ID: 1165600028

View in Genome Browser
Species Human (GRCh38)
Location 19:37046717-37046739
Sequence ATACATTTACATACAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165600026_1165600028 0 Left 1165600026 19:37046694-37046716 CCATGTTGTTCAAATACATTCAA 0: 1
1: 0
2: 3
3: 36
4: 305
Right 1165600028 19:37046717-37046739 ATACATTTACATACAGGCCAAGG 0: 1
1: 1
2: 1
3: 24
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165600028 Original CRISPR ATACATTTACATACAGGCCA AGG Intronic
902964230 1:19986744-19986766 ACACAGTTACCTACGGGCCATGG - Intergenic
903551611 1:24161060-24161082 ATTCATTTACGTATAGGCTACGG + Intronic
905260849 1:36717316-36717338 ATACATGTACAGACATGCCTCGG + Intergenic
907634009 1:56114872-56114894 ATAAATGTACATATAGGACATGG - Intergenic
908675786 1:66602018-66602040 ATTCCTTTACATACAGACCAAGG + Intronic
908685942 1:66720026-66720048 ATACATGTACATACTGACAATGG + Intronic
910085795 1:83400813-83400835 ACACATATACATACACGACAAGG - Intergenic
911964861 1:104353879-104353901 ATACATTTACATATTGTCTATGG + Intergenic
912781356 1:112551556-112551578 ATTCATTTACATATTGGCTAAGG + Intronic
919093343 1:192999597-192999619 ATACATATACATATACGCCATGG + Intergenic
919318767 1:196007199-196007221 ATTCATTTACAGACCGGGCATGG + Intergenic
920668489 1:207984276-207984298 ATAAATAAACAAACAGGCCAAGG + Intergenic
921512980 1:216054796-216054818 GTCCAATTACAGACAGGCCAAGG - Intronic
921628621 1:217405926-217405948 ATACATATACATACATGTGAGGG - Intergenic
922509449 1:226151660-226151682 ATAAATTTAAATAAATGCCAGGG + Intronic
923715734 1:236423449-236423471 TGACATTTTCATGCAGGCCACGG - Intronic
924111640 1:240705294-240705316 AAACATTTTCATGCAGGGCATGG - Intergenic
1063620849 10:7647278-7647300 ATTCATTTACATACTGTCTATGG + Intronic
1064352315 10:14587462-14587484 ATACATTTAAATAAATGCCTAGG + Intronic
1064789584 10:18941114-18941136 ATACATATACATACACACAATGG + Intergenic
1064811294 10:19201636-19201658 ATAAATATACATAGAGTCCAGGG - Intronic
1065825234 10:29564543-29564565 GTGCATTTCCATAGAGGCCAAGG + Intronic
1065952177 10:30662367-30662389 GTGCATTTCCATAGAGGCCAAGG - Intergenic
1069277713 10:66613134-66613156 ATAGTTTCACATGCAGGCCAAGG - Intronic
1070015356 10:72523826-72523848 ATATACTTACAGACGGGCCAAGG - Intronic
1070119113 10:73558427-73558449 ATACAATTGCATACAGGCATGGG + Intronic
1071119078 10:82257116-82257138 AAAAATTTACATACATTCCAGGG - Intronic
1073718448 10:106136786-106136808 ATACATTTTCAAATAGTCCATGG + Intergenic
1083482173 11:62956429-62956451 ATAAATATACATGCAGGTCATGG - Intronic
1087005702 11:93468459-93468481 ATGCATTTCCTCACAGGCCATGG + Intergenic
1089672401 11:120065554-120065576 ATTCATTTACACACTGGGCAAGG + Intergenic
1089721204 11:120424566-120424588 ATTCATTTACATATAGTCTATGG - Intronic
1091144599 11:133266701-133266723 ATACATGAACACACAGTCCAAGG + Intronic
1091176254 11:133560989-133561011 ATACATTTAAAAACACTCCATGG - Intergenic
1095039498 12:37425710-37425732 ATACATTTGCATAGAGGCCCAGG - Intergenic
1098370569 12:69755920-69755942 ATTCATTTACATACTGTCTATGG - Intronic
1099485598 12:83225673-83225695 TTACATTTAATTACAGTCCATGG - Intergenic
1101334279 12:103782465-103782487 ATTCATTCACATACTGTCCACGG + Intronic
1101574567 12:105985544-105985566 ATTGATTTACATACAGCCTATGG - Intergenic
1107108328 13:36670592-36670614 ATGCATCTACCTACAAGCCAAGG + Intergenic
1107613063 13:42135693-42135715 ATACATTCACATACAGCATAGGG - Intronic
1108690746 13:52857240-52857262 ACTCATTTAAATACTGGCCAAGG - Intergenic
1109100095 13:58172828-58172850 ATACATTTATATATAGGGGATGG + Intergenic
1111388379 13:87560566-87560588 ATACATATACATACACACCATGG + Intergenic
1112684733 13:101811609-101811631 ATTCCTTTGCATAGAGGCCAAGG + Intronic
1115096690 14:29646163-29646185 AGACATTTGCATAGACGCCAAGG + Intronic
1116270315 14:42756102-42756124 ATACATTAACAAAAAAGCCATGG - Intergenic
1120265906 14:82250824-82250846 ATACATTTTCAAACATGACAAGG - Intergenic
1120387580 14:83865370-83865392 ATACATTTGCATACAGATTATGG - Intergenic
1120901195 14:89577081-89577103 CTACATTTACTCACATGCCAAGG + Intronic
1121244289 14:92451138-92451160 ATGCATTTAGATAAGGGCCAAGG + Intronic
1121896386 14:97651900-97651922 ATTCATTTACATATTGTCCACGG - Intergenic
1123203378 14:106689976-106689998 ATACATTTAAAGACATGCCTCGG + Intergenic
1123483932 15:20666610-20666632 ATTCATTTACATACAGTCTGTGG + Intergenic
1125064826 15:35469864-35469886 ATACATTTACAAAGTGGGCAGGG + Intronic
1126969411 15:54093419-54093441 ATACATTTACATAAAAGCAAAGG - Intronic
1129921426 15:79322441-79322463 AGACATTTACAACTAGGCCAGGG + Exonic
1130213927 15:81951153-81951175 ATTCATTTACATGCAAGCGATGG - Intergenic
1132504216 16:298759-298781 ATATATATATATACAGGCCAAGG - Intronic
1134789853 16:16980047-16980069 ATACATTTACATACACACATAGG + Intergenic
1134812386 16:17178662-17178684 ATTCATTTACATACTGTCTATGG + Intronic
1135579108 16:23610138-23610160 ATCCATTTGCATACAGTCTATGG + Intronic
1136375323 16:29862023-29862045 ATACAAGTCCATTCAGGCCAGGG - Intronic
1139308997 16:66012504-66012526 AGATATTGACACACAGGCCAAGG + Intergenic
1140532824 16:75681916-75681938 ATATATATACATACATACCATGG - Intronic
1142792011 17:2274115-2274137 ATTCATTTACATATTGTCCATGG + Intronic
1145378372 17:22372727-22372749 ATACATTTACTCAGAGGCCCAGG + Intergenic
1145854953 17:28146104-28146126 ATACATTTTGAAAAAGGCCATGG + Intronic
1146307434 17:31741351-31741373 ATACATTTTCATCCAGTACAGGG - Intergenic
1146976549 17:37118072-37118094 TCATATTTACATACAGGTCAGGG - Intronic
1147700445 17:42390674-42390696 ATAAATAAACATTCAGGCCAAGG + Intergenic
1148197354 17:45723679-45723701 AAACATGAACATTCAGGCCAGGG + Intergenic
1153845343 18:9044297-9044319 ATACATTTGCATAGAGACTATGG + Intergenic
1153975099 18:10262377-10262399 AAAAATTTACCTCCAGGCCAAGG - Intergenic
1155129367 18:22915862-22915884 ATACATTTATATAAAATCCATGG + Intronic
1156931798 18:42654026-42654048 ATACATAGACATACACACCATGG + Intergenic
1157427009 18:47592753-47592775 GTACTTTTACAGACAGGTCAAGG + Intergenic
1158225403 18:55196097-55196119 ACTCATTTACATACAGTCTATGG + Intergenic
1160494509 18:79364580-79364602 ATAGCTTTACATATAGGTCAAGG - Intronic
1163096247 19:15059428-15059450 ATTCACTTACATACTGGCTACGG + Intergenic
1165148161 19:33745317-33745339 ATACATTTTTTTACATGCCAGGG + Intronic
1165600028 19:37046717-37046739 ATACATTTACATACAGGCCAAGG + Intronic
1167813801 19:51860365-51860387 ATACATTTACCTAAAAGCAATGG - Intronic
925674445 2:6345844-6345866 ATACATTTAAATACAGGTTAGGG + Intergenic
927578705 2:24222417-24222439 ACAAACTTACATAAAGGCCATGG + Intronic
928545008 2:32321483-32321505 TTACATTGACATACATGCCTAGG - Intergenic
928604343 2:32931456-32931478 ATTCATTTGCATACTGCCCATGG + Intergenic
929194917 2:39175147-39175169 GTACAATTTCATAGAGGCCATGG + Intergenic
929264936 2:39907823-39907845 ATACATTTTCAAACAAGCCGTGG + Intergenic
930201369 2:48554612-48554634 GTAAATTTACATATAGGCTAAGG + Intronic
930582867 2:53233261-53233283 ATTCATTTACATATGGGCTATGG - Intergenic
933356562 2:81217604-81217626 ACCCATTTCCATACAGGCCCTGG + Intergenic
933387499 2:81629889-81629911 ATACATTTTAAGAAAGGCCATGG + Intergenic
936009463 2:108916259-108916281 AAACATTCACAGACAGCCCACGG - Intronic
936974010 2:118201712-118201734 GCATATTTAGATACAGGCCAGGG - Intergenic
939598424 2:144157393-144157415 AGACATTTACACATAGGCCATGG + Intronic
940725045 2:157327630-157327652 AAACATCTGCACACAGGCCAGGG - Exonic
940753814 2:157659055-157659077 ATTCATTTTCATACTGTCCATGG - Intergenic
942624564 2:177885805-177885827 GTACATTTACATAAGGACCAAGG + Intronic
943230076 2:185238838-185238860 ATTCATTTACATATTGCCCATGG + Intergenic
944270009 2:197771841-197771863 ATGAAATTACTTACAGGCCAAGG + Exonic
946223385 2:218248253-218248275 GTTCATTTACTTTCAGGCCAGGG + Intronic
947283253 2:228480349-228480371 ATATATTTATATATATGCCAGGG + Intergenic
947980754 2:234407186-234407208 ATACAATTACGTACAGTACATGG + Intergenic
948036990 2:234865716-234865738 ACTCAGTTACATGCAGGCCATGG - Intergenic
1169822993 20:9734568-9734590 ACACACATACACACAGGCCACGG + Intronic
1169962919 20:11182212-11182234 GTACATATTCTTACAGGCCAAGG + Intergenic
1171524904 20:25801263-25801285 ATACATTTACACAGAGGCCCAGG - Intronic
1171551923 20:26054620-26054642 ATACATTTACACAGAGGCCCAGG + Intergenic
1171571264 20:26253804-26253826 ATACATTTACATACAGGCCCAGG - Intergenic
1171793035 20:29545923-29545945 ATACATTTACACAGAGGCTCAGG + Intergenic
1171855417 20:30338483-30338505 ATACATTTACACAGAGGCTCAGG - Intergenic
1173268851 20:41513068-41513090 CTACATTTACTAACATGCCAAGG + Intronic
1173877421 20:46383069-46383091 ATTCATTTACCTACTGGCCGAGG + Intronic
1174683357 20:52429975-52429997 ATACATACACATACACACCATGG + Intergenic
1177619717 21:23572290-23572312 ATACATTTAAATACATACAATGG + Intergenic
1177633970 21:23762913-23762935 ATGTATTTAAATACAGTCCAAGG + Intergenic
1178733378 21:35126452-35126474 ATACACATACATACACACCATGG + Intronic
1180573447 22:16750823-16750845 ATACATTTACATAGAGGCCCAGG - Intergenic
1183029651 22:35093983-35094005 ACAGATATACATACAGGCAATGG + Intergenic
949200453 3:1372135-1372157 AGACATTTAAAAACAGGCAAAGG + Intronic
949837743 3:8287423-8287445 CTTCATTTACATACTGTCCATGG - Intergenic
950218667 3:11178070-11178092 TGACATTTAGATCCAGGCCATGG + Intronic
951595033 3:24309162-24309184 ATACATATACAAAAAGGCCAAGG - Intronic
951729291 3:25792997-25793019 ACACATTTACATACTGTCTACGG - Intronic
953107128 3:39894171-39894193 ATGCATTTACATGCATGTCATGG - Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
954158326 3:48700917-48700939 ACACATTCATATACAAGCCAGGG + Intronic
954891295 3:53931764-53931786 ATACATAAACAAACAGGGCAGGG - Intergenic
955886566 3:63605422-63605444 AAACCTTTGCACACAGGCCAGGG - Intronic
956015560 3:64879023-64879045 TTTCATTTACTTACAGGTCAAGG + Intergenic
956408341 3:68951842-68951864 ATATATTTACATAGAGGAAATGG - Intergenic
956893288 3:73634319-73634341 ATTCATTTACATATTGTCCATGG - Intergenic
961595274 3:128011115-128011137 ATAAATTTACATACATCTCAAGG - Intergenic
962857372 3:139360131-139360153 ATACATTCACATACATACAATGG + Intronic
964839784 3:160981077-160981099 ATATTTTTCCATACAGGACAGGG - Intronic
965031733 3:163378365-163378387 TCACATTTACATGCAGTCCATGG + Intergenic
966023710 3:175248692-175248714 ATACATTCACACAGTGGCCACGG - Intronic
966168780 3:177053254-177053276 ATGCATTTACATATTGTCCATGG - Intronic
966177053 3:177149806-177149828 ATTCATTTACATACTATCCATGG + Intronic
966579337 3:181542137-181542159 ATACATTTAGCTCCATGCCAAGG + Intergenic
968564952 4:1306952-1306974 GTCCATTTACATACAGCCAAGGG - Intronic
970038789 4:11772353-11772375 ATATATTTACATAGAGAGCATGG + Intergenic
970291462 4:14577421-14577443 ATACAATTATATGCAGGCAAAGG + Intergenic
971711369 4:30117837-30117859 GAACATTTACAAACAGGGCATGG - Intergenic
972199427 4:36696169-36696191 ACACATTCACATACTGGACATGG - Intergenic
972782118 4:42295143-42295165 ATACATCTTCATAATGGCCATGG - Intergenic
973211190 4:47617505-47617527 AAACATTTCCATAGAGGGCAGGG + Intronic
973694224 4:53474285-53474307 ATACATATAAACACAGGCCAGGG + Intronic
973822212 4:54671706-54671728 ACACATTTTCAAACAAGCCAGGG - Intronic
973834247 4:54793200-54793222 ACACATATACATACACGCCAAGG + Intergenic
975739082 4:77410925-77410947 ATACATATATATACACACCATGG - Intronic
976603657 4:86962414-86962436 ATACATTTATTTAAAGCCCATGG + Intronic
980280160 4:130708112-130708134 AAACAATTACATCCAGGCAAAGG - Intergenic
980747852 4:137043605-137043627 ATACATTAAGAAACAGGCCAAGG + Intergenic
982693320 4:158572057-158572079 ATTGATTTACATAGAGCCCAGGG - Intronic
983457270 4:167980808-167980830 ATACATTTTCTTATAAGCCATGG - Intergenic
983718126 4:170811160-170811182 ATTCATTTACATACTGTCTATGG + Intergenic
983905802 4:173181384-173181406 ATAAATTTGCTTACAGTCCAGGG + Intronic
983909331 4:173219352-173219374 ATACATACACATACATACCACGG + Intronic
984087934 4:175335148-175335170 ATACATTAACAAACAATCCAAGG + Intergenic
984332744 4:178347300-178347322 ACACATTTACAAACATGCCCTGG - Intergenic
984900570 4:184582589-184582611 ATACATTTACATAGAGGCTTAGG + Intergenic
986135439 5:4973329-4973351 ATACAATTACATATAGGATAGGG - Intergenic
987500523 5:18703369-18703391 CTACGTTGACATACAAGCCAAGG - Intergenic
988248097 5:28715083-28715105 ATACATTAACACACAGAACATGG + Intergenic
990350705 5:54912853-54912875 ATCAATTTACATATAGTCCAGGG - Intergenic
990530556 5:56669481-56669503 ACACATTTACACACAAGTCAGGG + Intergenic
990670551 5:58124847-58124869 ACACATTTCCATAAAGGCCTGGG - Intergenic
990723483 5:58726057-58726079 ATACATTAAAATAAAGCCCATGG - Exonic
991537076 5:67681386-67681408 ATATATTTATACTCAGGCCAAGG + Intergenic
993161057 5:84291837-84291859 ATATATATACCTACAGGCCCTGG + Intronic
993357599 5:86934332-86934354 AAAGATTTACAAAAAGGCCAAGG + Intergenic
994554854 5:101286239-101286261 ATACATATACATAGAGGGTAAGG + Intergenic
994887777 5:105587118-105587140 ATACATTTATACACACACCATGG + Intergenic
995647179 5:114326258-114326280 GTACATTTTCACAGAGGCCACGG + Intergenic
995982655 5:118123534-118123556 ACACATATACATACACTCCAAGG - Intergenic
998004697 5:138649215-138649237 ACACCTTTACACACAGGCCCAGG + Intronic
998536396 5:142935433-142935455 ATTCATTTACATATTGTCCATGG - Intronic
1000250519 5:159490419-159490441 AGACATTTACAAGCAGGCCATGG - Intergenic
1000503936 5:162090345-162090367 ATACACATACATACAGGACCAGG + Intronic
1000955824 5:167542384-167542406 GTACAGATACATACATGCCAAGG - Intronic
1001139121 5:169128952-169128974 ATACATATACTCACAGGCAAAGG + Intronic
1002395847 5:178953638-178953660 AGACATCTACAGACAGGCTAGGG - Intronic
1004046290 6:12027037-12027059 ATTTATTTACATACTGACCATGG + Intronic
1006594534 6:35183138-35183160 ATACATTTACATACACACAAAGG + Intergenic
1007180282 6:39924647-39924669 ATTCATTTACATATTGCCCATGG - Intronic
1008153674 6:47988182-47988204 ATACATTTACACATTGGACAGGG + Intronic
1009474704 6:64075983-64076005 ATTCATTTACATATTGTCCATGG + Intronic
1009483353 6:64189449-64189471 ATTCATTTACATATTGCCCATGG + Intronic
1009568990 6:65356130-65356152 ATACATATACATACACACAATGG + Intronic
1010656428 6:78517055-78517077 TTACAATTACCTACAGCCCAGGG - Intergenic
1012019410 6:93898256-93898278 CTAGATTTACCTACAAGCCAAGG - Intergenic
1012199268 6:96385481-96385503 ATAGATTTAGATACTGGGCATGG + Intergenic
1012313775 6:97760022-97760044 ATACATTTACCTATTGTCCATGG - Intergenic
1012635427 6:101532926-101532948 ATATATTTACATAGAGGAAAGGG + Intronic
1013682140 6:112536052-112536074 ATACATACATATACATGCCATGG - Intergenic
1014808626 6:125860255-125860277 ATACATTTATAAACATTCCAAGG - Intronic
1017134728 6:151138433-151138455 ACACATTTGAATACAGACCAGGG + Intergenic
1017555876 6:155567660-155567682 ATATATATACATACACACCATGG - Intergenic
1018344754 6:162888727-162888749 AGTCATTTTCATACAGGCCCTGG + Intronic
1019611545 7:1939325-1939347 ATACACACACACACAGGCCAGGG + Intronic
1021952512 7:25789254-25789276 ATTCATTTACATATTGTCCATGG - Intergenic
1023003040 7:35830880-35830902 AGACATTTAGATACAGGAAAAGG - Intronic
1023098222 7:36685264-36685286 AAACATTTAAATACCGGGCAAGG + Intronic
1023213722 7:37836365-37836387 AAATATATACATACAGGCAAAGG - Intronic
1025285565 7:57657862-57657884 ATACATTTGCATAGAGGCCCAGG - Intergenic
1025300577 7:57816910-57816932 ATACATTTACACAGAGGCCCAGG + Intergenic
1025822541 7:64982154-64982176 ATACATTTACCAAGTGGCCATGG + Intronic
1026028674 7:66769577-66769599 ATGCATCTACGTCCAGGCCAAGG - Intronic
1029725699 7:102402637-102402659 TTGCATTTGCATAGAGGCCAAGG - Intronic
1032863180 7:135901059-135901081 ATACACTTACATACTGTACATGG - Intergenic
1033541431 7:142359341-142359363 ATCCATTGGCATCCAGGCCAAGG - Intergenic
1033557020 7:142497296-142497318 ATGCATTTTCATCCAAGCCAAGG - Intergenic
1036528924 8:9563453-9563475 ATTCATTTACATATAGTCTATGG - Intronic
1036593086 8:10186358-10186380 ATTCATTTATATACTGTCCATGG - Intronic
1038276396 8:26124970-26124992 ATACATTTACATATTGTCTATGG + Intergenic
1039818909 8:41119053-41119075 TTACATTTACAGACAGGAAATGG + Intergenic
1040806507 8:51402681-51402703 ATAAATTTCCAGAGAGGCCATGG - Intronic
1043414870 8:80036945-80036967 ACATATTTGCATAGAGGCCAAGG - Exonic
1045395405 8:101755810-101755832 ATACATATTCACACAGGACATGG - Intronic
1045633655 8:104157670-104157692 ATACATGTACATACACACAATGG - Intronic
1047498325 8:125424290-125424312 ATTCATTTTCATTCATGCCAAGG - Intergenic
1047712573 8:127567175-127567197 ATTCATTTACATACTGTCTATGG + Intergenic
1049143726 8:140981710-140981732 ATTCCTTTACATACAGCCCATGG + Intronic
1053563907 9:39226917-39226939 ACACATATACATACACACCATGG - Intronic
1053793252 9:41701770-41701792 ATACATTTACACAGAGGCCCAGG - Intergenic
1054133241 9:61392153-61392175 ATACACATACATACACACCATGG + Intergenic
1054151925 9:61613068-61613090 ATACATTTACACAGAGACCCAGG + Intergenic
1054181660 9:61913782-61913804 ATACATTTACACAGAGGCCCAGG - Intergenic
1054471697 9:65544199-65544221 ATACATTTACACAGAGGCCCAGG + Intergenic
1056268472 9:84923468-84923490 ATTCATTAAGATACAGGTCAGGG + Intronic
1059033188 9:110723193-110723215 ATACATATACACACACACCATGG + Intronic
1059301927 9:113320900-113320922 AAAGATTTACATACAGGTCATGG + Intronic
1060217530 9:121747209-121747231 ATAGTTTTTCCTACAGGCCAGGG + Intronic
1060437090 9:123603302-123603324 ATTCATTTATTTACAGGCAAGGG - Intronic
1185794347 X:2952179-2952201 AGACATTTTCATACACACCAAGG + Intronic
1188621603 X:32232439-32232461 CCACAGTTACATACAGGCTAGGG - Intronic
1190852128 X:54255464-54255486 CTACATGTACATACAGGAAAAGG + Intronic
1192593349 X:72380566-72380588 ATTCATTTACATACTGTCTATGG + Intronic
1192744205 X:73922546-73922568 AAAAATTTACACAAAGGCCATGG + Intergenic
1193593058 X:83413235-83413257 ATTCATTTACATATTGTCCATGG - Intergenic
1193946053 X:87736711-87736733 AAACATTTTCCTACATGCCAGGG + Intergenic
1194028207 X:88780624-88780646 ATATATTTATATATATGCCATGG + Intergenic
1195871911 X:109495089-109495111 ATACCTATACATTCTGGCCATGG + Intergenic
1196874005 X:120140626-120140648 ATTGATTTACATAGAGCCCAGGG - Intergenic
1197047617 X:122017922-122017944 AAACATTTACAAGCAGCCCATGG - Intergenic
1198339025 X:135695744-135695766 ATACATGGAAAAACAGGCCATGG - Intergenic
1198398605 X:136248351-136248373 ATACATTAACAGAAAGGACAGGG + Intronic
1200335568 X:155347760-155347782 ATATATTGCCATGCAGGCCATGG - Intergenic
1200350900 X:155493465-155493487 ATATATTGCCATGCAGGCCATGG + Intronic