ID: 1165595477

View in Genome Browser
Species Human (GRCh38)
Location 19:37008784-37008806
Sequence CGGGAGACACAGCAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 674
Summary {0: 1, 1: 2, 2: 62, 3: 66, 4: 543}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165595477_1165595485 4 Left 1165595477 19:37008784-37008806 CCTCCCTCTTGCTGTGTCTCCCG 0: 1
1: 2
2: 62
3: 66
4: 543
Right 1165595485 19:37008811-37008833 TGAGGGGTGCAGATGCTTCTTGG 0: 1
1: 0
2: 1
3: 32
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165595477 Original CRISPR CGGGAGACACAGCAAGAGGG AGG (reversed) Intronic
900695596 1:4007844-4007866 AGGGAGAGACAGAAATAGGGAGG + Intergenic
900846171 1:5103212-5103234 CAGGAGAGACAGCATGAAGGGGG - Intergenic
900998221 1:6134260-6134282 CTGCAGACACAGCAGGAGGTGGG + Intronic
901152397 1:7112621-7112643 AGGGACACACAGCGGGAGGGAGG - Intronic
901842835 1:11964618-11964640 TGGGAGAGACAGAAAGCGGGTGG - Intronic
902183186 1:14705148-14705170 GGGAAGAGGCAGCAAGAGGGAGG - Intronic
902381590 1:16055405-16055427 GTGGAGAGACAGCCAGAGGGAGG - Intronic
902478223 1:16699158-16699180 CAGGCCACACAGCTAGAGGGTGG + Intergenic
902660891 1:17902759-17902781 GTGAAGACACAGCAAGAAGGTGG + Intergenic
903424581 1:23244424-23244446 GTGGAGTCACAGCAAGTGGGAGG + Intergenic
903699640 1:25237169-25237191 TGGGCGACACAGCAAGAGTCCGG + Intergenic
903740442 1:25555652-25555674 TTAGAGACAAAGCAAGAGGGTGG - Intronic
904805489 1:33128582-33128604 CTGTAGACACAGGAAGAGGGTGG - Intergenic
904825141 1:33269383-33269405 AGGGAGCCACACCCAGAGGGAGG - Intronic
905955017 1:41985463-41985485 GTGAAGACACAGCAAGAAGGTGG - Intronic
906306553 1:44723741-44723763 AGGGAGACAGAGAAAGTGGGTGG - Intronic
906532928 1:46533653-46533675 GTGGGCACACAGCAAGAGGGCGG + Intergenic
906673918 1:47679500-47679522 TTGGAGACACAGGAAGAGGCAGG - Intergenic
906678334 1:47708980-47709002 CGGGAGCCGCAGCAGGCGGGGGG - Intergenic
906778294 1:48549528-48549550 AGGGAGAGACAGCAGGAGAGAGG + Intronic
906811802 1:48834591-48834613 CTGAGGACACAGCAAGAAGGAGG + Intronic
907392583 1:54167981-54168003 CTGGGGATGCAGCAAGAGGGAGG + Intronic
907861772 1:58360642-58360664 AGAGACACACAGCAAAAGGGTGG + Intronic
908331726 1:63077397-63077419 GTGAAGACACAGCAAGAAGGTGG + Intergenic
908632660 1:66126984-66127006 CGAAAGACAAAGAAAGAGGGGGG + Intronic
908838215 1:68249995-68250017 GTGAAGAGACAGCAAGAGGGTGG - Intergenic
910170163 1:84368753-84368775 AGGGAGGCACAGCCAGAGGAAGG + Intronic
911595332 1:99793289-99793311 ATGAAGACACAGCAAGATGGTGG - Intergenic
912131542 1:106608290-106608312 GTGAAGACACAGCAAGAAGGTGG - Intergenic
913566774 1:120080401-120080423 CAAGAGACGGAGCAAGAGGGGGG - Intergenic
913936848 1:125063740-125063762 GGGGAGGCAGACCAAGAGGGAGG + Intergenic
913937497 1:125067527-125067549 GGGGAGGCAGAGCAAGAGGGAGG - Intergenic
914333401 1:146693865-146693887 CAGGAGAGACAGCAAGTGAGAGG + Intergenic
915289817 1:154875984-154876006 CAGGACACAGAGCAAGAGGTGGG - Intergenic
915300453 1:154948412-154948434 GGGGAGACACAGGGAGAGAGGGG + Intronic
915537566 1:156546333-156546355 TGGGAGACAGAGAAAGAGAGGGG - Intronic
915939188 1:160107858-160107880 TGGGGTACACAGCAAGAAGGTGG - Intergenic
916204418 1:162301361-162301383 GGGAAGACACAGCTAGAAGGTGG + Intronic
918130393 1:181622513-181622535 GGGAGGACACAGCAAGAAGGGGG - Intronic
918374795 1:183898179-183898201 CGGAAGAGACTGCAAGAGGGAGG - Intronic
918414220 1:184290080-184290102 GGGGAGACACACCCACAGGGTGG - Intergenic
918743339 1:188165498-188165520 ATGAAGACACAGCAAGAAGGTGG - Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919046350 1:192457519-192457541 CTGAGGACACAGCAAGAAGGTGG - Intergenic
919070283 1:192746610-192746632 CAGGAGACCCAGCAAGTGAGCGG - Intergenic
919884901 1:201926116-201926138 AGGGAGTCAAAGCGAGAGGGAGG + Intronic
920164598 1:204026600-204026622 CTGGAGACAAAGGCAGAGGGAGG + Intergenic
920438920 1:205965567-205965589 CAGGAGAGAAAGCCAGAGGGAGG - Intergenic
921123291 1:212155239-212155261 GTGAAGACACAGCAAGAAGGTGG + Intergenic
922798390 1:228352842-228352864 TGGGAGACACACCAGGATGGGGG + Intronic
923606414 1:235447332-235447354 CTGGAGATACAGCAATAGTGTGG - Intronic
924797644 1:247303834-247303856 CTGGAGAGACACCAAGAGTGTGG + Intronic
924808174 1:247378358-247378380 GTGAGGACACAGCAAGAGGGTGG + Intergenic
1063093850 10:2891561-2891583 CGGGAGTCAAAGCAAGAGGTTGG + Intergenic
1063463690 10:6229942-6229964 CGGGCCACACAGCAGGAGGTGGG - Intronic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064119922 10:12609720-12609742 CAGGCTGCACAGCAAGAGGGGGG - Intronic
1064277742 10:13922070-13922092 CTGAGGACACAGCAAGAAGGTGG + Intronic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1066262592 10:33743807-33743829 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1066290864 10:34013251-34013273 AGAGAGACATAGAAAGAGGGAGG - Intergenic
1066295748 10:34052807-34052829 CGGGAGAAGGAGCAAGAGGGTGG - Intergenic
1067089000 10:43257182-43257204 CAGAGGTCACAGCAAGAGGGAGG + Intronic
1067094784 10:43293203-43293225 AGAGAGACTGAGCAAGAGGGAGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067248120 10:44563432-44563454 GGGAAGACACAGCAAGAAGGTGG - Intergenic
1067572724 10:47383788-47383810 CGGGAGAGACAGTGGGAGGGAGG + Intronic
1068099443 10:52533089-52533111 AGGGAGAGAAAGAAAGAGGGAGG - Intergenic
1068390689 10:56392375-56392397 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1069186931 10:65435395-65435417 AGGCAGACAAAGCAAGAGAGAGG + Intergenic
1069627958 10:69880105-69880127 AGGGAGACACAGGGAGAGAGGGG - Intronic
1069808110 10:71138560-71138582 CGGGGACCACAGCAGGAGGGCGG - Intergenic
1069963365 10:72092495-72092517 ACGAAGACACAGCAAGAAGGCGG - Intergenic
1070339574 10:75484757-75484779 TGTGAGACACAGCAAGAAGGTGG + Intronic
1070574986 10:77670935-77670957 AGGGAGAAACAGAAAGAGAGAGG + Intergenic
1070574995 10:77671000-77671022 AGGGAGAGACAGAAAGAGAGAGG + Intergenic
1071270924 10:84006608-84006630 AAGGAGAAAGAGCAAGAGGGAGG - Intergenic
1071293945 10:84205932-84205954 GGGAAGACAAAGCTAGAGGGAGG - Intronic
1071583083 10:86791741-86791763 TGGGCAACAGAGCAAGAGGGAGG - Intronic
1072027539 10:91476525-91476547 GGGCAGACAGAGCAAGAGGGAGG + Intronic
1073447578 10:103590595-103590617 CGGGAGAGACAGGGAGAGTGCGG - Exonic
1073632532 10:105162838-105162860 AGGGTGACAGAGAAAGAGGGAGG - Intronic
1075455689 10:122583403-122583425 AGGAAGAGAGAGCAAGAGGGAGG + Intronic
1075457812 10:122596106-122596128 AGGAAGAGAGAGCAAGAGGGAGG + Intronic
1075551974 10:123399692-123399714 CGGGAGGCGCAGGAAGAGGGGGG - Intergenic
1075832956 10:125427148-125427170 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1076465925 10:130681586-130681608 GGGGGAACACAGCAAGAGAGAGG + Intergenic
1077022488 11:424395-424417 CAGGACACACAGCCAGTGGGTGG - Intronic
1077266650 11:1654199-1654221 AGGGAGAGAGAGCAAGAGAGAGG - Intergenic
1078019246 11:7641476-7641498 CAGGAGACACAGAAAGTGGCTGG + Exonic
1078696111 11:13633721-13633743 CAGGAGAAAGAGCAAGAGTGGGG + Intergenic
1078799306 11:14627024-14627046 ATGAAGACACAGCAAGAAGGGGG - Intronic
1079096393 11:17513192-17513214 AGGGAAACACGGCAGGAGGGAGG + Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1080008000 11:27429876-27429898 CCTGAGAGACAGGAAGAGGGGGG + Intronic
1080107058 11:28521801-28521823 CTAGAGAGACAGCAAGAGTGGGG - Intergenic
1081222839 11:40483236-40483258 CTGGAGACAAAGCTAGAGGGAGG + Intronic
1083177367 11:60959152-60959174 CGGGTGACACAGCAAGACCCTGG + Intergenic
1083590051 11:63888526-63888548 AGGGAGACAGAGAAAGAGGCGGG - Intronic
1083737374 11:64689207-64689229 AGGGAGACACAGAGAGAGGCAGG - Intronic
1083753851 11:64778531-64778553 CGCGAGACGCACAAAGAGGGAGG + Intronic
1084938859 11:72601663-72601685 CAGGAGACACAAGAAGAGGAAGG + Intronic
1088839446 11:113611598-113611620 GTGAGGACACAGCAAGAGGGAGG - Intergenic
1089389821 11:118093184-118093206 CGGTGGACACAGCAATAGGAAGG - Intronic
1089693077 11:120198665-120198687 CAGGAGACAGAGCAGTAGGGTGG + Intergenic
1089970343 11:122688285-122688307 TGGGCAACAGAGCAAGAGGGAGG - Intronic
1090458467 11:126869393-126869415 CTGGAGACACTGCAGGAGAGTGG - Intronic
1090543097 11:127730630-127730652 GTGAAGACACAGCGAGAGGGTGG - Intergenic
1091344235 11:134842263-134842285 CGGGACAATCAGCAGGAGGGAGG + Intergenic
1092069265 12:5619519-5619541 CTGGATACACAGCTAGATGGGGG + Intronic
1092347505 12:7728096-7728118 GTGAAGACACAGCAAGAGTGTGG - Intergenic
1095038239 12:37418026-37418048 GGGGAGGCACAGCAAGAGTGAGG + Intergenic
1095038704 12:37420457-37420479 GGGGAGGCACAGCAAGAAGGAGG + Intergenic
1095049981 12:37546520-37546542 GGGCAGACAGAGCAAGAGGGAGG - Intergenic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1096735387 12:53649306-53649328 CAGAAGACTCAGCAAGAGGCTGG + Intronic
1097685214 12:62684735-62684757 AGGGAGTCACAGAAAGAAGGTGG + Intronic
1097791186 12:63817385-63817407 GGGAAGGCACAGCAAGATGGTGG + Intergenic
1098008150 12:66021010-66021032 GGGAAAACACAGCGAGAGGGTGG + Intergenic
1099126170 12:78760993-78761015 CAGGAGACAGAGAGAGAGGGAGG + Intergenic
1099324473 12:81196763-81196785 CGAGAGAGGAAGCAAGAGGGAGG + Intronic
1099918354 12:88924677-88924699 GGGAGGACACAGCAAGAAGGTGG + Intergenic
1100811772 12:98345618-98345640 AGGGAAACAAAGCAATAGGGAGG + Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101288425 12:103340815-103340837 CTGAAGACACAGCAATAGGCTGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101849025 12:108387595-108387617 CGGGAGGAAGAGCAAGTGGGGGG - Intergenic
1102186544 12:110951900-110951922 AGGGAGACAGAGGGAGAGGGAGG + Intergenic
1102925163 12:116820940-116820962 TGGGAGACCCAGCAAGTGAGAGG - Intronic
1103070047 12:117933827-117933849 AGCGACACACAGCAAGAGGGTGG + Intronic
1103185261 12:118951319-118951341 CAGTAGACAGAGCATGAGGGTGG - Intergenic
1103441386 12:120965573-120965595 CGAGAGACCCAAGAAGAGGGTGG - Intergenic
1103910128 12:124347737-124347759 GGAGAGACACAGCCAGAGTGTGG - Intronic
1104364301 12:128163195-128163217 CAGTAGTCACAGGAAGAGGGGGG - Intergenic
1104437120 12:128765374-128765396 GGGGACACACAGCAAGGGGCGGG - Intergenic
1104574409 12:129953769-129953791 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1104633882 12:130425847-130425869 AGGGGCCCACAGCAAGAGGGGGG - Intronic
1104894214 12:132153899-132153921 CCTGGGACACAGCAAGAGGACGG - Intergenic
1104918504 12:132278597-132278619 CTGGAGACACAACCAGACGGCGG - Intronic
1104932652 12:132347951-132347973 CGGGAGACACACCTAGAGTCAGG - Intergenic
1104938026 12:132376988-132377010 AGGGAGACAGAGAGAGAGGGAGG + Intergenic
1104938055 12:132377194-132377216 AGGGAGACAGAGAGAGAGGGAGG + Intergenic
1105264960 13:18807880-18807902 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1105839093 13:24238178-24238200 TGGGAGACAGAGCAAGAGTCTGG - Intronic
1106022303 13:25926992-25927014 CGGGAGGCACAGCAGGATGCAGG - Intronic
1106431385 13:29683823-29683845 CATGAGGCACAGCAAGAAGGTGG - Intergenic
1109024300 13:57140336-57140358 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109025205 13:57146441-57146463 CGGGAAACACAGCAGGACGCTGG - Intronic
1109026195 13:57153014-57153036 CGGGAAACACAGCAGGACGCTGG - Intronic
1109027187 13:57159585-57159607 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109028173 13:57166150-57166172 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109029160 13:57172721-57172743 CGGGAAACACAGCAGGACGCTGG - Intergenic
1109202637 13:59448095-59448117 GTGAAGACACAGCAAGACGGTGG - Intergenic
1110939162 13:81327740-81327762 TGGGCGACAAAGCAAGAGGCTGG + Intergenic
1110955610 13:81549251-81549273 CAGGAGAAACAGTGAGAGGGGGG + Intergenic
1111257417 13:85689336-85689358 AGGGAGACAATGGAAGAGGGAGG + Intergenic
1111933605 13:94536585-94536607 CGGGAGAGGGAGCAAGAGAGAGG - Intergenic
1112496747 13:99911325-99911347 GAGGAGACAGAGCCAGAGGGAGG - Intergenic
1112601536 13:100860225-100860247 TGGGACACCCAGCAACAGGGTGG - Intergenic
1113381752 13:109811426-109811448 GGGGACACACAGCCAGAGGAGGG - Intergenic
1113381769 13:109811478-109811500 GGGGACACACAGCCAGAGGAGGG - Intergenic
1113695244 13:112341600-112341622 AGGGAGAGAGAGAAAGAGGGAGG - Intergenic
1114524116 14:23357480-23357502 CGTGCCCCACAGCAAGAGGGTGG - Exonic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1116674367 14:47886815-47886837 AGGGAGACAAAGGAAGAGGAAGG + Intergenic
1116763111 14:49039065-49039087 AGGGAGAGACAGAGAGAGGGAGG - Intergenic
1116959076 14:50951857-50951879 CAGGAGACACATTAAGAGTGAGG + Intergenic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117232927 14:53740456-53740478 TGGTAGGCAAAGCAAGAGGGTGG - Intergenic
1117704870 14:58454772-58454794 GTGAAGAGACAGCAAGAGGGAGG - Intronic
1117964268 14:61190653-61190675 GTGGAAACACAGCAAGAGGCAGG - Intronic
1118065822 14:62189187-62189209 GAGAAGACACAGCAAGAAGGCGG - Intergenic
1118418764 14:65575640-65575662 TGGGGGACAGAGCAAGAGTGTGG - Intronic
1118602899 14:67482801-67482823 GGGCACCCACAGCAAGAGGGTGG - Intronic
1119562164 14:75599211-75599233 CTGGAGGCACAGCATGGGGGAGG - Intronic
1120428459 14:84381573-84381595 TGGGCCACACAGCAAGAGGTGGG - Intergenic
1120677914 14:87443432-87443454 GGGGAGAGAGAGAAAGAGGGAGG + Intergenic
1120688750 14:87568887-87568909 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1120998544 14:90435106-90435128 AGGGAGACACAGCAAGAGTCTGG - Intergenic
1122951331 14:105046876-105046898 TGGAAGAGACAGCATGAGGGGGG - Intergenic
1202833504 14_GL000009v2_random:60234-60256 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1124372438 15:29111302-29111324 AGGGAGGCAGAGCCAGAGGGTGG - Intronic
1124511061 15:30326277-30326299 CGAGAGAGAGAGCGAGAGGGAGG - Intergenic
1125605929 15:40939885-40939907 CAGGAGACAGGGCAGGAGGGAGG + Intergenic
1125729200 15:41883301-41883323 TGGGAAACACAGCAAGGTGGGGG - Intronic
1126096757 15:45095655-45095677 ACGGAGACACAGGCAGAGGGAGG + Intronic
1126176991 15:45745044-45745066 CAGGAGAGACAGCAAGAGAGGGG - Intergenic
1127012262 15:54643463-54643485 GGGGAGGCAGAGCAAGATGGTGG + Intergenic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1128787002 15:70405022-70405044 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1129238609 15:74238833-74238855 CAGCAGAGACAGCAAGAGTGTGG + Intronic
1130567476 15:85008864-85008886 CTCGAGACACAGGGAGAGGGAGG - Intronic
1130648485 15:85748768-85748790 CAGGGGACACAGCCAGTGGGGGG - Intronic
1131092477 15:89633034-89633056 CGGCTGACACAGCCAGAGGTGGG - Intronic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1132322237 15:100934427-100934449 CTGGGGACACAGCAGGAGTGTGG + Intronic
1133756424 16:8765639-8765661 TGAGAGACACAGCAAGAGCAAGG + Intronic
1133875926 16:9734267-9734289 CTGGCGAAACAGCAAGAGGGAGG - Intergenic
1134049645 16:11128499-11128521 GGGGAGACACAGCCAAGGGGTGG - Intronic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1134201814 16:12205487-12205509 GGGTGGAGACAGCAAGAGGGAGG - Intronic
1134429975 16:14194343-14194365 AGGGAGAGAAAGAAAGAGGGAGG + Intronic
1134855087 16:17511849-17511871 CCAAAGACACAGCAAGAAGGTGG - Intergenic
1135304408 16:21356048-21356070 TGAGAGACACAGTAGGAGGGTGG + Intergenic
1135719235 16:24800875-24800897 CGAGAGACAGGGCAAGAGGAAGG - Intronic
1135835804 16:25824152-25824174 GGGAAGACACAGAAACAGGGAGG + Intronic
1135871301 16:26153256-26153278 CTGGAGATACAGAAAGATGGCGG + Intergenic
1136301150 16:29335178-29335200 TGAGAGACACAGTAGGAGGGTGG + Intergenic
1136301161 16:29335238-29335260 TGGGAGACACTGTAGGAGGGTGG + Intergenic
1136932647 16:34432887-34432909 TGGCAGACAGAGCAAGAGGGAGG - Intergenic
1136971925 16:34978927-34978949 TGGCAGACAGAGCAAGAGGGAGG + Intergenic
1136989213 16:35141900-35141922 TGGCAGATAGAGCAAGAGGGAGG - Intergenic
1138203396 16:55106623-55106645 GTGGAGACACAGCGAGAAGGTGG + Intergenic
1138554785 16:57764930-57764952 GAGGAGCCACAGCATGAGGGTGG + Intronic
1139957893 16:70701791-70701813 GAGGAGGGACAGCAAGAGGGAGG - Intronic
1140000217 16:71017385-71017407 CAGGAGAGACAGCAAGTGAGAGG - Intronic
1140306461 16:73807476-73807498 TGGGAGACACAGCAAGACCATGG - Intergenic
1140451802 16:75076866-75076888 TGTGAGACACAGCAAGATGGTGG + Intronic
1141294895 16:82758430-82758452 GGGGAGACAAAGCAAAGGGGGGG - Intronic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1141836526 16:86543779-86543801 CGGGCCACACAGCACGAGGTGGG + Intronic
1142062850 16:88041914-88041936 TGAGAGACACAGTAGGAGGGTGG + Intronic
1142683986 17:1566723-1566745 CAGGAGAAACAGGAAGAGAGAGG - Intergenic
1144239219 17:13293643-13293665 AGGGAGAGAAAGAAAGAGGGAGG - Intergenic
1145293876 17:21573415-21573437 GGGGAGACAGTGGAAGAGGGAGG + Intronic
1145306070 17:21675884-21675906 GGGCAGACAGAGCAAGAGGGAGG + Intergenic
1145306406 17:21677711-21677733 GGGGAGACAGAGCAAGAGGGAGG + Intergenic
1145306412 17:21677744-21677766 GGGAGGACAGAGCAAGAGGGAGG + Intergenic
1145308215 17:21687138-21687160 GGGGAGGCAGAGCAAGAGGGAGG + Intergenic
1145369941 17:22299782-22299804 AGGGAGACAGAGTAAGAGGGAGG - Intergenic
1145370322 17:22301990-22302012 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1145385728 17:22410393-22410415 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1145386100 17:22412561-22412583 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1145859205 17:28193320-28193342 TGGAACACACAGCACGAGGGTGG + Intronic
1146200134 17:30850278-30850300 AGGGAGACATAGCCAGAGGTTGG - Intronic
1146445331 17:32928220-32928242 CGGGAGCCACAGCCTGAGGTGGG + Exonic
1146504241 17:33391007-33391029 TGGCAGACAGAGAAAGAGGGAGG + Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147708708 17:42447456-42447478 GGGAGGACACAGCAAGAAGGTGG - Intergenic
1147722272 17:42546669-42546691 TGGGAGACACAACAAGGGGTGGG + Intergenic
1147723457 17:42552839-42552861 TGGGAGACACAACAAGGGGTGGG + Exonic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1149115291 17:53086914-53086936 TGGCGGACACAGCAAGATGGGGG - Intergenic
1149436037 17:56634205-56634227 GTGTAGACACAGCAAGAAGGTGG - Intergenic
1150434598 17:65144115-65144137 CGGGTGAGACAGCGGGAGGGTGG + Intronic
1151138350 17:71968922-71968944 TGTGAGACACAGCAAGAAGATGG + Intergenic
1151410575 17:73924816-73924838 ATGAAGACACAGCAAGAGGTCGG + Intergenic
1151412004 17:73937209-73937231 GGTGAGCCACAGCAAGAGAGGGG + Intergenic
1151412100 17:73937739-73937761 GGGAGGACACAGCAAGAAGGTGG + Intergenic
1151674067 17:75589016-75589038 CGGGAGCCGCAGCAGGAGCGGGG + Intergenic
1152250426 17:79209653-79209675 GCAGAGACACAGCAAGAGGTGGG + Intronic
1152250660 17:79210997-79211019 GCAGAGACACAGCAAGAGGTGGG + Intronic
1152335509 17:79698322-79698344 CCGGGGACACAGCAAGCAGGCGG + Intergenic
1154423433 18:14253663-14253685 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1155682217 18:28502229-28502251 AAGGAGACACAGGAATAGGGTGG + Intergenic
1156399755 18:36729590-36729612 TTGAAGACACAGCAAGAAGGTGG - Intronic
1156435198 18:37119498-37119520 TGGTGGACACAGCAAGAAGGTGG - Intronic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156552290 18:38030316-38030338 AGGGGGACATAGCAAGAAGGGGG - Intergenic
1157285091 18:46372301-46372323 CAGGATGCACAGCAAGTGGGTGG - Intronic
1157884093 18:51349679-51349701 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1158741606 18:60148890-60148912 GTGCAGACACAGCAAGAAGGTGG - Intergenic
1159236428 18:65679982-65680004 CTGTAGACATAGCAAGAGTGAGG - Intergenic
1159636110 18:70806855-70806877 CTGGGGAAACAGCAAGAGAGAGG - Intergenic
1159876107 18:73812997-73813019 TGGGAGGCAAAGCAAGATGGTGG - Intergenic
1159959538 18:74544948-74544970 AGAGAGACACAGAAAGAGGCTGG + Intronic
1160675662 19:389974-389996 CGGAGGACAGAGAAAGAGGGAGG - Intergenic
1161334695 19:3706448-3706470 TGGGAGACAGAGCAAGACGCTGG - Intergenic
1161824870 19:6556528-6556550 CGGGAGACAGAGGAAGAGATAGG - Intergenic
1162340242 19:10087337-10087359 CGGGAGGGAGAGCAAGAGGGGGG + Intronic
1162581899 19:11536345-11536367 CGGGTCACACAGCTCGAGGGTGG - Intergenic
1163159219 19:15454776-15454798 CAGGAGCCGCAGGAAGAGGGAGG + Exonic
1163238991 19:16047519-16047541 AGGGAGACACAGAGAGAGAGAGG - Intergenic
1163648443 19:18503385-18503407 AGGGAGCCCCAGCAAGTGGGGGG + Intronic
1163688507 19:18725662-18725684 TGGGAGGCTCAGGAAGAGGGAGG - Intronic
1164502788 19:28833403-28833425 TGGGACCCACAGCACGAGGGCGG - Intergenic
1164526308 19:29015997-29016019 GGAGAGAGACAGCAAGAGAGAGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164866296 19:31607049-31607071 CGGGAGCCAGAGGAAGAGAGAGG - Intergenic
1165509172 19:36256361-36256383 GGGCAGACAGAGCAAGAGGGAGG - Intergenic
1165509684 19:36258776-36258798 GGGCAGGCAGAGCAAGAGGGAGG - Intergenic
1165510710 19:36265321-36265343 GGGCAGGCAGAGCAAGAGGGAGG - Intergenic
1165511758 19:36270267-36270289 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165512308 19:36272768-36272790 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165512855 19:36275309-36275331 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165513411 19:36277864-36277886 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165513960 19:36280398-36280420 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165514513 19:36282935-36282957 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165515064 19:36285468-36285490 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165515615 19:36288004-36288026 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165516166 19:36290541-36290563 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165516716 19:36293067-36293089 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165517269 19:36295590-36295612 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165517821 19:36298125-36298147 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165518374 19:36300660-36300682 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165518924 19:36303192-36303214 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165519473 19:36305707-36305729 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165520021 19:36308235-36308257 GGGCAGACACAGCAAGAGGGAGG - Intergenic
1165595477 19:37008784-37008806 CGGGAGACACAGCAAGAGGGAGG - Intronic
1165595894 19:37011097-37011119 GGGCAGACAGAGCAAGAGGGAGG - Intronic
1165601395 19:37058058-37058080 GGAGAGACAGAGCAAGAGGGAGG - Intronic
1165601833 19:37060460-37060482 GAAGAGACAGAGCAAGAGGGAGG - Intronic
1165624046 19:37270346-37270368 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165624592 19:37272887-37272909 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165625135 19:37275414-37275436 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165625669 19:37277952-37277974 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165626209 19:37280477-37280499 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165626750 19:37283004-37283026 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165627290 19:37285525-37285547 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165627831 19:37288053-37288075 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165628368 19:37290577-37290599 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165628908 19:37293102-37293124 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165629451 19:37295628-37295650 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165629992 19:37298153-37298175 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165630535 19:37300681-37300703 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165631071 19:37303219-37303241 GGGCAGACACAGCAAGAGGGAGG + Intergenic
1165631530 19:37305670-37305692 GGGCAGACAGAGCAAGAGGGAGG + Intergenic
1165708823 19:37995233-37995255 CGTGAGAGACAGCAAGAGACAGG + Intronic
1166049862 19:40252232-40252254 CCAGAAACCCAGCAAGAGGGAGG - Intronic
1166295401 19:41887003-41887025 TGGGAGAGACAGCAAGAGATGGG + Intronic
1166317045 19:41994829-41994851 CGGGAGACACAACACGGTGGAGG + Intronic
1166519506 19:43471072-43471094 GAGGTTACACAGCAAGAGGGTGG - Intergenic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166546480 19:43637097-43637119 GAGGAGAGAAAGCAAGAGGGAGG - Intronic
1166554053 19:43686463-43686485 TGGGACACCCAGCAAGAGAGGGG - Intergenic
1166677115 19:44747280-44747302 GGGGAGACAGAGACAGAGGGCGG + Intergenic
1166752463 19:45170842-45170864 GGGGAATCACAGCAAAAGGGAGG + Intronic
1167322720 19:48806451-48806473 CAAGAGACACAGCAAGGAGGAGG + Intronic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167373258 19:49097289-49097311 CTCGAGACACAGAAAAAGGGAGG - Intronic
1167455074 19:49593551-49593573 GAGGAGACACAGCAAGGGGCGGG - Intronic
1168084190 19:54033319-54033341 GTGGAGACACAGCAAGAAGGCGG - Intergenic
1168220311 19:54955761-54955783 TGGGCGACACAGCAAGACTGAGG + Intronic
1168684166 19:58337929-58337951 CTGGAGACAGAGAGAGAGGGAGG - Intronic
1202639166 1_KI270706v1_random:67461-67483 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1202712244 1_KI270714v1_random:24986-25008 CAGGCCACACAGCTAGAGGGTGG + Intergenic
925275575 2:2645666-2645688 CGCGAGACACAGCCAGGGCGGGG + Intergenic
925642463 2:5999135-5999157 CTGGAAACACAGCCAGAAGGTGG - Intergenic
926446189 2:12945880-12945902 AGGGAGACACAGAGAGAGAGAGG - Intergenic
926668703 2:15553769-15553791 AGGGAGAGAGAGAAAGAGGGAGG - Intronic
926906428 2:17809969-17809991 CAGCAGACACAGCAAGAGGATGG - Intergenic
927512864 2:23655228-23655250 TGGGAGACGCAGCAACAGGAAGG - Intronic
927990416 2:27443136-27443158 TGAGTGACACAGCAAGAAGGAGG - Exonic
928320434 2:30278957-30278979 CAGAGGACACAGCAAGAGGTTGG - Intronic
928921812 2:36534580-36534602 AGGGAGAGACAGGAAGAGGGAGG + Intronic
929714092 2:44293134-44293156 TGGGAGACACAGGAAGAGAGAGG + Intronic
929904054 2:46030556-46030578 CAGAAGTAACAGCAAGAGGGAGG - Intronic
930162199 2:48169796-48169818 TATGGGACACAGCAAGAGGGTGG + Intergenic
930246887 2:48992678-48992700 ATAGAGACAGAGCAAGAGGGTGG - Intronic
930324538 2:49898987-49899009 CAGGAGAGAGAGCAAGAGAGGGG + Intergenic
933569683 2:83994885-83994907 TGGGAGAAACACCAAGATGGGGG - Intergenic
933665928 2:84964843-84964865 TGGGTGACACAGCAAGACGCTGG + Intergenic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935497873 2:103804035-103804057 TGTGGGACACAGCAAGAAGGTGG + Intergenic
935963499 2:108449496-108449518 CGTGAGACAGAGAATGAGGGCGG - Intronic
936076264 2:109403696-109403718 GGGGTGACACAGCTAGAGAGAGG - Intronic
936514686 2:113174233-113174255 CGGGACACAGAGCAGGAAGGGGG - Intronic
936651706 2:114435081-114435103 CCGGAGTAACAGCAACAGGGGGG - Intergenic
938132817 2:128732063-128732085 CTGGAGACACAGAAAGACAGAGG + Intergenic
939956326 2:148530446-148530468 CAGAGGACACAGCAAGAAGGTGG + Intergenic
940412114 2:153377167-153377189 GGGGAGAGGCAGCAAGAGGATGG + Intergenic
941361076 2:164552013-164552035 CAAGAGAGAAAGCAAGAGGGAGG + Intronic
942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG + Intronic
944848447 2:203692292-203692314 AGGGAGATACAGCGAGGGGGAGG + Intergenic
945126452 2:206516542-206516564 ATGAAGACACAGCAAGAAGGTGG - Intronic
945530641 2:210950121-210950143 GGGGAGACAGAGGGAGAGGGAGG - Intergenic
946616980 2:221520550-221520572 AGAGAGAGAGAGCAAGAGGGGGG + Intronic
946773920 2:223117877-223117899 ATGGAGACACAGGAAGAAGGAGG + Intronic
946804254 2:223454275-223454297 GTGAAGACACAGCAAGAAGGCGG + Intergenic
947816086 2:233038120-233038142 ACTGGGACACAGCAAGAGGGAGG + Intergenic
948691220 2:239706337-239706359 GGGGAGACAGAGGAGGAGGGAGG - Intergenic
1168826756 20:819327-819349 AGGGAGAGACAGAGAGAGGGAGG - Intergenic
1169400248 20:5273697-5273719 GGTGGGACACAGCAAAAGGGAGG - Intergenic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169938770 20:10914398-10914420 GTGAAGACACAGCAAGAGAGTGG + Intergenic
1170273957 20:14562735-14562757 CAAGAGACCCAGCAAGAAGGAGG - Intronic
1171523572 20:25793387-25793409 GGGCAGACAGAACAAGAGGGAGG + Intronic
1171524732 20:25799873-25799895 GGGGAGACCGGGCAAGAGGGAGG + Intronic
1171531318 20:25855344-25855366 GGGCAGACAGAACAAGAGGGAGG + Intronic
1171531645 20:25857172-25857194 GGGGAGGCAGAGCAAGAGGGAGG + Intronic
1171531654 20:25857231-25857253 GGGAGGACAGAGCAAGAGGGAGG + Intronic
1171533055 20:25864670-25864692 GGGGAGACAGAGCAAGAGGGAGG + Intronic
1171533494 20:25867140-25867162 GGGGAGGCAGAGCGAGAGGGAGG + Intronic
1171533923 20:25869519-25869541 GGGGAGACAGGGCAAGAGGGAGG + Intergenic
1171543406 20:25983792-25983814 GGGGAGACAGGGCAAGAGGAGGG - Intergenic
1171544233 20:25988418-25988440 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1171544505 20:25990034-25990056 GAGCAGACAGAGCAAGAGGGAGG - Intergenic
1171552095 20:26056010-26056032 GGGGAGACCGGGCAAGAGGGAGG - Intergenic
1171553255 20:26062496-26062518 GGGCAGACAGAACAAGAGGGAGG - Intergenic
1171573759 20:26277958-26277980 GGGGAGGCACAGCAAGAGGGAGG - Intergenic
1171779301 20:29404921-29404943 AGGGAGACACAGCAATTGTGAGG + Intergenic
1171793211 20:29547303-29547325 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1171806852 20:29688482-29688504 GGGGAGGCACAGCAAGAGGGAGG - Intergenic
1171846455 20:30280414-30280436 GGGGAGACAGAGCAAGAGGCAGG - Intergenic
1171846887 20:30282852-30282874 GGGGAGGCAGAGCAAGAGGGAGG - Intergenic
1171847429 20:30285478-30285500 GGGGAGGCAGAGCAAGAGGGAGG + Intergenic
1171855243 20:30337076-30337098 GGGGAGACAGAGCAAGAGGGAGG + Intergenic
1171885758 20:30651576-30651598 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1173063967 20:39691738-39691760 AGGGAGTAAAAGCAAGAGGGTGG + Intergenic
1174087125 20:48017206-48017228 CAAGAGAGAGAGCAAGAGGGAGG - Intergenic
1175173223 20:57094026-57094048 CCGGAGACACAGCAAGACCCAGG - Intergenic
1175287738 20:57849045-57849067 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1175331592 20:58168383-58168405 CGGGACACACACCGAGAGGTAGG - Intergenic
1175701897 20:61145261-61145283 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1175750820 20:61495943-61495965 AGGGACACACAGCAGGAGAGAGG + Intronic
1176179397 20:63742310-63742332 CGGGAGACACAGCCAGCCAGTGG - Intronic
1176647489 21:9365070-9365092 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1176679206 21:9810183-9810205 GGGGAGGCAGAGCCAGAGGGAGG + Intergenic
1176850036 21:13906346-13906368 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1176955256 21:15095190-15095212 AGGGGCACACAGCAAGAGTGTGG + Intergenic
1177606255 21:23381354-23381376 CACGAGAAGCAGCAAGAGGGAGG - Intergenic
1177864798 21:26500084-26500106 GTGAAGACACAGCAAGATGGTGG - Intronic
1178135864 21:29626487-29626509 GGGAGGACACAGCAAGAAGGTGG + Intronic
1178178448 21:30132083-30132105 AGGGAGACACAGAGAGAAGGTGG + Intergenic
1178389680 21:32188046-32188068 GCGAAGACACAGCAAGAAGGTGG + Intergenic
1179576236 21:42310160-42310182 CGGGAGACAGAGAAAGACGGGGG + Intergenic
1180362784 22:11914403-11914425 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1180636149 22:17264536-17264558 CGGGAGAGACAGAGAGAAGGAGG - Intergenic
1180985802 22:19903381-19903403 CTACAGACACAGCAAGAGGGAGG + Intronic
1181012954 22:20052922-20052944 CGGCAGAGACAGGAAGAGTGAGG + Intronic
1182103798 22:27674804-27674826 AGGGAGACAGAGAAAGAGAGAGG - Intergenic
1182867372 22:33615530-33615552 GTGAAGACACAGCAAGAAGGTGG + Intronic
1183246555 22:36698187-36698209 CGAGAGAGAGAGAAAGAGGGAGG - Intronic
1183746469 22:39694753-39694775 AGGGAGAGACAGAGAGAGGGAGG - Intergenic
1183967019 22:41447940-41447962 CGGGACACAGAGCCAGGGGGAGG + Intergenic
1184320663 22:43739979-43740001 AGGGAGACACGGCCAGGGGGTGG - Intronic
1184477437 22:44729261-44729283 CGGGAGACTCAGGAACAGTGAGG - Intronic
1184541236 22:45126689-45126711 GTGGAGACACAGCAAGAATGTGG - Intergenic
1184595698 22:45512650-45512672 CGGGAGGCACAGCCAGGGTGGGG + Intronic
950011908 3:9729956-9729978 CTGGGGCCACATCAAGAGGGAGG + Intergenic
950309118 3:11940381-11940403 AGGAAGTCACAGGAAGAGGGAGG - Intergenic
950568623 3:13786467-13786489 GGGGACACACCGCAAGATGGTGG - Intergenic
950681997 3:14591888-14591910 CAGGAGGCACATCAAGAGGAAGG + Intergenic
952330786 3:32362805-32362827 CTGGAGACAGAGCAACAGGAAGG - Intronic
952506262 3:34009174-34009196 AGGGAGAGAGAGAAAGAGGGAGG - Intergenic
952929739 3:38349806-38349828 GTGAAGACACAGCAAGAGAGTGG - Intronic
954479037 3:50780508-50780530 CGAGAGAGAAAGCAAGAGTGAGG + Intronic
956778440 3:72585975-72585997 TGGGGGACACAGCACTAGGGTGG + Intergenic
957351098 3:79022652-79022674 TGGGAGACACAGCACCAGGAAGG + Intronic
957973741 3:87416928-87416950 GTGGAGACACAGCAAGAAGGTGG + Intergenic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960581605 3:119283610-119283632 CAGGAGACAGAGAATGAGGGAGG - Intergenic
960602110 3:119468930-119468952 CGGGAGCCGCAGCACGTGGGCGG - Exonic
961107954 3:124258163-124258185 GGGGAGACAGAGCCAGGGGGTGG + Intronic
961441288 3:126954801-126954823 CAGAAGACACAGCAAGAGGCTGG + Intronic
961460269 3:127045590-127045612 AGGGAGAGAGAGGAAGAGGGAGG + Intergenic
962499390 3:135974641-135974663 AGGGAGACAGAGAACGAGGGAGG - Intronic
965647169 3:170896536-170896558 CAGGAGATACAGCAAGTGAGGGG - Intronic
965647441 3:170898501-170898523 CAGGAGAGACAGCAAGCAGGGGG - Intronic
966735335 3:183182559-183182581 TAGGAGACAAAGCAGGAGGGGGG + Intronic
967483022 3:189996466-189996488 AGGGAGAGACAGGAAGAGGTTGG + Intronic
968187658 3:196644197-196644219 GTGGAGACAAAGCAAGACGGGGG - Intronic
1202739390 3_GL000221v1_random:39917-39939 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
969338091 4:6523316-6523338 CAGGCCACACAGCAAGAAGGAGG - Intronic
969521097 4:7678156-7678178 CTGGAGACACAGCACAGGGGCGG + Intronic
969521170 4:7678521-7678543 CTGGAGACACAGCACAGGGGCGG + Intronic
971024513 4:22575451-22575473 GTGAAGACACAGCAAGACGGTGG + Intergenic
971629322 4:28969351-28969373 ATGAAGACACAGCAAGAAGGAGG + Intergenic
972104298 4:35462680-35462702 AGGGAGACAGAGCAAGACAGTGG - Intergenic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
973274671 4:48294073-48294095 CAGGTGACACAGCAAGAAGGTGG + Intergenic
973369403 4:49233821-49233843 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
974170985 4:58267020-58267042 TGGGGGACACAGCAATAAGGTGG + Intergenic
974561601 4:63529664-63529686 CGGGAGAGAGAGCAAGATGGGGG + Intergenic
974837192 4:67265297-67265319 AGGGAGACACAGAAGGTGGGTGG - Intergenic
974931588 4:68366384-68366406 CGGGAGAGAGAGCATGAAGGGGG - Intergenic
975095882 4:70455893-70455915 AGGGAGGCACAAGAAGAGGGTGG - Intronic
975528191 4:75373947-75373969 CTGAGGACACAGCTAGAGGGAGG + Intergenic
975629469 4:76386144-76386166 CTGGAGGCAGAGCAAGATGGCGG + Intronic
976608142 4:87001828-87001850 AAGCAGACACAGGAAGAGGGAGG - Intronic
976855880 4:89604890-89604912 CAGGAGTCCCAGAAAGAGGGAGG + Intergenic
977728243 4:100322232-100322254 CAGGAGAGAGAGCAAGAAGGGGG + Intergenic
979388592 4:120099912-120099934 GGGAAGACACAGCAAGAAGATGG - Intergenic
979878671 4:125927594-125927616 TGGGAGGCAGAGCAAGATGGTGG + Intergenic
980354272 4:131723706-131723728 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980354809 4:131726212-131726234 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980355344 4:131728689-131728711 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980355893 4:131731190-131731212 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980356428 4:131733681-131733703 CGGCAGACACAGCAAGAGGGAGG - Intergenic
980356967 4:131736169-131736191 GGGCAGACACAGCAAAAGGGAGG - Intergenic
980357507 4:131738661-131738683 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980358047 4:131741150-131741172 GGGCAGACACAGCAAAAGGGAGG - Intergenic
980358577 4:131743641-131743663 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980359120 4:131746114-131746136 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980359660 4:131748585-131748607 GGGGAGACACAGGAAAAGGGAGG - Intergenic
980360198 4:131751077-131751099 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980360742 4:131753552-131753574 GGGCAGACACAGCAAAAGGGAGG - Intergenic
980361284 4:131756032-131756054 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980361825 4:131758507-131758529 GGGCAGACACAGCAAAAGGGAGG - Intergenic
980362367 4:131760987-131761009 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980362907 4:131763470-131763492 GGGCAGACACAGCAAGAGGGAGG - Intergenic
980378376 4:131977522-131977544 GGGCAGACACAGCAAGAGGGAGG + Intergenic
980928680 4:139164093-139164115 AGGGAGAGAGAGAAAGAGGGAGG + Intronic
981259254 4:142700034-142700056 AGGGAGAGAGAGAAAGAGGGTGG - Intronic
982438031 4:155400063-155400085 GGGGAGCCACAGCAAGATGAGGG - Intergenic
1202766516 4_GL000008v2_random:153331-153353 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
985894024 5:2738730-2738752 CCGGAGGCACAGGAGGAGGGAGG - Intergenic
986355030 5:6915595-6915617 CAGGAGCCACAGCAAGAGAGAGG + Intergenic
986928188 5:12784278-12784300 GCGAGGACACAGCAAGAGGGTGG + Intergenic
987007440 5:13724771-13724793 CGAGAGCCAGAGCAAGAGAGTGG - Intronic
987017854 5:13838329-13838351 CGGGCCACACAGCAGGAGGTGGG + Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
988492775 5:31718573-31718595 AAGCAGACACAGCAAGAAGGTGG - Intronic
992092040 5:73326036-73326058 GTGGAGAGGCAGCAAGAGGGTGG - Intergenic
992191392 5:74295419-74295441 GGGAGGAGACAGCAAGAGGGTGG + Intergenic
992451160 5:76877331-76877353 CGAGTGACATAGAAAGAGGGAGG - Intronic
993410763 5:87570437-87570459 GGGAGGACACAGCAAGAAGGTGG + Intergenic
994254410 5:97576279-97576301 GTGAAGACACAGCAAGAAGGTGG + Intergenic
994274853 5:97823088-97823110 CAGGAGTCATAGCAAGATGGTGG - Intergenic
995105999 5:108379468-108379490 TGAGTGATACAGCAAGAGGGTGG - Intronic
995394905 5:111677110-111677132 CGGGAGACACAGCAACAGTTAGG - Intronic
996412192 5:123170419-123170441 TGGGAGGCACAGCAAGAGAGAGG - Intronic
998352948 5:141512880-141512902 CGTGAGACACAGGAAGAGGGTGG - Exonic
999671511 5:153962741-153962763 AGGAAGACACAGCAAGAAGTCGG - Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000405835 5:160887616-160887638 GGGGAGACACAGCAAGGTTGAGG - Intergenic
1001193244 5:169649825-169649847 CGGGTGACAGAGCAAGACGCCGG - Intronic
1001542991 5:172552147-172552169 CCTGAGACACAGCAGGAAGGTGG - Intergenic
1001981057 5:176037296-176037318 CGGGAGAAAGATAAAGAGGGTGG + Intergenic
1002193455 5:177490443-177490465 CAGGAGGAACAGAAAGAGGGAGG + Intronic
1002236404 5:177806770-177806792 CGGGAGAAAGATAAAGAGGGTGG - Intergenic
1002702112 5:181131453-181131475 AGGGAGACACAGGAAGACCGGGG + Intergenic
1003320135 6:5043964-5043986 CAGGAGGCAGAGCGAGAGGGGGG - Intergenic
1003850780 6:10220450-10220472 CGGGCCACACAGCAGGAGGCGGG - Intergenic
1004284484 6:14308067-14308089 CAGGAGCCAGAGAAAGAGGGTGG - Intergenic
1004390515 6:15205740-15205762 TGGGAGACAGAGCAAGACGCCGG - Intergenic
1004410094 6:15373242-15373264 CTTGAGACAGAGCAAGAGGTGGG - Intronic
1004447017 6:15709866-15709888 CAGGAAACAGAGCAAGAGGTGGG - Intergenic
1006128703 6:31855352-31855374 AGGGAGACAGAGGGAGAGGGAGG + Intergenic
1007078123 6:39080668-39080690 CAAGAGTCACATCAAGAGGGAGG - Intronic
1007292245 6:40796703-40796725 AGGGCTACAGAGCAAGAGGGGGG + Intergenic
1007500561 6:42293748-42293770 CTGAATACACAGCAACAGGGTGG - Intronic
1007971309 6:46054750-46054772 GTGGAGATACAGCAAGACGGTGG + Intronic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1008870843 6:56270791-56270813 CAGGAGACAGAGCATGAGGGAGG - Intronic
1010653376 6:78480796-78480818 AGGGAGACAGAGAAAGAGAGAGG + Intergenic
1010922820 6:81704872-81704894 AGGGAGGAAGAGCAAGAGGGAGG + Intronic
1012049277 6:94319681-94319703 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1012189083 6:96259441-96259463 GAGGAGGCACAGCAAGACGGAGG + Intergenic
1013592303 6:111629431-111629453 GGGGAGACACTGCAGGAGGAAGG - Intergenic
1015035693 6:128651557-128651579 CAGGAGACAGAGAAAGTGGGGGG - Intergenic
1015810908 6:137161385-137161407 AGGGAGAGAAAGAAAGAGGGAGG + Intronic
1018212612 6:161496781-161496803 AGGGAGACACAGCAAGAAGGTGG + Intronic
1018726832 6:166619213-166619235 CCCGAGACACAGCATGAGGTTGG - Intronic
1019073499 6:169368580-169368602 GCGAAGACACAGCAGGAGGGCGG + Intergenic
1019867972 7:3730762-3730784 CCTCAGACATAGCAAGAGGGTGG + Intronic
1019967875 7:4514815-4514837 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1020405986 7:7834595-7834617 GTGAAGACACAGCAAGAAGGTGG - Intronic
1020461570 7:8434427-8434449 AGGGAGGGAGAGCAAGAGGGAGG - Exonic
1022327009 7:29341571-29341593 AGGGAGGGACAGAAAGAGGGAGG + Intronic
1024122336 7:46257373-46257395 TGGGAAAGAAAGCAAGAGGGAGG + Intergenic
1025284013 7:57648301-57648323 GGGCAGACAGAGCAAGAGGGAGG + Intergenic
1025284348 7:57650121-57650143 GGGGAGGCAGAGCAAGAGGGAGG + Intergenic
1025284358 7:57650180-57650202 GGGAGGACAGAGCAAGAGGGAGG + Intergenic
1025294795 7:57768891-57768913 GGGGAGACAGAGCAAGAGGAAGG - Intergenic
1025295621 7:57773493-57773515 CGGGAGACAGAGCAAGAGGGAGG - Intergenic
1025295890 7:57775099-57775121 GGGCAGACAGAGCAAGAGGGAGG - Intergenic
1025300749 7:57818306-57818328 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1025301640 7:57823179-57823201 GGGGAGGCAGAGCAAGAGGGAGG - Intergenic
1026330040 7:69344039-69344061 GTGAAGACACAGCAAGAAGGTGG + Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1027409814 7:77904591-77904613 GTGAAGACACAGCAAGAAGGTGG - Intronic
1029310751 7:99661525-99661547 CAGGAGAAATATCAAGAGGGAGG - Intronic
1029331321 7:99858455-99858477 TGGGAGAAATATCAAGAGGGAGG + Intronic
1029601572 7:101566617-101566639 GTGAAGACACAGCAAGAAGGCGG - Intergenic
1029872080 7:103705013-103705035 CAGGAGAAAAATCAAGAGGGTGG - Intronic
1031496708 7:122458153-122458175 GGGGAGAGACACCTAGAGGGTGG + Intronic
1032089559 7:128904423-128904445 CAGGAGAGAGAGAAAGAGGGAGG - Intronic
1033536025 7:142312881-142312903 AGGGAGACAAAGATAGAGGGAGG + Intergenic
1033537933 7:142329026-142329048 AGGGAGAGACAACATGAGGGTGG - Intergenic
1033537951 7:142329091-142329113 CAGGAGAGACAACATGAGGGTGG - Intergenic
1033952762 7:146805572-146805594 AGGAAGGAACAGCAAGAGGGAGG + Intronic
1034137877 7:148788060-148788082 CGTGAGGCACTGCAAGAAGGTGG - Intronic
1034844881 7:154435260-154435282 CGAGAGAGAAAGAAAGAGGGAGG + Intronic
1034985271 7:155509515-155509537 AGGGAGAGACAGAGAGAGGGAGG + Intronic
1035116881 7:156532315-156532337 GTGAAGACACAGCAAGAAGGTGG - Intergenic
1035132462 7:156668632-156668654 CGGGAGACACGGAGTGAGGGAGG - Intronic
1035153885 7:156896631-156896653 GGGGAGAAAGAGCAAGAAGGAGG + Intergenic
1035811436 8:2494930-2494952 CGGGAAACACATCCAGATGGTGG + Intergenic
1035892500 8:3360483-3360505 CTGGGGAAACAGCAAGAAGGAGG - Intronic
1036123592 8:6043859-6043881 GGGGAGAGAGAGAAAGAGGGAGG - Intergenic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1036762095 8:11516422-11516444 TGGGAGAGACAGCAATAGGGCGG - Intronic
1036764367 8:11537983-11538005 CGGGGGAGTCAGCAAGAGGAGGG - Intronic
1037595029 8:20347841-20347863 CAGGAGAGACAGCAAGAAGGGGG + Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037943508 8:22972508-22972530 CTGGAGGCATAGCAAGAAGGAGG - Intronic
1038053021 8:23831187-23831209 CGGGAGAAAGAGCTAGAGAGGGG + Intergenic
1038276680 8:26127195-26127217 GGGAGGACACAGCAAGAGGGCGG - Intergenic
1038339072 8:26669049-26669071 AGGCAGACACACCAAGAGTGAGG - Intergenic
1039442803 8:37607069-37607091 CGGGAGACAGAGTGAAAGGGAGG + Intergenic
1039818513 8:41115782-41115804 CTGGAGAAAGAGCAAGAGTGGGG - Intergenic
1039910465 8:41822843-41822865 CGGGAAGCACAGCACGAGAGCGG + Intronic
1040578776 8:48677779-48677801 AGGCAGACGAAGCAAGAGGGTGG + Intergenic
1041343982 8:56876501-56876523 CGTGAGAGACAGAAGGAGGGAGG + Intergenic
1042171938 8:66000092-66000114 AAGGAGACACAGACAGAGGGAGG - Intergenic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1043208342 8:77476345-77476367 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1044799878 8:95943161-95943183 GGAGAAACACAGCAAGAAGGGGG - Intergenic
1046581751 8:116101885-116101907 AGGGAGATAAAGGAAGAGGGAGG - Intergenic
1046593249 8:116230410-116230432 AGAGAGACACAGCAAATGGGAGG + Intergenic
1046805532 8:118475282-118475304 TGAGAGAGACAGCAAGAGAGGGG - Intronic
1047369506 8:124244981-124245003 CGGGAGACACATCCCCAGGGGGG - Intergenic
1047612038 8:126530439-126530461 GTGGAGACACAACAAGAAGGTGG - Intergenic
1047979189 8:130162391-130162413 CATGAGACAAAGCAAGAGGCAGG + Intronic
1048709659 8:137195187-137195209 AGGGAGACAGAGCGGGAGGGAGG + Intergenic
1048878718 8:138856674-138856696 CAGGAGAGACAGCAAGAGAGAGG + Intronic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1050593146 9:7180542-7180564 CAGCAGATATAGCAAGAGGGAGG + Intergenic
1052877287 9:33576370-33576392 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1053348779 9:37397743-37397765 GGGAAGACATAGCAAGAAGGTGG - Intergenic
1053375982 9:37606811-37606833 TGGGACACACAGCCAGAGAGAGG + Intronic
1053498715 9:38568024-38568046 CTGGAGACAGGGCAAGAGGAAGG - Intronic
1053662477 9:40293281-40293303 CTGGAGACAGGGCAAGAGGAAGG + Intronic
1053749103 9:41235444-41235466 CTGGAGTCTCAGCGAGAGGGTGG - Intergenic
1053793075 9:41700365-41700387 GGGGAGACAGAGCAAGAGGGAGG + Intergenic
1053912931 9:42923456-42923478 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1054152100 9:61614459-61614481 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1054159901 9:61666479-61666501 GGTGAGGCACAGCAGGAGGGAGG - Intergenic
1054160443 9:61669110-61669132 GGGGAGGCAGAGCAAGAGTGAGG + Intergenic
1054161628 9:61675401-61675423 GGGGAGACAGAGCAAGAGGAAGG + Intergenic
1054172544 9:61855229-61855251 GGGGAGGCAGAGCCAGAGGGAGG - Exonic
1054173307 9:61859017-61859039 GGGGAGGCAGAGCAAGACGGAGG - Intergenic
1054181483 9:61912386-61912408 GGGGAGACAGAGCAAGAGGGAGG + Intergenic
1054254542 9:62800297-62800319 CTGGAGTCCCAGCGAGAGGGTGG - Intergenic
1054336761 9:63815305-63815327 CTGGAGTCTCAGCGAGAGGGTGG + Intergenic
1054374606 9:64439506-64439528 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1054447395 9:65384240-65384262 GGGGAGGCAGAGCCAGAGGGAGG - Intergenic
1054471874 9:65545603-65545625 GGGGAGACAGAGCAAGAGGGAGG - Intergenic
1054664235 9:67721764-67721786 GGGGAGGCAGAGCAAGACGGAGG + Intergenic
1054664996 9:67725572-67725594 GGGGAGGCAGAGCCAGAGGGAGG + Intergenic
1054764147 9:69029007-69029029 AGGAAGAGGCAGCAAGAGGGCGG - Intergenic
1054884997 9:70186819-70186841 GGTGAGACAGAGCAAGAGGGAGG + Intronic
1055153216 9:73028436-73028458 GGGGAAACACGGCAAGAGGCAGG + Intronic
1055602121 9:77930873-77930895 CGGGCCGCACAGCAAGAGAGTGG + Intronic
1056644311 9:88397643-88397665 TGGGAGACAGAGCAAGACTGGGG - Intronic
1057115977 9:92522536-92522558 AGAGAGAGACAGAAAGAGGGAGG - Intronic
1057161768 9:92894322-92894344 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1057678166 9:97152517-97152539 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1058482531 9:105411391-105411413 ATGGAGACAGAGCAAGAGAGAGG - Intronic
1058495512 9:105554728-105554750 AGAGAGGCACAGCAAGAGTGTGG - Intergenic
1059419800 9:114183769-114183791 CTGGAGACAGAGCCAGGGGGAGG + Intronic
1059496994 9:114718239-114718261 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060121700 9:120997479-120997501 AGAGAGACACAGAAAGGGGGGGG - Intronic
1061140887 9:128765766-128765788 GGGGAGTCACAGCAAGTGTGGGG + Intronic
1061393673 9:130331796-130331818 CGGGAGCCACAGCCAGAGCCAGG - Intronic
1061395098 9:130339475-130339497 AGAGAGACACAGGAACAGGGAGG + Intronic
1061634845 9:131901008-131901030 GGGGAGACACAAGGAGAGGGGGG + Intronic
1062034005 9:134374662-134374684 GGGGAGGCACAGCAAGTGGGTGG + Intronic
1062142729 9:134968729-134968751 CGGGAGACTCACACAGAGGGTGG - Intergenic
1062405543 9:136394557-136394579 GGGGAGACTGAGCCAGAGGGTGG + Intronic
1062610059 9:137369552-137369574 CTGGGGACACAGCAAGGGGCAGG + Intronic
1203708033 Un_KI270742v1:69866-69888 CTGGAGACAGGGCAAGAGGAAGG + Intergenic
1203547271 Un_KI270743v1:138209-138231 CTGGAGACAGGGCAAGAGGAAGG - Intergenic
1203664378 Un_KI270754v1:12719-12741 GGGGAGGCAGAGCCAGAGGGAGG + Intergenic
1185538484 X:883027-883049 GGAGAGACAGAGAAAGAGGGAGG + Intergenic
1185538513 X:883402-883424 AGAGAGACAGAGAAAGAGGGAGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1188266357 X:28080716-28080738 GTGAGGACACAGCAAGAGGGTGG + Intergenic
1188434641 X:30147263-30147285 GGGAAGCAACAGCAAGAGGGTGG - Intergenic
1188475732 X:30589665-30589687 CAGGAGAGAAAGCAAGAGGTGGG + Intergenic
1188643382 X:32534647-32534669 GGGAGGACACAGCAAGAAGGAGG - Intronic
1189339077 X:40190858-40190880 AGGGAGACACACCAAGAGGGAGG + Intergenic
1189868933 X:45361579-45361601 CAGGAGACAGAGCAAGATGATGG - Intergenic
1189973581 X:46441230-46441252 GGAGAGACAGAGCAAGAGAGGGG + Intergenic
1191008159 X:55733124-55733146 CTGGAGACACAGAAACGGGGAGG - Intronic
1195003767 X:100667155-100667177 TGGGAGAAACAGCCAGAGAGAGG + Intronic
1199881800 X:151979386-151979408 AGGAAGACACAGCTAGAGGGAGG + Intergenic
1201516626 Y:14825241-14825263 AGGGAGAGACAGGAAGAGAGAGG - Intronic