTAGAGCCTGTGCAACTGG + Intergenic
942398837 2:175580244-175580266 TCCTCTACAGCCTCTGGAGGGGG - Intergenic
942558643 2:177198112-177198134 TGCTGAGCAGCGTGGGGAGCTGG + Intergenic
944311106 2:198234971-198234993 TCCTGTACAGCCTGCAGAACTGG - Intronic
947443337 2:230142124-230142146 TCATGTACAGCCTGTGGAACTGG + Intergenic
1169291339 20:4355656-4355678 TCCTGTACAGCCTACGGAGATGG + Intergenic
1170331118 20:15211716-15211738 TCCTGTACAGCCTGCAGAACTGG + Intronic
1170667043 20:18395244-18395266 TCCTCAGCTGCCTGTGTAGCTGG - Intronic
1170693087 20:18632977-18632999 TGCTGCCCAGCCTGTGCAGCCGG + Intronic
1172257721 20:33534425-33534447 TCCTGAACTTCCTGAGTAGCTGG + Intronic
1173688749 20:44942637-44942659 TCCAAAGCAGCCTGTTGAGCTGG - Exonic
1174417720 20:50378588-50378610 AAGTGAACAGCCTGTGGAGAGGG + Intergenic
1174751852 20:53118845-53118867 TCCTGTACAGCCTGTGGAACAGG - Intronic
1175279686 20:57794761-57794783 TCCAGAGCCGCCTGTGGAGTTGG + Intergenic
1178950414 21:36980926-36980948 GCCTGAGCAGCCAGTGGAGAAGG - Intronic
1179434505 21:41350851-41350873 TGCTGAAGAGACTGTGGAACTGG - Intronic
1179723897 21:43331231-43331253 GCCTGACCAGCCTGTGGGGAGGG - Intergenic
1179827897 21:43978157-43978179 TCCTGAAGAGGCTGTGGAAGGGG + Intronic
1181471808 22:23145294-23145316 TCCTGGACACCCTGGAGAGCCGG - Intergenic
1181544333 22:23592559-23592581 CCCTGAAGAGGCTGTGGAGTAGG - Intergenic
1183731549 22:39621426-39621448 TCCTGAGCGCCCTGTGGGGCTGG + Intronic
1183772764 22:39940716-39940738 TCCTGAGCAGCCTGGAGAGGTGG - Intronic
1183827753 22:40401735-40401757 TCCTGGGCAGCCTGCAGAGCTGG - Intronic
1184185054 22:42858787-42858809 TCCTGAAGAGCCTTTGGTGGAGG + Intronic
1184718644 22:46296422-46296444 AGCTGCACAGCCTGTGGGGCTGG - Intergenic
951272969 3:20650069-20650091 TCTTGTACAGCCTGTGGAACTGG + Intergenic
952611547 3:35216121-35216143 TGCCGAGCAGCCTGGGGAGCTGG - Intergenic
953716935 3:45323649-45323671 ACCTAAATAACCTGTGGAGCCGG - Intergenic
954337882 3:49930203-49930225 TCCTTTACAGCCTGTGTGGCTGG - Intergenic
954631061 3:52047807-52047829 TCATGCGCAGCCTGTGGAGAGGG - Intergenic
954803756 3:53202966-53202988 CCCGGAAAAGGCTGTGGAGCTGG - Intergenic
955404490 3:58617398-58617420 TCCTGAGCTTCCTGAGGAGCCGG + Intronic
955429050 3:58822866-58822888 TTCTGAACACCCCCTGGAGCAGG + Intronic
957966174 3:87324274-87324296 TGCTGAGCAGCATGGGGAGCTGG + Intergenic
958928155 3:100180909-100180931 TCCTGTACAGTCTGTGGAACTGG - Intergenic
961303066 3:125934470-125934492 TCATGAAGAGCCGGTGCAGCAGG + Intronic
962197906 3:133379584-133379606 ACCAGAACTGTCTGTGGAGCTGG - Intronic
962636269 3:137334895-137334917 TCCTTAGCACCCTGAGGAGCTGG - Intergenic
962810229 3:138953126-138953148 GCCTGAACCTCCTGTGTAGCTGG + Exonic
964298727 3:155263148-155263170 TCCTATACAGCCTGTGGAACTGG + Intergenic
964976965 3:162633674-162633696 TCCTCAACACCCTGAGTAGCTGG + Intergenic
967975017 3:195029344-195029366 CACTGAACAGCCTGTGAAGTTGG - Intergenic
969235714 4:5864061-5864083 TCCTCAACAGCCTGGTTAGCCGG + Intronic
969315730 4:6380514-6380536 TCCTGGCCAGACTGGGGAGCGGG - Intronic
969354861 4:6619466-6619488 TCTGGAAAAGTCTGTGGAGCAGG - Intronic
969458186 4:7312993-7313015 TCGGGAACAGCATGTGTAGCTGG + Intronic
970319967 4:14865522-14865544 CCCTGAACAGCATGAGGACCTGG - Intergenic
973912922 4:55601871-55601893 TCCTGAGGAGCCTGAGGAGCTGG - Intronic
974164139 4:58178564-58178586 TCCTCTACATCCTGTGGAACTGG + Intergenic
975142501 4:70933040-70933062 TCCTACACAGCCTGTGGAATTGG - Intronic
977594116 4:98859394-98859416 GCCTCAACAGCCTGAGTAGCTGG - Intergenic
978853033 4:113360819-113360841 TCCTGCTCATCCTGTGGATCTGG - Exonic
981271897 4:142855173-142855195 TCCTGATGACCTTGTGGAGCAGG - Intergenic
981973668 4:150696805-150696827 TCCAGACCAGCCTGTAGAGATGG + Intronic
982115443 4:152095057-152095079 TCCAGCACAGCCCTTGGAGCAGG - Intergenic
983650546 4:170032415-170032437 ACCTGAACAACCTGAGTAGCTGG + Intronic
985563008 5:601379-601401 TTCTGAACACCCTGTGAAGTTGG + Intergenic
985719186 5:1480428-1480450 CCCTGACCAGCCTGTGGCCCCGG + Intronic
986449312 5:7850294-7850316 GGCTGGACAGCCTGTGGAGGGGG - Intronic
986713236 5:10502866-10502888 TTCCGAGGAGCCTGTGGAGCCGG - Intergenic
988447935 5:31309705-31309727 TCCTGTACAGCCTGTGGAAATGG - Intronic
990874336 5:60467707-60467729 TCCTGTTAAGCCTGGGGAGCTGG - Intronic
991362286 5:65833181-65833203 TCCTGAAAATCCTTTGGAGGAGG - Intronic
992086863 5:73285218-73285240 TCCTGCTCAGCCTGAGGAGGTGG + Intergenic
992867118 5:80969098-80969120 TCCTGCACAGCTGGAGGAGCTGG - Intronic
995768122 5:115640643-115640665 TACTGCACAGCCTCTGAAGCAGG + Intergenic
1000482896 5:161801958-161801980 TCCTGAAAACAGTGTGGAGCAGG - Intergenic
1001389583 5:171368016-171368038 TGCTTAAGAGCCTGTGGGGCTGG - Intergenic
1001794677 5:174492123-174492145 ACCTGATCAGCTTGTGGAACAGG + Intergenic
1001987384 5:176086263-176086285 TCCTGAAGAGCCCTTGGTGCAGG + Intronic
1002100382 5:176854765-176854787 TCCTGACCAGGCTGTGGGGATGG + Intronic
1002229483 5:177751879-177751901 TCCTGAAGAGCCCTTGGTGCAGG - Intronic
1002265862 5:178031894-178031916 TCCTGAAGAGCCCTTGGTGCAGG + Intronic
1002873224 6:1186637-1186659 ACCAGAACAGCCTTTGGTGCAGG - Intergenic
1003459597 6:6318004-6318026 TCCAGAGCAGCCTGGTGAGCTGG - Intronic
1004005448 6:11633637-11633659 TCATGAAAATCCTGTGGAGCAGG - Intergenic
1004219567 6:13734438-13734460 TTTTGAACAGTCTGAGGAGCTGG - Intergenic
1004868245 6:19875453-19875475 TCCTGTACAGCCTGCAGAACCGG + Intergenic
1005311806 6:24565995-24566017 TCCTGAACAGACTTTGGATGGGG - Intronic
1006282848 6:33069256-33069278 TCCCAAGGAGCCTGTGGAGCTGG - Exonic
1006425255 6:33959444-33959466 GCCTGCACAGCCTGGGGAGTGGG - Intergenic
1006822971 6:36913277-36913299 TTCTGACCAGCATGTGGGGCTGG + Intronic
1007960801 6:45957325-45957347 TCCTGAGAAGCCTGTGAAGTGGG + Intronic
1008686624 6:53932365-53932387 TCCTGAGCAGCCTGAGAAGGGGG - Intronic
1010905760 6:81486118-81486140 ACCAGAACAGCATGGGGAGCTGG - Intergenic
1013450889 6:110279879-110279901 TCCTGGATAGCCTGTGAAACTGG - Intronic
1014994547 6:128125481-128125503 TCCAGTACAGCCTGTGGAACTGG + Intronic
1015447106 6:133319005-133319027 TGCTTAACAGCCTGTCCAGCAGG + Intronic
1015460262 6:133482850-133482872 TCCTATAAAGCCTGAGGAGCAGG - Intronic
1015753407 6:136584084-136584106 TACTGACCAGCGTGTGGGGCAGG - Intronic
1016311029 6:142733802-142733824 TCCTGTACAGCCCATGGAACTGG - Intergenic
1018377500 6:163227148-163227170 TCCTGTACAGCCTGCAGAACTGG - Intronic
1018946677 6:168352158-168352180 TCCTGCACAGCCTGCAGAACTGG - Intergenic
1019900596 7:4017619-4017641 TCTTGAAAAGTCTGTGGAACTGG + Intronic
1020117506 7:5484154-5484176 TCCTTAACAGCCTCACGAGCTGG - Intronic
1020318477 7:6923869-6923891 TCATGAAGAGCCTGTGCTGCAGG - Intergenic
1021600031 7:22356251-22356273 TCCTGGACACCCTCTTGAGCAGG - Intronic
1022405727 7:30088152-30088174 TCCTGAGCAGCCAAGGGAGCAGG - Intronic
1023793212 7:43770174-43770196 TCCTGGACAGCCTATGCAGGTGG + Intronic
1024239325 7:47421976-47421998 TCCTGAATGGCCTGGGGAGTGGG - Intronic
1025252923 7:57363961-57363983 AAGTGAACAGCCTGTGGAGAGGG - Intergenic
1026948679 7:74332947-74332969 TCCTGCCCTGCCTGTGGAGGTGG - Intronic
1027315088 7:76980710-76980732 TCCTGGACCGCCTATGAAGCCGG + Intergenic
1029698810 7:102232766-102232788 CTCTGATCAGCCTGTGAAGCGGG + Intronic
1033639905 7:143252326-143252348 TCCTATACAGCCTGTGGAACTGG + Intronic
1036918886 8:12832700-12832722 TCCTGGTCAGCTTGTGGAGGTGG - Intergenic
1037346808 8:17909707-17909729 TCCTGCACAGCCTGAGAAGGAGG - Intronic
1037908954 8:22732193-22732215 TCATCAACATCCTGTGGAGATGG + Intronic
1037960935 8:23097671-23097693 TCCTGGACAGCCTCGGGAGGGGG - Intronic
1039312052 8:36327556-36327578 TCCTGGATATCCTGTGAAGCTGG + Intergenic
1040924041 8:52657796-52657818 TCCTGAACAGTCAGTGGTGGAGG + Exonic
1041549227 8:59080827-59080849 TCCTGTACAGCCTGCAGAACTGG + Intronic
1042190119 8:66177657-66177679 TGCTGAAGCGCCTGGGGAGCGGG + Intronic
1043678872 8:82996717-82996739 TCCTGAACAGCATCTGGGGGAGG + Intergenic
1043886119 8:85602803-85602825 TCCTGTACAGCCTGCAGAACCGG - Intergenic
1044712464 8:95071483-95071505 TCCAGGACAGCCTGTGGGGGTGG - Intronic
1048439843 8:134451775-134451797 CCCTGAACAGCATGTGGAGATGG + Intergenic
1048661447 8:136607137-136607159 TCCAGAGCTGCCTGTGGAGTTGG - Intergenic
1048679926 8:136829934-136829956 TCCTGTAGGGCCTGTGGAACAGG - Intergenic
1049005992 8:139856060-139856082 TCCCACACAGCCTGTGAAGCTGG - Intronic
1049210392 8:141383865-141383887 TTCGGAACAGGCTGTGGGGCAGG - Intergenic
1049411116 8:142474430-142474452 TCATGTACACCCTGTGCAGCAGG - Intronic
1049615772 8:143575285-143575307 TCCTGCCCAGCCTGTGGCACTGG + Exonic
1049667444 8:143852551-143852573 TCCAGTGCAGCCAGTGGAGCAGG + Intergenic
1049744252 8:144256465-144256487 GTCTGAGCAGCCTGTGGTGCTGG - Intronic
1051006068 9:12346057-12346079 TCCTGTACAGCCTGCAGAACTGG + Intergenic
1051127433 9:13820568-13820590 TCTTGAACAGCCTGCAGAACTGG + Intergenic
1051649506 9:19307278-19307300 TCCTCAGCTGCCTGTGTAGCTGG - Intronic
1051705843 9:19878762-19878784 TCCTATACAGCCTGTGGAACTGG + Intergenic
1051817853 9:21130858-21130880 TCAAAAACAGCCTGTGGAACAGG - Intergenic
1051878665 9:21817553-21817575 AAGTGAACAGCCTGTGGAGCAGG - Intronic
1052833476 9:33233844-33233866 CCCAGGACAGGCTGTGGAGCTGG + Intronic
1055562626 9:77535769-77535791 TCCCAACCAGCCTGTGGACCGGG - Intronic
1056049178 9:82750115-82750137 TTCTGAAATGCCTGTGTAGCTGG - Intergenic
1056558783 9:87711808-87711830 TCCTGCAAAGACTGTGGCGCTGG - Intergenic
1056978077 9:91279459-91279481 TCCTGTACAGCCTGCAGAACTGG - Intronic
1058721901 9:107772176-107772198 CCCTGTACTGCCTGTGGAACTGG - Intergenic
1059553691 9:115256443-115256465 TCCTGTACAGCCTGCAGAACTGG - Intronic
1061293776 9:129666382-129666404 TCCCGAACAGCCTGGGAAGTGGG + Intronic
1062089951 9:134670628-134670650 CTCGGGACAGCCTGTGGAGCAGG - Intronic
1062121467 9:134836174-134836196 TCCTGGACAGCCTGCAGAGCTGG - Intronic
1062345614 9:136113290-136113312 TCCAGATCAGCCTGGGCAGCAGG - Intergenic
1062402051 9:136377022-136377044 CCCTGGAAAGCATGTGGAGCTGG - Intronic
1062520650 9:136956372-136956394 TCCTGTACAGCCTGCCCAGCAGG - Intronic
1062675805 9:137742951-137742973 ACGTGAACAGCATGTGCAGCAGG - Intronic
1190908630 X:54751535-54751557 TCCTGAGCAGTGTGTGGAGTGGG + Intronic
1192804308 X:74495938-74495960 TCCTGAACACCTTGGGGATCGGG - Intronic
1193800916 X:85935059-85935081 TCTTGAACAGCCTGTGGAACTGG - Intronic
1194362834 X:92975851-92975873 TCCACAACAGACTGTGAAGCAGG - Intergenic
1194391320 X:93321433-93321455 TCCTGTAAATCCTGTGGAACTGG + Intergenic
1194667246 X:96688834-96688856 GCCTTAGCAGCCTGTGTAGCTGG - Intronic
1195556422 X:106230264-106230286 TCCTGAACAACCAATGGAGAAGG - Intergenic
1195656975 X:107341093-107341115 TTCTGAAGACTCTGTGGAGCAGG - Intergenic
1195942297 X:110176222-110176244 CCAAGAACAGTCTGTGGAGCTGG + Exonic
1196834753 X:119803731-119803753 TCCTGTACAGCCTGCAGAACTGG + Intergenic
1199063507 X:143387749-143387771 CCCTGTACAGCCTGTGGAACTGG + Intergenic
1199077998 X:143546057-143546079 TCTTTCACAGCCTGTGGAACTGG - Intergenic
1200671082 Y:6092080-6092102 TCCACAACAGACTGTGAAGCAGG - Intergenic