ID: 1165595879

View in Genome Browser
Species Human (GRCh38)
Location 19:37011005-37011027
Sequence CTCTGGACAAGTCACCTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 2, 2: 7, 3: 30, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165595879 Original CRISPR CTCTGGACAAGTCACCTGTT TGG Intronic
903020728 1:20391997-20392019 TTCTGGATAAGTAACCTGTAGGG - Intergenic
911257240 1:95646629-95646651 CTCTGCTGAGGTCACCTGTTGGG + Intergenic
912384761 1:109265788-109265810 CTCTGGACAAGGAGCCTGTGGGG - Exonic
913666065 1:121049887-121049909 CTCTGCACAAGTCTCCTGGGAGG - Intergenic
913936869 1:125063833-125063855 CTCTGGACAAGCCACCCTTTAGG - Intergenic
913937477 1:125067434-125067456 CTCTGGACAAGCCACCCTTTAGG + Intergenic
914017463 1:143833163-143833185 CTCTGCACAAGTCTCCTGGGAGG - Intergenic
914656074 1:149741695-149741717 CTCTGCACAAGTCTCCTGGGAGG - Intergenic
915892599 1:159785307-159785329 CTCTGCAGTAGTCACCTCTTGGG + Intergenic
919315563 1:195967586-195967608 CTTTACAAAAGTCACCTGTTGGG - Intergenic
922454306 1:225762544-225762566 CTCTGGATAAGACACCAGTGAGG + Intergenic
1067904362 10:50275452-50275474 CCCTGTACAAGCCACCTCTTAGG + Intergenic
1068569790 10:58616287-58616309 CTCTGAGCATGTCACTTGTTGGG - Intronic
1070760116 10:79018854-79018876 TTCTGGACATGTTTCCTGTTTGG + Intergenic
1071463510 10:85920059-85920081 CTCTGGAGAAGTCCCCAGTAGGG - Intronic
1073848352 10:107585729-107585751 GTCTGGGCAAGTCACCTGTGTGG + Intergenic
1078666717 11:13331890-13331912 CTCTGGAGAAGTCACCTGTTGGG + Intronic
1079105191 11:17567192-17567214 CTCTGGACATGTCACCTGTGTGG - Intronic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1084420493 11:69058251-69058273 CTCTCCACAAGGCACCTGTGGGG - Intronic
1091987885 12:4927801-4927823 TTCTAGAAAAGTGACCTGTTGGG + Intronic
1092112619 12:5974493-5974515 CTCTGGTCCAGTCAACTATTGGG - Intronic
1095038260 12:37418119-37418141 CTCCGGACAAGCCACCCTTTTGG - Intergenic
1095038727 12:37420550-37420572 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1095039101 12:37422518-37422540 CTCAGGACAAGTCACCCGTTTGG - Intergenic
1095049688 12:37544811-37544833 CTCTGGACAAGCCACCGGTTCGG + Intergenic
1098224618 12:68308784-68308806 CTCTGGACAAGGAGCCTCTTTGG - Intronic
1100949317 12:99828255-99828277 CTCTGGACTAGACCCCTGATTGG + Intronic
1101292331 12:103383830-103383852 CTCTGGACTAGGCACCTTATTGG - Intronic
1109837284 13:67876823-67876845 CTCTGTACAAGTCACATGGTAGG - Intergenic
1114233185 14:20802042-20802064 CTCTGGAGAAGTCTCTTGTCCGG - Exonic
1115777247 14:36729141-36729163 AGCTGGAAAAGTGACCTGTTTGG + Intronic
1121332277 14:93057128-93057150 CTCTGGGCAAGTCGCCTGTGAGG - Intronic
1121745209 14:96283580-96283602 TCCTGGACAAGTCATCCGTTTGG + Exonic
1126028893 15:44476675-44476697 CTCTAGGCAACCCACCTGTTCGG - Intronic
1126525088 15:49644937-49644959 CTCTGATAAATTCACCTGTTTGG + Exonic
1127427985 15:58874764-58874786 CTCTGGACAGGTAGCCTGCTAGG - Intronic
1131226331 15:90627385-90627407 GTCTGGGCAATTCACCTTTTGGG + Intronic
1131787000 15:95924199-95924221 CTGTTGACAGTTCACCTGTTAGG + Intergenic
1135075638 16:19391080-19391102 CTCTGGACACGCCACCTTTAAGG - Intergenic
1136932628 16:34432794-34432816 TTCTGGCCAAGTCACCCGTTTGG + Intergenic
1136971944 16:34979020-34979042 TTCTGGCCAAGTCACCCGTTTGG - Intergenic
1139397451 16:66651583-66651605 CTCTGGATAAGTCATATGTTAGG - Intronic
1139581125 16:67874184-67874206 CTATGGAGAAGCCACCTATTAGG + Intronic
1141908424 16:87042520-87042542 GTCCTGACAAGACACCTGTTAGG - Intergenic
1141981815 16:87555238-87555260 CTCTGTCCCAGTCTCCTGTTGGG + Intergenic
1143867015 17:9931423-9931445 CTTTGGAAAGGTCACCTGCTGGG - Intronic
1145306432 17:21677837-21677859 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1145369919 17:22299689-22299711 CTCTGAACAAGTTACCCTTTTGG + Intergenic
1145370581 17:22303513-22303535 TCCTGGCCAAGTCACCCGTTTGG + Intergenic
1145386082 17:22412468-22412490 CTCTGGACAAGTCACCAGTTTGG + Intergenic
1145850346 17:28087850-28087872 CTTTAGACATGTCACCTCTTTGG + Intronic
1151033731 17:70773057-70773079 CTCTGGAGAAGTGACCTCTCGGG + Intergenic
1152515804 17:80823587-80823609 CTCTGGAGAATTAAACTGTTGGG + Intronic
1152990435 18:358682-358704 CCATGGACCAGTTACCTGTTAGG - Intronic
1153407620 18:4758539-4758561 CTCAAGAGAAGTCACCTGTCTGG - Intergenic
1154404742 18:14079156-14079178 CTGTAGACAAGTCACCTCTGTGG - Intronic
1158284169 18:55860764-55860786 CTTTAGGCCAGTCACCTGTTAGG + Intergenic
1158390071 18:57037802-57037824 CTCTGTTCAAGTCACCTGGGAGG - Intergenic
1159925277 18:74263555-74263577 TTCTGAAGGAGTCACCTGTTTGG - Intronic
1162000299 19:7740467-7740489 CTCTGGAAATGTCACCTTTTCGG - Exonic
1165553034 19:36605002-36605024 CTGTGTGCAAGTCACCTGCTGGG - Intronic
1165595458 19:37008691-37008713 TTCTGGACAAGTCACCCGTTTGG + Intronic
1165595879 19:37011005-37011027 CTCTGGACAAGTCACCTGTTTGG + Intronic
1165601814 19:37060368-37060390 CTTTGGACAAGTCACCCGTTTGG + Intronic
927963913 2:27257570-27257592 ACTTGGGCAAGTCACCTGTTGGG + Intronic
929485110 2:42346102-42346124 CACTGGGCCAGTCAGCTGTTTGG - Intronic
929561690 2:42960330-42960352 CTCTGGGCCACTCACCTGCTCGG - Intergenic
932851253 2:75189254-75189276 CTCTGGGCAAGACCCCTGTGAGG + Intronic
937072125 2:119072497-119072519 CTCTGGAGAAGTCACCCAATGGG + Intergenic
942406482 2:175661474-175661496 CTGTGCAAAAGTCACCTCTTGGG - Intergenic
947278201 2:228418883-228418905 TTCTGGACAAGTCACTTTTATGG + Intergenic
948628880 2:239288934-239288956 CTCTAGACAAGTCACAGCTTAGG + Intronic
1169167206 20:3434302-3434324 CTCTGGAAATGTCACCTGCCAGG - Intergenic
1171223074 20:23418986-23419008 TTCTGGAAAAGTTATCTGTTTGG + Intronic
1171413443 20:24961794-24961816 CTCTGGCCAAGCCCCGTGTTGGG - Intergenic
1171413512 20:24962093-24962115 CTCTGGCCAAGCCCCATGTTGGG - Intergenic
1171523934 20:25795279-25795301 CTCTGGACAAGCCATCCCTTTGG - Intronic
1171524348 20:25797534-25797556 CTCTGGACAAGCCACCCTTTTGG - Intronic
1171531677 20:25857324-25857346 CGCTGGACAAGCCACCCTTTTGG - Intronic
1171533082 20:25864822-25864844 CTCTGGACAAGCCACGCTTTTGG - Intronic
1171543388 20:25983699-25983721 TTCTGGAAAAGCCACCTTTTTGG + Intergenic
1171544211 20:25988325-25988347 CTCTGGACAAGTCACTGGTTAGG + Intergenic
1171552479 20:26058349-26058371 CTCTGGACAAGCCACCCTTTTGG + Intergenic
1171552893 20:26060604-26060626 CTCTGGACAAGCCATCCCTTTGG + Intergenic
1171573734 20:26277858-26277880 CTCTGGACAAGCCACCCTTTTGG + Intergenic
1171806831 20:29688382-29688404 CTCTGGACAAGCCACCCTTTTGG + Intergenic
1171837081 20:30167370-30167392 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1171846130 20:30276045-30276067 CTCAGGAGAAGACACCTGTCCGG + Intergenic
1171846436 20:30280321-30280343 TTCTGGAAAAGCCACCTTTTTGG + Intergenic
1173327472 20:42047090-42047112 GTGTGGACAAGTAACTTGTTGGG + Intergenic
1174208038 20:48855500-48855522 CTCTGTTCCAGTCATCTGTTAGG + Intergenic
1176679226 21:9810276-9810298 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1181530816 22:23516405-23516427 CTCGGGAAATGTCAGCTGTTGGG - Intergenic
1182544191 22:31064092-31064114 CTCTGGACCAATCAGCTGTGGGG + Intronic
1185348918 22:50324031-50324053 CTCTTGAAAACTCACCTCTTGGG - Intronic
952045480 3:29313762-29313784 CTATAAACCAGTCACCTGTTTGG - Intronic
952240885 3:31530726-31530748 CATTGGACAAGTCACCTGCATGG - Intergenic
955076538 3:55619032-55619054 CCCTGGAGAAGACACCTGTTGGG - Intronic
960939730 3:122925813-122925835 CTATAGGAAAGTCACCTGTTTGG + Intronic
961741085 3:129033515-129033537 CTGTGCACCAGGCACCTGTTAGG - Intronic
963540544 3:146582290-146582312 GTCTGGGCAAGTCAGCTGTGTGG - Intronic
965554946 3:170009092-170009114 CTCAGGACAAATGCCCTGTTTGG + Intergenic
971178888 4:24308831-24308853 CTCTGGGTAAGTCATCTTTTTGG - Intergenic
973037701 4:45426952-45426974 CACTGTACTAGTCACCTGTAAGG - Intergenic
973809022 4:54552127-54552149 TTCTAGACAAGTCATCGGTTTGG - Intergenic
975802831 4:78080125-78080147 CTCTGGCAAACTCACTTGTTTGG + Intronic
985215758 4:187651889-187651911 ATCTGGCCATGTCATCTGTTTGG + Intergenic
985578606 5:685168-685190 CTCTGGACCAGTGACCTCTCAGG - Intronic
986083165 5:4415014-4415036 TTCTGGACAGGGCAACTGTTTGG - Intergenic
986401248 5:7383905-7383927 CTCTTCCCTAGTCACCTGTTGGG - Intergenic
990516295 5:56533984-56534006 CTTTGGATAAGTCACCTGCTGGG + Intronic
996027341 5:118661631-118661653 TCCAGGACAGGTCACCTGTTGGG - Intergenic
1001333433 5:170778457-170778479 CTCTGGACAGGCCACATCTTGGG + Intronic
1002096162 5:176832281-176832303 CTGTGGAGAAGTCAGGTGTTTGG + Intronic
1002554759 5:180027694-180027716 CTCTCCACACGTCACCTGTGGGG + Intronic
1004505153 6:16241177-16241199 CTCTGTACAAATCTGCTGTTAGG - Intronic
1008158099 6:48042252-48042274 CTATGTAGAAATCACCTGTTTGG - Intronic
1013696703 6:112710821-112710843 CTCTAATAAAGTCACCTGTTGGG + Intergenic
1019904736 7:4053266-4053288 CTCTGCAAATGTCACCTGCTGGG - Intronic
1020056637 7:5122026-5122048 TTCTGCACAAGTCACGTGTGCGG + Intergenic
1020171267 7:5846941-5846963 TTCTGCACAAGTCACGTGTGCGG - Intergenic
1025284808 7:57652628-57652650 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1025285163 7:57654589-57654611 CTCAGGACAAGTCACCCGTTTGG - Intergenic
1025294778 7:57768798-57768820 TTCTGGAAAAGCCACCTTTTTGG + Intergenic
1025301154 7:57820635-57820657 CTCCGGACAAGCCACCCTTTGGG + Intergenic
1025301610 7:57823027-57823049 CTCTGGACAAGCCACCCTTTTGG + Intergenic
1028835141 7:95366291-95366313 CTGTGGACAAGTCACTTAATTGG - Intronic
1034447893 7:151122813-151122835 CTCTGGACATGCCCCCTGTGCGG + Intronic
1037122872 8:15310353-15310375 CTCTGGACAAGTGACAAGTGGGG - Intergenic
1044266845 8:90191799-90191821 CTATGGTCAAATCAGCTGTTTGG + Intergenic
1044480078 8:92675671-92675693 CTTTGGACAAGTCACTTCTTTGG - Intergenic
1048706978 8:137164612-137164634 CTTTGGAAAAGTCACCTCTCTGG + Intergenic
1049724335 8:144138499-144138521 CGCTGGACCACGCACCTGTTGGG - Exonic
1053784556 9:41644986-41645008 CCCTGGACAAGCCACCCTTTTGG + Intergenic
1053785138 9:41647796-41647818 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1054159880 9:61666386-61666408 CTCTGGACAAGCCACCGTTTTGG + Intergenic
1054161647 9:61675494-61675516 TTCTGGAAAAGCCACCTTTTTGG - Intergenic
1054161954 9:61679798-61679820 CTCAGGAGAAGACACCTGTCAGG - Intergenic
1054172522 9:61855136-61855158 CCCTGGACAAGCCACCCTTTAGG + Exonic
1054173283 9:61858924-61858946 CCCTGGACAAGCCACCCTTTTGG + Intergenic
1054173864 9:61861746-61861768 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1054447373 9:65384147-65384169 CTCTGGACAAGCCACCCTTTAGG + Intergenic
1054448141 9:65388008-65388030 CCCTGGACAAGCCACCCTTTTGG + Intergenic
1054448720 9:65390812-65390834 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1054663676 9:67719035-67719057 CTCTGGACAAGCCACCCTTTTGG + Intergenic
1054664259 9:67721857-67721879 CCCTGGACAAGCCACCCTTTTGG - Intergenic
1054665018 9:67725665-67725687 CCCTGGACAAGCCACCCTTTAGG - Intergenic
1055728171 9:79253929-79253951 CTCTTGACCTCTCACCTGTTGGG + Intergenic
1057758829 9:97856868-97856890 ATGTGGACTAGTCACCTGCTAGG + Intergenic
1061325042 9:129858589-129858611 CTCTGAACAGGTAACCTGTGTGG + Exonic
1203664398 Un_KI270754v1:12812-12834 CTCTGGACAAGCCACCCTTTTGG - Intergenic
1188800389 X:34522688-34522710 TTCTGGACAAATTACATGTTTGG - Intergenic
1192356636 X:70410306-70410328 CTCTGGACAAGTCATCATTTTGG - Intronic
1194940923 X:100009119-100009141 CTGTGGAGAAGTCAGCTGGTAGG + Intergenic
1195333054 X:103821668-103821690 GTCTGGACAATTCACCAGTCAGG + Intergenic
1200966909 Y:9055240-9055262 CTCTGGACATGCCACCTTTAAGG + Intergenic