ID: 1165602982

View in Genome Browser
Species Human (GRCh38)
Location 19:37073831-37073853
Sequence CTCAAAGACAAATGGGGACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165602978_1165602982 1 Left 1165602978 19:37073807-37073829 CCTGTGTCAAAAAGTAAGGAAGT 0: 1
1: 0
2: 2
3: 55
4: 568
Right 1165602982 19:37073831-37073853 CTCAAAGACAAATGGGGACACGG 0: 1
1: 0
2: 3
3: 25
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165602982 Original CRISPR CTCAAAGACAAATGGGGACA CGG Intronic
900200401 1:1402426-1402448 CTGAAGGATAAATGTGGACACGG + Intronic
905067515 1:35195806-35195828 CTCAAAGAAATATGAGGAGAGGG - Intergenic
908854447 1:68408837-68408859 CTTAGAGTCAAATGGGGACCTGG - Intergenic
909606678 1:77515203-77515225 CTCTAAGCCAAATGGGGAGGAGG - Intronic
910276346 1:85453317-85453339 CACAAAGAAAAATGCAGACATGG + Intronic
911208961 1:95119602-95119624 CTCAAAGAGAAAGAGGGAGAAGG - Intronic
914405367 1:147365482-147365504 CTAAAAGACAAATGGAAAAATGG - Intergenic
917970001 1:180200195-180200217 TCCAATGACACATGGGGACAAGG - Exonic
918660940 1:187088072-187088094 TTAAGAGACATATGGGGACAGGG - Intergenic
921455670 1:215368137-215368159 CCCAAAGACAAATGGTGTAAAGG + Intergenic
922339871 1:224646721-224646743 TTTAAAGGCAAAAGGGGACAAGG + Intronic
924818474 1:247463970-247463992 CTCAATGAAAAATGGGTAAAAGG - Intergenic
1062845082 10:697405-697427 CTCAGAGAGAAACGGGCACACGG + Intergenic
1065624278 10:27614692-27614714 TTGAAAGACTTATGGGGACAGGG - Intergenic
1067813280 10:49448184-49448206 CTCAATAACAAATGTTGACAAGG - Intergenic
1069860264 10:71466677-71466699 CACACACACAAATGTGGACAAGG - Intronic
1070458604 10:76642725-76642747 CCCAAATCCAAATGGGGAAATGG - Intergenic
1071062427 10:81588542-81588564 CTTAGAAAAAAATGGGGACAGGG - Intergenic
1074007294 10:109440098-109440120 TTTAAAGACAAAAGGGAACAAGG + Intergenic
1074434746 10:113424514-113424536 ATCAATGACAAATGGAGAAAAGG - Intergenic
1075724568 10:124604796-124604818 TTCCAAAGCAAATGGGGACAGGG + Intronic
1076033308 10:127177492-127177514 CTCAAACACAAGGGGGGAAAAGG - Intronic
1076659875 10:132048415-132048437 CAAACAGACAAATGGGGAGAAGG - Intergenic
1076742299 10:132492586-132492608 TTCAAAGAGCAAGGGGGACAAGG - Intergenic
1079873621 11:25830565-25830587 CACACACACAAATGGGTACAAGG - Intergenic
1081474505 11:43413019-43413041 CACACACACAAATGGGGGCAGGG + Intronic
1085031643 11:73274858-73274880 TTCAGAGACAAATGGGGAAATGG - Intronic
1085179656 11:74522778-74522800 GTAAAAGTCAAATGGGGACTTGG + Intronic
1087765346 11:102146193-102146215 ATAAAAGACAAATAGAGACAGGG + Intronic
1088299388 11:108339857-108339879 CTCAAAGACAGCAGGGGAGAGGG + Intronic
1088456966 11:110042702-110042724 TTCAAAGAATGATGGGGACAGGG + Intergenic
1088655191 11:111992284-111992306 CTGGAAGACAAATGGGGTAAAGG - Intronic
1090763133 11:129854546-129854568 CTCTAAGACAAATAGGAGCAAGG - Intronic
1091611563 12:2014858-2014880 CTCCAAGGCCAGTGGGGACAAGG - Intronic
1092613061 12:10191700-10191722 CAAAAAGATAAATGGGAACATGG - Exonic
1093552065 12:20424921-20424943 TTCAAAGCCAAATGAGGACTTGG + Intronic
1094659712 12:32456867-32456889 TTCAAATACAAAAGGGGAGATGG - Intronic
1094858143 12:34428258-34428280 TTAAAAGACAAATGGTTACAGGG + Intergenic
1098228396 12:68348211-68348233 CTCACCTAAAAATGGGGACAGGG - Intergenic
1098239441 12:68451804-68451826 CTCCAAGGCAACTGGAGACAAGG - Intergenic
1098926370 12:76354485-76354507 CTGAAAGGCAAATGTGGTCAGGG + Exonic
1099721299 12:86364855-86364877 CACAAAGGCAAATGGAGGCAGGG + Intronic
1100434118 12:94555907-94555929 CTCAAAGAATAATGAGGACATGG + Intergenic
1100701596 12:97154502-97154524 CTGAAAAACAAAAGGGGGCAGGG - Intergenic
1101899256 12:108779093-108779115 CTAAAAGACAAATTTGGGCACGG - Intergenic
1102061596 12:109936506-109936528 CACATTGACAAATGGGGTCACGG + Intronic
1102217705 12:111173295-111173317 CAGAAAGTCAAATGGGGACGGGG + Intronic
1104192238 12:126493332-126493354 CTCAAAGAAGACAGGGGACAAGG - Intergenic
1105318444 13:19291026-19291048 CTCACAGAGAAATGGGTACGTGG + Intergenic
1106075762 13:26459559-26459581 CTCAAAGACAAGCTGGGCCAGGG + Intergenic
1106996050 13:35481455-35481477 CTGAAAAAAAAATGGGGAAAGGG + Intronic
1107198326 13:37682520-37682542 CTCAAACAAAGATGAGGACAAGG + Intronic
1107504876 13:41023759-41023781 ATCAAAGGCAAAAGGGGCCATGG + Intronic
1107677482 13:42811843-42811865 CTGAAAGACAAATGAGCATATGG + Intergenic
1108382567 13:49868268-49868290 CTCAAAGACCCATGAGGGCAGGG - Intergenic
1109847142 13:68008736-68008758 TTCAGAGACAAATGGTAACATGG + Intergenic
1112044570 13:95583351-95583373 TGCAAAGACAGATGGGGACTTGG - Intronic
1113047084 13:106167872-106167894 CTCAAGGACCAAAGAGGACAGGG - Intergenic
1113109746 13:106810317-106810339 AGCAAAGACAATAGGGGACATGG - Intergenic
1117392303 14:55273204-55273226 CTAAAAGGCAAATGGGGAGCAGG - Intronic
1120387208 14:83861843-83861865 CTGAAAGACAAATAGGGGAATGG + Intergenic
1122307402 14:100774380-100774402 CTCACTGCCAACTGGGGACATGG - Intergenic
1122379622 14:101293163-101293185 CTCCAAGAGAAGAGGGGACAGGG + Intergenic
1122825397 14:104368189-104368211 CCCAAGGACAAATGGGGTCAGGG + Intergenic
1123150503 14:106176885-106176907 CTGAAAGACAAATGTGGACTCGG - Intergenic
1124026560 15:25972260-25972282 CTGAAAGAAAAATGGGAGCATGG + Intergenic
1124604732 15:31161676-31161698 CTTAAAGGCAGATGGGGTCATGG + Intergenic
1125712770 15:41800342-41800364 CTCAAAAAAAAAAGGGAACAAGG - Intronic
1125888450 15:43247516-43247538 CTCAAAAAAAAAAGGAGACAAGG + Intronic
1126275946 15:46881180-46881202 ATCATAGACATTTGGGGACAAGG + Intergenic
1126363421 15:47869743-47869765 CTCAAAGGCTAATGGTGACCTGG - Intergenic
1126925304 15:53578768-53578790 CTGAAAGAGAAAAGGGGACTTGG - Intronic
1127975488 15:63994000-63994022 TTCAAAGACAAAGGAGGACCAGG + Intronic
1128250414 15:66160007-66160029 AGCAAAGAAAAATGGGGAGAGGG - Intronic
1128624287 15:69183645-69183667 TTTAAAGGCAAAGGGGGACATGG - Intronic
1131165778 15:90141421-90141443 TTTAAAGGCAAAAGGGGACAAGG - Intergenic
1132666236 16:1082506-1082528 CTCAGAGGCAAAGGGGCACAGGG + Intergenic
1135154855 16:20043788-20043810 CACAAAGACAGATGGGGTCAGGG + Intronic
1135387373 16:22055091-22055113 CTCAAAAACAAATGGAGAGAAGG - Intronic
1135956697 16:26962176-26962198 CTTAAGGACAAATGTGGACATGG + Intergenic
1136780105 16:32893328-32893350 CTGAAAGACAAATGTGGACTCGG + Intergenic
1136890502 16:33968199-33968221 CTGAAAGACAAATGTGGACTCGG - Intergenic
1140779023 16:78276836-78276858 TGCAAAGAAAAATGGGGACAAGG - Intronic
1203082528 16_KI270728v1_random:1155415-1155437 CTGAAAGACAAATGTGGACTCGG + Intergenic
1145934008 17:28704544-28704566 CTCTAAGAGAAATGGGGAGGAGG - Intronic
1146218779 17:31000328-31000350 CTCAAAGACAATAAGGGAGAGGG + Intergenic
1146634990 17:34497207-34497229 CTCAGAGGAAAATGGAGACAAGG + Intergenic
1148612096 17:48971428-48971450 ATCAAAGAGAAATGGGGATGAGG - Intergenic
1149398718 17:56271725-56271747 CTATAAGACAAGTTGGGACATGG + Intronic
1152178810 17:78805121-78805143 CTCATTGACAAATGAGAACATGG - Intronic
1152425179 17:80214710-80214732 CGCAAAGTCAAACGGGTACACGG + Exonic
1152503477 17:80729788-80729810 TTAAAGGACAAATGGAGACACGG + Intronic
1155252865 18:23968226-23968248 AACAAAGACAAATGGCAACAAGG - Intergenic
1157325597 18:46666720-46666742 CAAAGAGACAAATGGGGAGATGG + Intergenic
1157407628 18:47436400-47436422 AGCAAAGAAAAATGGGGAAAGGG + Intergenic
1157473446 18:48007158-48007180 CGCAAAGATAAATGGGCCCATGG + Intergenic
1157587059 18:48808288-48808310 CTCATGAACAAATGGGGAAAGGG - Intronic
1157894637 18:51453987-51454009 CCCAGATACAAGTGGGGACATGG + Intergenic
1159919962 18:74219308-74219330 CAAAATGACAAATGGGGGCAGGG - Intergenic
1162921334 19:13905148-13905170 CTGAAAGACAAATGGGCCCTGGG + Intronic
1163243532 19:16078103-16078125 CTCATAGACAAATGGAGGCAGGG + Intronic
1164024146 19:21335098-21335120 CTCAAAGACATATGTGACCATGG - Intergenic
1164827128 19:31292007-31292029 CTCAAAGAGGAATGGGAATACGG - Intronic
1165602982 19:37073831-37073853 CTCAAAGACAAATGGGGACACGG + Intronic
1168308647 19:55450195-55450217 CTCAGAGAGACAGGGGGACAGGG + Intergenic
1168308675 19:55450305-55450327 CTCAGAGAGACAGGGGGACAGGG + Intergenic
1168308703 19:55450415-55450437 CTCAGAGAGACAGGGGGACAGGG + Intergenic
926298178 2:11583240-11583262 CTGAACGACCAAAGGGGACAGGG - Intronic
926971959 2:18475408-18475430 GTGAAAGACAAGTGGGGAAAAGG - Intergenic
927513844 2:23660568-23660590 CTCATAGCCAAAAAGGGACAAGG + Intronic
928883682 2:36124898-36124920 CTCAAAGACACATAAAGACATGG + Intergenic
929429018 2:41871154-41871176 CTCAAATCCAAATGAGGACTGGG - Intergenic
930633856 2:53783877-53783899 ATCTATGACAAATGAGGACATGG + Intronic
931458118 2:62427895-62427917 TTCAAAGGCAAAAGGGAACAAGG - Intergenic
931557043 2:63517731-63517753 CTAAAAGACAAAATGTGACAGGG - Intronic
933119004 2:78512330-78512352 CACAAACACAAATTAGGACATGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
937765568 2:125656831-125656853 CTCAAAGGCTAATAGGAACATGG - Intergenic
939070439 2:137534133-137534155 ATCAAAGGCAAAAGGGGAAATGG - Intronic
939771379 2:146323874-146323896 CTCAAATACATCTGGGAACAAGG - Intergenic
940862232 2:158782806-158782828 CTCACAGACTGATGGGGTCATGG + Intergenic
942957544 2:181791063-181791085 CTAAAAGACAAATGCAGTCAGGG + Intergenic
943698485 2:190962630-190962652 CTCCAAGACAAGTTGGGATATGG - Intronic
946498690 2:220222511-220222533 CTCAAAAACAAAAGGGGTCGGGG - Intergenic
946669504 2:222087579-222087601 GTCAAATACAAATGGGAACATGG + Intergenic
947040777 2:225917052-225917074 GCCAGAGACAAAGGGGGACATGG - Intergenic
947302622 2:228705406-228705428 CTCAGAGACAAAAGGAGACTAGG - Intergenic
947698106 2:232209772-232209794 TGCAAAGATAAATGGGCACATGG + Intronic
948169182 2:235887559-235887581 CTCAAAGGCAGATGGGGCCCAGG + Intronic
948591908 2:239055867-239055889 CTCCAGGACACCTGGGGACATGG - Intronic
1169066893 20:2698783-2698805 CTCAAAGACAAATTAGGACCAGG + Intronic
1169866544 20:10206545-10206567 CTCCAAGACCAATGGGGAAAGGG - Intergenic
1170207689 20:13816777-13816799 TTCAAAAAGAAATGGGTACAAGG - Intronic
1171233241 20:23504365-23504387 TTTAAAGGCAAAAGGGGACAAGG - Intergenic
1171364979 20:24617364-24617386 CTGAGGGACAAAAGGGGACATGG + Intronic
1172190735 20:33060442-33060464 CACATATACAGATGGGGACATGG - Intronic
1172438665 20:34949474-34949496 TTAAAAGACAAATAGGGAAAAGG - Intronic
1172567174 20:35939722-35939744 CTCACTGACAACTGAGGACAGGG - Intronic
1172672590 20:36644544-36644566 CCCAAAGGCAGATGGAGACAGGG + Intronic
1173937830 20:46882604-46882626 ATCAAAGAATGATGGGGACATGG + Intergenic
1176019710 20:62956437-62956459 CTCAAAGAGAACAGGGGAGAGGG - Intronic
1176257057 20:64158278-64158300 GACAAAGACAGGTGGGGACAGGG - Intronic
1179382253 21:40910663-40910685 GCCAAAGAAACATGGGGACAAGG - Intergenic
1181563914 22:23722398-23722420 CACAAAGGCAAAAGGGGATACGG - Intergenic
1182020729 22:27079610-27079632 CTACTAGACAAATGGGGAAATGG + Intergenic
1182527067 22:30927094-30927116 ATCTAAGACAATTGGGAACATGG - Intronic
1184868073 22:47214356-47214378 CTCAGGGACAAATGGGACCAGGG - Intergenic
952396256 3:32922998-32923020 CTCAAAAGAAAATAGGGACATGG + Intergenic
952881656 3:37989655-37989677 CACAGAGACAAAAAGGGACAGGG + Intronic
953123442 3:40068763-40068785 ATAAATGACAAATGGGGAAACGG - Intronic
953225417 3:41014560-41014582 CTCAAATGCAAATGGAGACTTGG + Intergenic
953608613 3:44428851-44428873 CTAAAAGTCAATTGGGGTCAAGG + Intergenic
955132300 3:56182729-56182751 CTCAAAGCCAAGTGGTGAAACGG - Intronic
955735295 3:62032274-62032296 CTGAAAGTCATGTGGGGACAGGG + Intronic
956154636 3:66282439-66282461 CTCAAAGACTAATGGGGGCCTGG - Intronic
958566123 3:95813187-95813209 ATCAAAGACATATGAGGCCAGGG + Intergenic
958938614 3:100285721-100285743 CAAAAAGACAAATGTTGACAAGG - Intronic
960485116 3:118242206-118242228 CTGAAAGATATATGGGGAAAGGG + Intergenic
960988242 3:123294382-123294404 GTCAAATACAAAGGGGGAAAAGG + Intronic
962157630 3:132965269-132965291 CTCAAAGACAAGGAGGGGCATGG + Intergenic
962473731 3:135737579-135737601 CTCAAGGCCAAATGGGCCCATGG + Intergenic
963994407 3:151690979-151691001 TTTAAAGGCAAAAGGGGACAAGG - Intergenic
964108277 3:153062365-153062387 CTCAAAGACAATTGACAACAAGG + Intergenic
965284201 3:166796304-166796326 CTGCAAGAAATATGGGGACATGG - Intergenic
967527185 3:190508531-190508553 CTGAAAGACAAGAGGGGAAAGGG - Intergenic
967702762 3:192612864-192612886 CTCAAAGAAAAATTTGGGCAAGG - Intronic
969242621 4:5910846-5910868 CTGTTAGACAAATAGGGACATGG - Intronic
969404362 4:6978973-6978995 GTGAAATACAAAAGGGGACAAGG + Intronic
970472057 4:16388817-16388839 CTCAAAGAGAAATGGGGAAAGGG - Intergenic
971052479 4:22876851-22876873 CACAAAGAAAAATATGGACAAGG - Intergenic
971374810 4:26048241-26048263 GTCACAGACAAAGGGGGGCAGGG + Intergenic
971744797 4:30566135-30566157 CACAAAGACAATTGGGAAAATGG + Intergenic
971876000 4:32309065-32309087 GACAAAGACAAATAGGCACAAGG + Intergenic
972304560 4:37819723-37819745 CTCAAAGACATATGAAGCCATGG + Intergenic
972378591 4:38497805-38497827 AGCAAAGAAAAATGGGGAGAAGG + Intergenic
972440085 4:39079608-39079630 GGCAAAGGCAAATGGGGAAAGGG - Intronic
972562876 4:40243999-40244021 CCCAAAGACTAATGGGGAGAGGG + Exonic
975521685 4:75308259-75308281 CCCAAAGACCAGTGGGGACAGGG + Intergenic
975659707 4:76676237-76676259 TACAAAAACAAAGGGGGACAAGG + Intronic
977147600 4:93464280-93464302 TTCATAGACAAAGGGGGAAATGG - Intronic
977528432 4:98172228-98172250 CTCAAATACAAAATGGTACAAGG - Intergenic
979368528 4:119854886-119854908 CTCAAAGACCAGTGTGGAAAAGG + Intergenic
980432028 4:132713743-132713765 CTCACATACTAATGGGGAAAGGG - Intergenic
983510813 4:168607878-168607900 CTCAGAAACAAATGGTAACAAGG + Intronic
983671824 4:170246606-170246628 CTCAACTACTGATGGGGACAGGG + Intergenic
984128152 4:175837791-175837813 CACAAAGGCAGATGAGGACATGG - Intronic
984653251 4:182291271-182291293 GTCAGGGACAAATGGGGCCATGG - Intronic
985875202 5:2589215-2589237 GTCAAAGACAGATGGAGAGAGGG - Intergenic
986770185 5:10965954-10965976 CTCAAAAAAAAATGGGGGGAAGG - Intergenic
987376559 5:17240744-17240766 ATCAAAGACAAAAGGGGACTAGG - Intronic
989245323 5:39248251-39248273 AGCAAAGACAAATGCAGACAAGG + Intronic
990072622 5:51803648-51803670 CTCAGAGACAGATGAGGAGAAGG - Intergenic
990372685 5:55136629-55136651 CTCAAAAATAAATGTGAACAAGG - Intronic
990405480 5:55486239-55486261 CTCAAAGAAAAATGGGGAAAGGG - Intronic
992782779 5:80143194-80143216 CTCAAAGCCCCCTGGGGACAAGG + Exonic
996269845 5:121590423-121590445 CCCAAAGCCAAAAAGGGACAAGG + Intergenic
996524223 5:124460750-124460772 TGCAAAGACATATGGGGAAAAGG + Intergenic
996690396 5:126334082-126334104 CTCAAAGACAGATGTTGGCATGG - Intergenic
996957582 5:129202599-129202621 CTGAAGGCCAACTGGGGACATGG + Intergenic
997928780 5:138055179-138055201 CTGACAGACGAATGGGGATAAGG + Intergenic
998538183 5:142953755-142953777 CTAAAAGAAAACAGGGGACACGG - Intronic
1004024281 6:11804108-11804130 CTCAAAGAAAAATGCAGAAAGGG - Intronic
1007036926 6:38683590-38683612 CTAAAAGACAAATGGAGGCCGGG + Intronic
1009192778 6:60649792-60649814 CTCAAGGACAAATGGGGCTTCGG + Intergenic
1010588672 6:77686423-77686445 TTTAAAGACAAAAGGGGAAAGGG - Intergenic
1010751371 6:79619522-79619544 CTCAAATACCAATGAGGACCAGG - Intergenic
1011229039 6:85139277-85139299 CTCTAACAGAAATAGGGACATGG - Intergenic
1011409435 6:87052061-87052083 ATCTAAGAAAAATGGGGAGAGGG + Intergenic
1012395784 6:98795749-98795771 CTCATGGAGAAATGGGGAAAAGG + Intergenic
1013425432 6:110008490-110008512 CTCAAATGCATATGGGTACAAGG - Intergenic
1013756465 6:113467550-113467572 CACAAAGTGAGATGGGGACAGGG - Intergenic
1014783777 6:125594632-125594654 CTCAGAGACACCTGAGGACAGGG + Intergenic
1014862110 6:126482001-126482023 CACAAAGAAAAATGGGCAAAAGG - Intergenic
1016873968 6:148846640-148846662 CTCAAAGTCAAATGGGAAAGAGG - Intronic
1017186535 6:151606369-151606391 CTGAATGACAAATGGAGTCAAGG - Intronic
1017993246 6:159508568-159508590 CTCAAGGAAAAATGGAGGCAGGG + Intergenic
1018355271 6:163008242-163008264 CTCAAAGACAGATCGCCACAGGG + Intronic
1018811675 6:167302782-167302804 CACAAAATGAAATGGGGACAAGG - Intronic
1024622550 7:51174750-51174772 TTTAAAGGCAAAGGGGGACAAGG - Intronic
1024929008 7:54650187-54650209 TTTAAAGGCAAATGGGAACAAGG - Intergenic
1026515488 7:71067182-71067204 ATAACAGACAAATGGGGGCAAGG - Intergenic
1026631238 7:72039863-72039885 CTCAATGACACATGGGGCAATGG - Intronic
1027430818 7:78110789-78110811 CACAAAGAAAGAAGGGGACAGGG + Intronic
1027474112 7:78608313-78608335 CTCAAAGCCAGTTGGGGACAGGG - Intronic
1028892948 7:96009326-96009348 CTCAGATGCTAATGGGGACAGGG - Intronic
1028956807 7:96702463-96702485 CACAAAGAATAATGGAGACATGG + Intronic
1032158941 7:129495375-129495397 CTCAAAAAAAAAAGAGGACACGG + Intergenic
1033129700 7:138735293-138735315 CTCAAGTACAGGTGGGGACAGGG - Intronic
1033301544 7:140190517-140190539 CACAAGGACAAATGGACACAAGG + Intergenic
1033861549 7:145634112-145634134 TTCAGAGACAGATGGGGAGAAGG + Intergenic
1034555752 7:151849414-151849436 CACAGAGACTAATAGGGACATGG - Intronic
1035519994 8:267790-267812 TTCAAAGACTAAGGGGGAAAGGG + Intergenic
1036444486 8:8809696-8809718 ATCAAAGACAGTTGGGGAGAGGG + Intronic
1039865975 8:41502233-41502255 CTCAGAGACAAACTGGGAAAGGG - Intronic
1041702784 8:60810140-60810162 TTCAAAGAAAAATGGGGACAAGG - Intronic
1043026561 8:75077580-75077602 CAAAAAGACAAATGTGGAAATGG + Intergenic
1045530516 8:102980974-102980996 ATGAAAGACCAATGGGGACTAGG - Intergenic
1046086890 8:109448332-109448354 CTCAAATACAACTGTGGACATGG - Exonic
1047342344 8:123994270-123994292 CTCAAAGACAGGTGGGGTCTGGG + Intronic
1047908406 8:129498500-129498522 ATGAAAAACAAATGAGGACAAGG + Intergenic
1049172069 8:141167614-141167636 CTTAAAGACAACTCAGGACAGGG - Intronic
1049484656 8:142848809-142848831 GTCAGAGACAAAAGGGGAAATGG - Intronic
1052125710 9:24772130-24772152 GTCAAAGACAAATCGTGACAAGG - Intergenic
1052301234 9:26954975-26954997 ATGAAAAAGAAATGGGGACAGGG + Intronic
1054862506 9:69968238-69968260 CACACAGACTACTGGGGACATGG + Intergenic
1056070366 9:82980166-82980188 CTTAAAGAAAAACAGGGACAAGG + Exonic
1056142216 9:83693706-83693728 CTCAAAAACAATTGAGAACAGGG - Intronic
1057150618 9:92792988-92793010 ATCAATGACAAATGGAGAGAAGG + Intergenic
1057290925 9:93807178-93807200 CTGAGTGACAAATGGGGACAAGG - Intergenic
1057442230 9:95090966-95090988 CTCAATGACAAAGGGGTCCAGGG + Intergenic
1058148708 9:101440812-101440834 TTCAAAGACATATGGAGAAATGG - Intergenic
1058157901 9:101535249-101535271 CTCAAAGAGAAATATGGAGATGG + Intronic
1058847023 9:108971243-108971265 CTCAAAGACTAATGGTTAGAAGG - Intronic
1060339953 9:122766514-122766536 GTCAAAGACAAATGGGGGTGAGG + Intergenic
1061219847 9:129243917-129243939 ATTTAAGACAAATGGGGCCATGG - Intergenic
1061526176 9:131164883-131164905 CTCAAAGAAAAATTTGGATATGG - Intronic
1062102904 9:134737789-134737811 CTCTAACCCCAATGGGGACAGGG - Intronic
1185543883 X:926307-926329 GTCAAAGCCAAATGTGGACATGG + Intergenic
1185604405 X:1359576-1359598 CACAGAGAGAGATGGGGACAGGG - Intronic
1185785430 X:2886934-2886956 ATCAAAGACTAATGGGGGCCAGG - Intergenic
1188760533 X:34023405-34023427 CTCAGAAACAAATAGGAACAAGG + Intergenic
1188866401 X:35318316-35318338 GTCAAAGAGAAATGGAGAAATGG - Intergenic
1188941295 X:36241193-36241215 CTCAAACATCCATGGGGACATGG - Intronic
1190542102 X:51487736-51487758 CTCAAAGTCACATGGGGGCAGGG - Intergenic
1194512757 X:94815851-94815873 CACAAACAAGAATGGGGACAAGG - Intergenic
1196579660 X:117363845-117363867 CTTAAATACACATGGGGAAATGG + Intergenic
1196981008 X:121213644-121213666 CTCAAAGGGGAATGGTGACATGG + Intergenic
1198552983 X:137763639-137763661 GGAACAGACAAATGGGGACATGG - Intergenic
1198590771 X:138178323-138178345 CTGCAAGACAAATGAGGTCAAGG - Intergenic
1199711273 X:150471204-150471226 CTCAGAAACAAAATGGGACAAGG - Exonic
1201288449 Y:12399203-12399225 ATCAAAGACTAATGGGGGCCAGG + Intergenic
1201905158 Y:19079711-19079733 CAAAAAAACAAATGGAGACAAGG + Intergenic