ID: 1165604269

View in Genome Browser
Species Human (GRCh38)
Location 19:37086829-37086851
Sequence GCACATTTTAAATATAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 542}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165604269_1165604270 1 Left 1165604269 19:37086829-37086851 CCATCTTTATATTTAAAATGTGC 0: 1
1: 0
2: 1
3: 47
4: 542
Right 1165604270 19:37086853-37086875 TCTTGTAAAGAGCATGTAGTTGG 0: 1
1: 2
2: 40
3: 296
4: 1033

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165604269 Original CRISPR GCACATTTTAAATATAAAGA TGG (reversed) Intronic
901909817 1:12447342-12447364 GCTCATTTTACAGATAAAGCTGG - Intronic
903800147 1:25961104-25961126 CCCCATCTTAAAAATAAAGAAGG - Exonic
904097989 1:27996680-27996702 GAACATTTTACTTATAAAAAGGG + Intronic
904793523 1:33041851-33041873 GCACATTTGAAAGAGAAAAAAGG - Intronic
904809496 1:33154157-33154179 GCTCATTTAAGATCTAAAGATGG + Intronic
905083576 1:35348613-35348635 GCACATTTACAATAGAAAAATGG - Intronic
907147913 1:52253307-52253329 TCACATTTTCAATATATAAATGG + Intronic
907395182 1:54184760-54184782 GGAGATTTTAAATAAAAATATGG - Intronic
907865920 1:58398955-58398977 CCAAATTTTAAAAATAAAAAAGG + Intronic
908436947 1:64116354-64116376 GCACATGTTAGATATAAAGGAGG + Intronic
908572955 1:65428200-65428222 TTACATTTTATATATAAACAAGG + Intronic
908956649 1:69638127-69638149 TCTCAATTTTAATATAAAGATGG + Intronic
909045599 1:70706097-70706119 GCACATTTAAAAAAAAAAAAAGG - Intergenic
909240847 1:73211148-73211170 GCACATTATAGACATAAATATGG + Intergenic
909331098 1:74412031-74412053 GCTATGTTTAAATATAAAGAAGG - Intronic
909734579 1:78941558-78941580 GCACATTTAAAAAAAAAAGGGGG - Intronic
909853141 1:80495094-80495116 TTTTATTTTAAATATAAAGAAGG - Intergenic
909972802 1:82010325-82010347 ATACATTTTTAATAGAAAGAAGG - Intergenic
910102295 1:83591498-83591520 GCACACTTCACCTATAAAGACGG - Intergenic
910487141 1:87727777-87727799 GCACATGTTAAATACTAAGGGGG - Intergenic
910502470 1:87908761-87908783 GTATAATTTAAATATACAGAAGG - Intergenic
910613574 1:89171529-89171551 TCACATTTCATATATAAATAAGG - Intronic
910660822 1:89670755-89670777 TCACAATCTAAATTTAAAGATGG - Intronic
911430663 1:97782596-97782618 GAACGTTTTAAATCTAAACAGGG - Intronic
911560373 1:99398473-99398495 ATACATTTTAAAAATAAATAGGG - Intergenic
911922288 1:103780634-103780656 GGAGATTTTAAATATATACATGG + Intergenic
911965491 1:104364153-104364175 ACTCATTTAAAATATAAAAAAGG + Intergenic
912243867 1:107940459-107940481 GGACATTTGAAAGATAGAGAAGG + Intronic
912478203 1:109956201-109956223 ACACTTTTTAAAAAGAAAGAGGG - Intergenic
913044872 1:115065345-115065367 CCACATTTTAAATTCCAAGATGG + Intronic
913559159 1:120000638-120000660 TGACATTTTAATTATGAAGAAGG + Intronic
913638706 1:120789904-120789926 TGACATTTTAATTATGAAGAAGG - Intergenic
914279753 1:146160081-146160103 TGACATTTTAATTATGAAGAAGG + Intronic
914540791 1:148610999-148611021 TGACATTTTAATTATGAAGAAGG + Intronic
914625849 1:149460247-149460269 TGACATTTTAATTATGAAGAAGG - Intergenic
917118752 1:171627531-171627553 GCACTTTTTACTTTTAAAGAAGG - Intergenic
918626032 1:186656779-186656801 GCAAATTTTAAAGATAAAAATGG + Intergenic
918674694 1:187268549-187268571 TCAAAATTAAAATATAAAGAAGG + Intergenic
918904685 1:190477201-190477223 AAATATTTTAAAAATAAAGAAGG + Intronic
919010933 1:191962363-191962385 GCATATTTTCTATATAAAGATGG - Intergenic
919226816 1:194714889-194714911 TCATATTTTAACTGTAAAGATGG - Intergenic
919898714 1:202027345-202027367 GGACTTTTTAAAAATAGAGATGG - Intergenic
920409025 1:205743881-205743903 GCTCATTTTACATAAAAATATGG - Intronic
921952603 1:220946151-220946173 GGACATTTATAAAATAAAGAGGG - Intergenic
922012289 1:221601521-221601543 ATGCATTTTAAAGATAAAGAAGG + Intergenic
923649458 1:235860113-235860135 GCATATTTTACATTTAAAAATGG - Intronic
924119156 1:240778932-240778954 GCATATTTTATTTATAAAGCAGG - Intronic
924907013 1:248466096-248466118 GCAAATTTTAAATATAATTATGG + Intergenic
924917096 1:248582038-248582060 GCAAATTTTAAATATAATTATGG - Intergenic
1062781536 10:214798-214820 TCACATTTTAAGAATAAAGGTGG - Intronic
1063062584 10:2572453-2572475 GAACATTTTTAATATAATCATGG - Intergenic
1063260573 10:4384909-4384931 TCACATTTTTAATATCAACAGGG + Intergenic
1063275692 10:4565266-4565288 GCATATTTTAAATACATATAAGG - Intergenic
1064417879 10:15166719-15166741 GCACATTTTATATATTAGAAAGG - Intronic
1064987710 10:21227412-21227434 GCACATTTCTAATTTAAAGGAGG + Intergenic
1065086593 10:22184816-22184838 GAACATTTTAAAAATATAGCTGG - Intergenic
1065400804 10:25298482-25298504 GCATATTTTAAATCAAAAAATGG + Intronic
1066973096 10:42335283-42335305 AAACATTACAAATATAAAGAGGG - Intergenic
1067670430 10:48315897-48315919 GCTCATTTTACATATAATGGAGG - Intronic
1068183580 10:53555276-53555298 TGACATTTGAATTATAAAGATGG - Intergenic
1068595866 10:58902309-58902331 AGACATTTTAAAAATAGAGATGG + Intergenic
1069001618 10:63273171-63273193 GCCCATTTTAAATATTTAAAAGG - Intronic
1070094424 10:73323253-73323275 ACCCATTTTGAAGATAAAGAAGG - Intronic
1070217294 10:74399196-74399218 ACACATATTAAATAAAAACAAGG - Intronic
1071306068 10:84299850-84299872 GCACATTTTCATTTTACAGATGG - Intergenic
1071324989 10:84505628-84505650 GCTCATTTTTAATTTAAATATGG + Intronic
1073705913 10:105984188-105984210 ACACATTTTGAATATAAAAGAGG - Intergenic
1074681551 10:115912456-115912478 GCACATTTTAAAAATACTGCTGG + Intronic
1075570915 10:123544482-123544504 GCACATTTTAAACATATTTAAGG - Intergenic
1078543190 11:12228020-12228042 GCACATTTTACAGATAAAAATGG + Intronic
1078973968 11:16449595-16449617 ATATATTTTAAAAATAAAGAAGG - Intronic
1078975660 11:16473116-16473138 GTACTTTTTATAAATAAAGAAGG - Intronic
1079440856 11:20513357-20513379 GAACATTTTAAAGCTAGAGATGG + Intergenic
1079808693 11:24967650-24967672 GCACATTAAAAAAATGAAGATGG - Intronic
1079990971 11:27246628-27246650 GCCCATTGGAAATATAAAGTTGG + Intergenic
1080601579 11:33825984-33826006 CCACAATTTCAAAATAAAGAAGG - Intergenic
1080754895 11:35187872-35187894 GCACTTTTTAAAAATAGACATGG + Intronic
1080819911 11:35795572-35795594 GGCCATTTAAAAAATAAAGACGG - Intronic
1081227751 11:40545632-40545654 GCACATATTAAGTATAAACAAGG + Intronic
1081284523 11:41251177-41251199 AGACATTTTAAATATGAAGGTGG - Intronic
1082662673 11:55932166-55932188 GCTCTTTTTAAATATAAAGATGG + Intergenic
1082695488 11:56358684-56358706 GCACATTTCAATAATAAATAAGG - Intergenic
1082770135 11:57201517-57201539 GGACATCTGAAATTTAAAGATGG + Intergenic
1085114020 11:73914084-73914106 GCACATTTTAAAAATAAATTTGG + Intronic
1086796391 11:91109548-91109570 CTATATTTTAAAGATAAAGAAGG - Intergenic
1086927277 11:92653965-92653987 GCAAAATTTAAAACTAAAGATGG - Intronic
1087115024 11:94515531-94515553 GCAAATTTAAAAAAGAAAGAAGG - Intergenic
1087733375 11:101804088-101804110 TCACATTTTAGAAATTAAGAGGG + Intronic
1087753497 11:102030528-102030550 ACACAATTTCAAAATAAAGAAGG + Intergenic
1088031508 11:105256898-105256920 GCACATTTTAAAGGAAAACATGG + Intergenic
1088078953 11:105886054-105886076 GAACATTAAAAATAGAAAGAAGG + Intronic
1088623389 11:111709621-111709643 GCAAATATTAAATAAATAGATGG - Intronic
1088913722 11:114211402-114211424 GCCCATTTTACAGATAAGGAAGG - Intronic
1091942920 12:4505814-4505836 TCAGATTCTAAAAATAAAGATGG - Intronic
1092668007 12:10827736-10827758 ACACAATTTAAATATAGAAAAGG + Intronic
1092705329 12:11277945-11277967 GAACATTTCCAAAATAAAGAGGG - Intergenic
1092919446 12:13218053-13218075 GCAAATTATGAGTATAAAGAGGG + Exonic
1093151095 12:15622556-15622578 GCACATTTTAAGTCTAAAATAGG + Intronic
1093575860 12:20729266-20729288 GTACATTTCAAATATAACGTTGG - Intronic
1093780115 12:23125732-23125754 GCACGTTTTAAATTTGATGAAGG + Intergenic
1093880242 12:24395936-24395958 GCACTTCTTAGAGATAAAGAGGG - Intergenic
1094287624 12:28813317-28813339 GCACTCTTTATATATAAAGTGGG + Intergenic
1095566160 12:43626283-43626305 GCACATTAAAAATAAAAGGATGG - Intergenic
1095673159 12:44884765-44884787 GCACATTTACAACCTAAAGAAGG + Intronic
1097296435 12:57968492-57968514 CAACATTATAGATATAAAGAAGG + Intergenic
1098341780 12:69459170-69459192 GCACATGCTAAAGAAAAAGAAGG - Intergenic
1099079055 12:78152755-78152777 GGATATTTTAAATATAATCAAGG + Intronic
1099264672 12:80430496-80430518 ACACATTTTAAATATGGGGAGGG + Intronic
1099367543 12:81787124-81787146 ACACATATTAAGAATAAAGATGG - Intergenic
1099426051 12:82523859-82523881 TCTCATCTTAAAGATAAAGAAGG + Intergenic
1099542535 12:83930565-83930587 GCACATTTTAAATAACAGGAAGG + Intergenic
1099592953 12:84619529-84619551 GAACCTTTGAAATCTAAAGATGG - Intergenic
1099786621 12:87272490-87272512 CAACATTTTAAATATACAGAAGG - Intergenic
1100764426 12:97848001-97848023 ACACATTTTAAATATGCAAATGG - Intergenic
1100780064 12:98014582-98014604 CCACACATTAAACATAAAGAGGG + Intergenic
1101924800 12:108962603-108962625 CCACATTTTTAAAGTAAAGAGGG + Intronic
1102541205 12:113620489-113620511 CCACATTTTAAATAAAGACAGGG - Intergenic
1102801077 12:115734468-115734490 ACAAATTTTAAATTCAAAGAGGG - Intergenic
1102944172 12:116971057-116971079 TCACATTTTAAACATTCAGAAGG + Intronic
1103486792 12:121288529-121288551 GCACATTTCAAAAATGAAAAAGG + Intronic
1103503881 12:121427235-121427257 GCTCATTTTAAAAATAAAAGAGG + Intronic
1104051576 12:125198122-125198144 TCACAGATTAAACATAAAGAAGG - Intronic
1104809823 12:131613354-131613376 GCACATTTTAACATTTAAGATGG - Intergenic
1105228743 13:18467350-18467372 AAACATTACAAATATAAAGAGGG - Intergenic
1105467948 13:20664691-20664713 GAATATTTTAAATATGAAAAAGG + Intronic
1106168594 13:27270381-27270403 GCACCTTTTAAAAATAAAAAGGG + Exonic
1107059459 13:36141936-36141958 TAACATTTAAAATATAAAGAAGG + Intergenic
1107070226 13:36260426-36260448 GCACTTTTTTTATAAAAAGATGG + Intronic
1107370342 13:39738658-39738680 GTCCATTTTAAATATAAAGGTGG + Intronic
1107599947 13:42003193-42003215 AAAAATTGTAAATATAAAGATGG - Intergenic
1107672072 13:42756115-42756137 GCACAATTAAAAAATAAAAAAGG - Intergenic
1107956391 13:45516762-45516784 GCTCATTTTACATAAAAGGAAGG - Intronic
1108277894 13:48829600-48829622 ACACATTTTTAATATACAGATGG - Intergenic
1108813597 13:54262883-54262905 GCATTTTTTAAATATCTAGAAGG + Intergenic
1108871043 13:54986538-54986560 GCATATTTTACATATAAGCATGG - Intergenic
1108991918 13:56669893-56669915 TCACATTTTACAAACAAAGAAGG - Intergenic
1109077268 13:57852430-57852452 GCACATCTAAAATATCTAGAAGG + Intergenic
1109942575 13:69390365-69390387 GCACATTATACATATATATAAGG - Intergenic
1110467833 13:75823218-75823240 GTACAGTTTACATATCAAGATGG - Intronic
1110470318 13:75852985-75853007 CCACATATAAAATATAAAAATGG + Intronic
1110652149 13:77954068-77954090 GCAAATTATAAATCAAAAGAAGG - Intergenic
1111014265 13:82356267-82356289 GCACATTTTTCTTGTAAAGATGG + Intergenic
1111289134 13:86140444-86140466 GCACATGTAAAATGTAAACATGG - Intergenic
1111459937 13:88525929-88525951 GCACAGTTTCATTATAAAGGTGG - Intergenic
1112642295 13:101289503-101289525 GCACATTTTCAGAACAAAGAAGG - Intronic
1112685959 13:101827265-101827287 GTGCATTGTAAATATAAAGAAGG - Intronic
1112688162 13:101856612-101856634 GCACATTTTGATTACAAAGAAGG + Intronic
1112701917 13:102019779-102019801 GCACACTTTAAATACAGAGCTGG + Intronic
1112712513 13:102146414-102146436 GCACATGTCAAACATAAAAAGGG - Intronic
1112755116 13:102624196-102624218 GAAAATGTTAAATATATAGATGG + Intronic
1112936720 13:104809690-104809712 GCCTATTTTAAATAAAAATAAGG + Intergenic
1113363780 13:109656737-109656759 GCATTTTTTTAATACAAAGATGG - Intergenic
1114331072 14:21637676-21637698 TCTGATTTTAAATATAAAAATGG - Intergenic
1114372624 14:22106983-22107005 GTACATTTTAAAAATAATAATGG + Intergenic
1114919162 14:27305300-27305322 GGACATTTTAAAGAGAAAAATGG - Intergenic
1115710677 14:36047507-36047529 GCACATTCTAAGTACATAGATGG - Intergenic
1115716303 14:36108328-36108350 GCATATTTTAAAGAGAAAAATGG + Intergenic
1115883080 14:37942464-37942486 GCACATTACAAATATGAAAAGGG - Intronic
1116625670 14:47259824-47259846 GCACATTTAGAACAGAAAGAGGG + Intronic
1116840571 14:49817107-49817129 GCTCCTTTAAAATATAAGGATGG + Intronic
1117738356 14:58790456-58790478 GCAGCTTATAAATATAAAAAGGG + Intergenic
1118125338 14:62896202-62896224 TGACATTTCAAATAGAAAGAAGG - Intronic
1118833206 14:69454660-69454682 ACACATTTTAAAGATAAGGCTGG + Intronic
1119736106 14:76983494-76983516 ACACACTGTACATATAAAGAGGG + Intergenic
1120071313 14:80106772-80106794 GTACATTTTAACTAGAAAAAGGG + Intergenic
1120319984 14:82947230-82947252 ACACATTTTAATTATTAAAATGG + Intergenic
1120571767 14:86127143-86127165 TCACATTTTAAAAATATAAATGG - Intergenic
1120623978 14:86802045-86802067 GGACATCTTAAATAAAAAGAAGG + Intergenic
1120980306 14:90283439-90283461 CACCATTTTAAATGTAAAGATGG + Intronic
1124822919 15:33065697-33065719 GAATATTTTAAATATATAGGAGG + Intronic
1124949436 15:34303046-34303068 TCACATTTTCATTTTAAAGATGG + Intronic
1125614639 15:40999650-40999672 ACACAATTTAATCATAAAGATGG - Intronic
1125703269 15:41707649-41707671 GCACAAGTTAAAAACAAAGAAGG + Intronic
1126623198 15:50660820-50660842 GAAAATCTTAAATATAAAAAAGG + Intronic
1128198881 15:65787527-65787549 ACACATTTTAAAAATAATAACGG + Intronic
1129306167 15:74664874-74664896 GAACCTTTTAAATGGAAAGATGG - Intronic
1129370304 15:75089347-75089369 TCACATTTTAAAAATAAATTAGG - Intronic
1129872690 15:78950863-78950885 TCACGTTTTAAAAATAAATATGG - Intergenic
1130025592 15:80268055-80268077 GCACATTTGGCAAATAAAGAAGG + Intergenic
1135671556 16:24379923-24379945 TCACATTTTATGTATCAAGAGGG + Intergenic
1137026089 16:35476707-35476729 GTATATTTTTAATATAAACATGG + Intergenic
1138394948 16:56696797-56696819 GCCCATTTCATATATAAATATGG + Intronic
1138641356 16:58390518-58390540 GAACATTTAAAATATGAAAAAGG + Intronic
1138871843 16:60898758-60898780 GCACATTTTAAATAATATTAAGG - Intergenic
1140113174 16:72020863-72020885 GAAAATTTTAAAAATAAAAAGGG + Intronic
1140672838 16:77295755-77295777 GCAAATTTTAAAGAAAATGAAGG - Intronic
1140719899 16:77762126-77762148 GCACATTTCAAATGTAATAAGGG - Intergenic
1142018840 16:87767188-87767210 GCACATTTTAAATGGGAAGGTGG - Intergenic
1142166884 16:88595928-88595950 TCACATTTTAAAAAGATAGATGG + Intronic
1145055146 17:19697893-19697915 GCCCATTTTAAAAATTAAGTAGG - Intronic
1147441657 17:40451217-40451239 GCACATTTAAAATCCCAAGAAGG - Intronic
1147518150 17:41141738-41141760 GCAAATTTTAAAATTTAAGATGG + Intergenic
1147653657 17:42076308-42076330 CCAGATTTTGAAGATAAAGAGGG + Intergenic
1147796721 17:43048925-43048947 GCACATATTAAATATACTGAGGG - Intronic
1148036436 17:44665293-44665315 ACATATTTTATAGATAAAGATGG + Intronic
1148657345 17:49297054-49297076 ACACAGTTTAAATATAGTGAGGG - Exonic
1150347691 17:64416868-64416890 GATTATTTTAAATATACAGAAGG - Intergenic
1150368867 17:64618129-64618151 TCACATGTTAAAAATAAAAAAGG + Intronic
1150901048 17:69277556-69277578 TAACATTTTAAAAATTAAGATGG + Intronic
1150985524 17:70192784-70192806 ACACATTTTAAATATCTATATGG + Intergenic
1151022734 17:70637287-70637309 GCAAATTATAAAAATAAAAATGG + Intergenic
1152479487 17:80540739-80540761 GCATTTTTTAAAAATTAAGATGG + Intergenic
1153033858 18:740364-740386 GCACATTTAAAACATAAAAGTGG + Intronic
1153211916 18:2776509-2776531 GTACATATAAAATATAAAAAAGG - Intronic
1153228411 18:2914833-2914855 CCACATTTTAAATAGTAAAACGG - Exonic
1153490531 18:5642944-5642966 GCTTATTTTAAATAAAAACATGG - Intergenic
1154524720 18:15272948-15272970 AAACATTACAAATATAAAGAGGG + Intergenic
1155378498 18:25189350-25189372 GCAGACTGTAAATATGAAGAGGG - Intronic
1155383522 18:25250792-25250814 AGACATTTTAAATTTCAAGATGG - Intronic
1155818092 18:30341408-30341430 AGGCATATTAAATATAAAGATGG + Intergenic
1158049783 18:53202851-53202873 GAACATTTTATTTATAAAAAGGG + Intronic
1158300127 18:56042671-56042693 ACACATTTTAAAGTGAAAGACGG + Intergenic
1158973481 18:62689588-62689610 GCATATTTTAAAGACAACGAGGG - Intergenic
1159191724 18:65054110-65054132 CTGCATTTTAACTATAAAGAAGG - Intergenic
1159397599 18:67883348-67883370 GCACATCTTAAATATCCAGGAGG + Intergenic
1159662447 18:71115319-71115341 GAACATTTTTACTATCAAGAAGG + Intergenic
1160316934 18:77857222-77857244 GCCCATTTTTAATAAAATGAAGG - Intergenic
1161386738 19:3998585-3998607 GAACATTTAAAAGAGAAAGAAGG - Intergenic
1161550924 19:4911657-4911679 GGACATTTTAAATGCAACGAGGG - Intronic
1164029387 19:21387763-21387785 GGACATTACAAACATAAAGAGGG + Intergenic
1164030181 19:21396668-21396690 CCAGACTTTAAAAATAAAGAAGG - Intergenic
1164092381 19:21969740-21969762 ACACATTATAAATATTAAGAGGG - Intronic
1164108242 19:22128923-22128945 GAACATTACAAATATAAAAAGGG - Intergenic
1164112302 19:22178846-22178868 AAACATTACAAATATAAAGAGGG - Intergenic
1164174123 19:22753607-22753629 AAACATTACAAATATAAAGACGG - Intergenic
1165604269 19:37086829-37086851 GCACATTTTAAATATAAAGATGG - Intronic
1167689955 19:50979384-50979406 TCACATTTTAAATAAAGAGCAGG - Intronic
1168533346 19:57147974-57147996 ATATATTTTAAAAATAAAGATGG - Intergenic
1168583870 19:57577283-57577305 AAAAATTTTAAAAATAAAGATGG + Intronic
925501086 2:4505635-4505657 CCACATTTTAAGCAGAAAGAAGG - Intergenic
925698779 2:6612144-6612166 GAACATTTCAAATCTACAGAAGG - Intergenic
925796881 2:7555193-7555215 GCCGATTTTGAATATAAAAAGGG + Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926420863 2:12697024-12697046 TCAGATATTCAATATAAAGAAGG + Intergenic
926573712 2:14557538-14557560 GCTCACATTAAATATATAGATGG + Intergenic
926987873 2:18643755-18643777 CCCCATTTTACATATGAAGAAGG - Intergenic
927226485 2:20770522-20770544 ACACATTTTTAACATATAGAGGG + Intronic
927429421 2:23014527-23014549 AAACATTTTAAAAATAAACAGGG - Intergenic
927581543 2:24255000-24255022 GCAGTTTTTAAATAAACAGAAGG + Intronic
927987931 2:27426524-27426546 GATCATTTTAAATGTAATGAAGG + Intergenic
928945474 2:36768121-36768143 GCATTTTTTAAATAAGAAGATGG - Intronic
928990135 2:37224568-37224590 GGAAAATTTAAATGTAAAGAGGG - Intronic
929151436 2:38752045-38752067 TCACAATTTCAATATAAAGGGGG - Intronic
929339400 2:40795223-40795245 GCAGATGGTAAATCTAAAGATGG + Intergenic
930280618 2:49364284-49364306 AAACACTTTAAATATAATGATGG + Intergenic
930287593 2:49451134-49451156 GCAGATTTTAAATCTGAAGCAGG - Intergenic
930296976 2:49566705-49566727 TCACAGTTTAAATTTAATGATGG + Intergenic
930729840 2:54718126-54718148 CCACATTTTAAATAGAATGTGGG - Intergenic
931490744 2:62743964-62743986 GAACATCTTAAATCTGAAGACGG - Intronic
932117332 2:69064608-69064630 AGACACTTTAAATATAAATATGG + Intronic
933190980 2:79333078-79333100 ACAAATTTTAAAAATCAAGATGG + Intronic
933214530 2:79614121-79614143 GCAATATTTAAATATAAATATGG + Intronic
933293731 2:80466829-80466851 GCATATTTTAGATAACAAGAGGG + Intronic
933629513 2:84639861-84639883 GCAGATTATAAATAGAAAAAAGG + Intronic
933934429 2:87189970-87189992 GCAGCTTTTAAATATAAACATGG - Intergenic
934249971 2:90342833-90342855 GCACAAATTAAAAATAAATAGGG - Intergenic
934259601 2:91460608-91460630 GCACAAATTAAAAATAAATAGGG + Intergenic
934977798 2:98817318-98817340 GTACATTTTAAAATTTAAGAGGG + Intronic
935312646 2:101800548-101800570 GCTAGTTTTAAATATAAAAAAGG + Intronic
936358713 2:111775925-111775947 GCAGCTTTTAAATATAAACATGG + Intronic
937397753 2:121553400-121553422 GCACTTTTTAAAAAGAAAAATGG + Intronic
937532770 2:122850227-122850249 GCATATTTCACATACAAAGAGGG - Intergenic
937567730 2:123315373-123315395 ATACATTATAAATATAAAGTGGG + Intergenic
938523903 2:132105065-132105087 AAACATTACAAATATAAAGAGGG + Intergenic
938881046 2:135588860-135588882 ACACATTTGAAAAATACAGATGG - Intronic
939135086 2:138284211-138284233 GCACATTCTAGATATCCAGAAGG - Intergenic
939595448 2:144117127-144117149 TCACCTGTTAAATATATAGAAGG - Intronic
940278006 2:151959707-151959729 CCACATTCCAAATATAAAGTAGG - Intronic
940416595 2:153429856-153429878 TAAGATTTTAAATATAAAAAGGG + Intergenic
940832697 2:158485127-158485149 GGACATTCTAATTATAGAGAAGG - Intronic
941304651 2:163848246-163848268 GAACATTATTAAGATAAAGAAGG - Intergenic
941574241 2:167210952-167210974 TTACATTTCAAATATAAAGAGGG - Intronic
942373081 2:175307223-175307245 GCCCATTTTAACTAGAAACAAGG - Intergenic
942741853 2:179189942-179189964 TAACATTTTAAATATGACGATGG - Intronic
942823486 2:180144589-180144611 GCATATGTTAAATATAACTAAGG + Intergenic
942875325 2:180788930-180788952 TCACATGTTAAATAAGAAGATGG - Intergenic
943110043 2:183593357-183593379 AGACATGTAAAATATAAAGAAGG - Intergenic
943663550 2:190585088-190585110 GGACATTTTAAAGACAAACATGG + Intergenic
943877326 2:193087049-193087071 GCAGATTTTAAAAATAAGCAAGG + Intergenic
944028187 2:195197668-195197690 ACACTTTTTAAATACAAAGGTGG - Intergenic
944052546 2:195487520-195487542 GCACTTTTTAAAAATAATTATGG + Intergenic
944177082 2:196842649-196842671 GTATATTTTAGATATAAAGGGGG + Intronic
944522045 2:200581440-200581462 GGACATTTTTAATATAATAAAGG - Intronic
944966013 2:204934655-204934677 GAACATTTTAATAATAAAAAAGG - Intronic
945321515 2:208429254-208429276 GCACATTTTAAAAATCATTATGG - Intronic
946112868 2:217435658-217435680 GAACATTTTAAATATGAGCAGGG + Intronic
947061954 2:226176866-226176888 GCACATTTAAAATAAATAGCAGG + Intergenic
947222318 2:227805256-227805278 GCACAGCTTAAAAATAGAGAAGG + Intergenic
947521514 2:230849642-230849664 GCAAATATTAACTAAAAAGATGG + Intergenic
947962288 2:234249227-234249249 GCACAAGCTAAAAATAAAGATGG + Intergenic
948225961 2:236309637-236309659 TCTTATTCTAAATATAAAGATGG - Intergenic
948341280 2:237254216-237254238 GCACATTTTAAATCTCCAGGAGG + Intergenic
1169499999 20:6149960-6149982 GCATATTTTAATTAAAAAGAGGG - Intergenic
1169664924 20:8022930-8022952 CCACGTTTTAAACATAAACATGG - Intergenic
1169727868 20:8755384-8755406 GCACATTTTAAAAATACATTAGG - Intronic
1170469205 20:16651537-16651559 GCACATTTTAAAAATTAATTTGG - Intergenic
1170877037 20:20259571-20259593 ACACATTAAAAATAGAAAGAGGG - Intronic
1171535711 20:25886969-25886991 GCATTTTTTAAATGTAAAAATGG + Intergenic
1171572148 20:26262929-26262951 GCATTTTTTAAATGTAAAAAAGG - Intergenic
1171805377 20:29674215-29674237 GCATTTTTTAAATGTAAAAAGGG - Intergenic
1171838675 20:30182216-30182238 GCATTTTTTAAATGTAAAAATGG + Intergenic
1172058741 20:32174366-32174388 ACACATTTTAACTATACAAATGG - Intergenic
1173697042 20:45026673-45026695 ATACCTTTTAAATATAAATAAGG - Intronic
1174123398 20:48284508-48284530 GCACATATTCAATGTACAGATGG - Intergenic
1175230393 20:57470138-57470160 GAACATTTTAAATGAAAAGGGGG + Intergenic
1176358298 21:5971146-5971168 GAACATTTAAACTATAAAAAGGG - Intergenic
1176772723 21:13095537-13095559 AAACATTACAAATATAAAGAGGG - Intergenic
1177538977 21:22466891-22466913 GCATCCTTAAAATATAAAGAAGG - Intergenic
1177711620 21:24783043-24783065 GAAAAATTTAAATATAAAAACGG + Intergenic
1178159029 21:29889284-29889306 ACACATTTTTAACATAAAAAAGG + Intronic
1178277381 21:31251551-31251573 GCACATTTTAAAATGTAAGAGGG + Intronic
1179765220 21:43567404-43567426 GAACATTTAAACTATAAAAAGGG + Intronic
1180520365 22:16195247-16195269 AAACATTACAAATATAAAGAGGG - Intergenic
1180688612 22:17690818-17690840 GTAAAATTTAAATATAAATATGG + Intronic
1181293504 22:21816522-21816544 ACACATTTAAAGTATAAAGTTGG - Intronic
1182930222 22:34166601-34166623 GCAAATTTTAAGTATAAAATCGG + Intergenic
1183726744 22:39594190-39594212 GCCCATTTTACAGATAAGGAAGG - Intronic
949553148 3:5129348-5129370 GCAGATTTCATATATAAAGTTGG + Intronic
949622626 3:5831681-5831703 GTACTATTTAACTATAAAGAGGG - Intergenic
949694453 3:6678404-6678426 CCCCATGTTAAATAGAAAGAAGG + Intergenic
950354692 3:12396861-12396883 GAAAATTTTAAAAATAAAAAGGG - Intronic
950671217 3:14526800-14526822 ATACATTTCAAACATAAAGAAGG + Intronic
950938711 3:16871498-16871520 AGACATTTTAAATATAAAGGAGG - Intronic
951325341 3:21296082-21296104 ACACATTTTAAATAAAAAGTAGG + Intergenic
951386081 3:22044520-22044542 GCAATTTTTAAATAAAAAGCAGG + Intronic
951878057 3:27450151-27450173 TCACCTTTTAAATTAAAAGAGGG + Intronic
952554357 3:34515057-34515079 TCCCATTTTAAAAATAAAGAGGG - Intergenic
952667935 3:35930145-35930167 CAAGATTTTGAATATAAAGATGG - Intergenic
952994304 3:38863096-38863118 GCAAATTTTAAGAATAAAGAAGG + Intronic
953038744 3:39236444-39236466 CCCCATTTTAAATAAATAGATGG + Intergenic
953067066 3:39483247-39483269 TAACATGGTAAATATAAAGATGG + Intronic
953967228 3:47318626-47318648 GCACATATTATTTAGAAAGATGG + Intronic
954492919 3:50924451-50924473 ACTCATTTTAAACACAAAGAAGG - Intronic
954923368 3:54211171-54211193 TCACATGTTAAAAAAAAAGAGGG - Intronic
955659903 3:61287443-61287465 CCACATATTAAAGATAAATATGG - Intergenic
955751044 3:62185693-62185715 GTATATTTTACATATAAATATGG - Intronic
955910460 3:63854245-63854267 GTTCTTTTTAAATTTAAAGATGG + Intronic
956229245 3:66995315-66995337 TCACATTGAAAATATCAAGAAGG + Intergenic
956367069 3:68515737-68515759 CCACATTTTACACATAAGGAAGG - Intronic
956944471 3:74203986-74204008 GCAGCTTTTAAGTATTAAGATGG + Intergenic
957605747 3:82396613-82396635 TCAACTTTTAAATAGAAAGAAGG + Intergenic
957667421 3:83250942-83250964 GCCCAACTTAAATATAAGGAGGG + Intergenic
957751554 3:84424549-84424571 GTAAATTTTAAATATACATATGG - Intergenic
957868825 3:86061756-86061778 GCAAAATTTAAATAGAAAAATGG + Intronic
958465388 3:94451352-94451374 TCACATTTTAAATATTAAAAAGG - Intergenic
958641264 3:96809356-96809378 GCATATTCTAAATATCAAGTAGG - Intergenic
959148541 3:102579842-102579864 GCTCATTTTATAGATAAAAAAGG - Intergenic
959181475 3:102985929-102985951 TCACATTTTACACATAATGAAGG - Intergenic
959237988 3:103748903-103748925 ACACGTTTGAAATATAAAAAGGG - Intergenic
959401755 3:105911169-105911191 CGACATTTTAATTTTAAAGAAGG + Intergenic
959732006 3:109614877-109614899 GCACATTATTATTATAAAGTAGG - Intergenic
959786531 3:110305395-110305417 GAAAATTTTATAGATAAAGAAGG - Intergenic
960419417 3:117425604-117425626 AAACCTTTCAAATATAAAGAAGG + Intergenic
961706855 3:128793543-128793565 GCAAGTTTCAAATAGAAAGAAGG - Intronic
962060301 3:131919627-131919649 ACACATTGTAAATATACAGCTGG - Intronic
962230454 3:133661509-133661531 ACAGATTTTAAATATAAACATGG + Intronic
962953391 3:140242376-140242398 GCACATTTGAAATATAATATTGG + Intronic
964428286 3:156576367-156576389 GAACATTTCAAATATTAGGATGG + Intergenic
965574260 3:170202265-170202287 GCACACTTGAGATAAAAAGAGGG - Intergenic
966081034 3:176001056-176001078 GCACATTCTAATTAGAAAGAAGG + Intergenic
967202028 3:187080289-187080311 GTATTTTTTAAATAAAAAGATGG - Intergenic
967235629 3:187381183-187381205 CCACAATTTAAATATAATCACGG + Intergenic
967413432 3:189190771-189190793 GTACATTTAATATATAGAGATGG + Intronic
967501095 3:190198526-190198548 TCACATTTGAAATATAAAATTGG - Intergenic
967650490 3:191979532-191979554 GAACATTTTAAATAAAACAATGG - Intergenic
968011190 3:195278422-195278444 ACAAATTTCAAATATAAAAATGG + Exonic
968017081 3:195346390-195346412 GCAAATTTCAAACATTAAGAAGG + Intronic
968321173 3:197769931-197769953 ACATATTTTAAATATAATGTGGG + Intronic
970953542 4:21784450-21784472 TCACATTTTAAAGAAAAACAAGG + Intronic
971662843 4:29441876-29441898 GCACATTTTAAAAATGCAAATGG - Intergenic
972242669 4:37210169-37210191 GCACATCTTACATACCAAGAAGG - Intergenic
972407855 4:38763629-38763651 GCACATTTGAAATCTCAAAAAGG + Intergenic
973712001 4:53639437-53639459 GCAGATTTTAAATAAATATAAGG - Intronic
973926207 4:55740619-55740641 ACACATTTTAAACTTAAATATGG - Intergenic
975458691 4:74624921-74624943 GTACAGTTTAAATATACTGATGG + Intergenic
976004117 4:80407725-80407747 GCACATTTTAAAAATAATTGGGG + Intronic
976132033 4:81894898-81894920 GCAGATTTTAAAAATGAACAAGG + Intronic
976337003 4:83900477-83900499 GCCCATTATACATATTAAGAAGG - Intergenic
977124821 4:93151484-93151506 ACATAGTTTTAATATAAAGAAGG - Intronic
977169109 4:93738499-93738521 GTAGATTTTAAATATAACTAGGG + Intronic
977399345 4:96511434-96511456 GCATATTTCAAATAGAAAGATGG - Intergenic
977402587 4:96551821-96551843 ACATATCTAAAATATAAAGAAGG + Intergenic
977486741 4:97658357-97658379 AAACATTTTAAAGATAAAGCAGG + Intronic
977969622 4:103198395-103198417 GGAAATTTTAAATTTAAAGGCGG - Exonic
978405999 4:108379278-108379300 GCACAATTCAAATATAGAGCTGG - Intergenic
978679759 4:111365929-111365951 TCCAATTTAAAATATAAAGAGGG + Intergenic
978779856 4:112540070-112540092 GCACAGTTTTAATATCAGGATGG + Exonic
979415861 4:120438141-120438163 CTACATTTTAAATATAGAAAAGG - Intergenic
979466967 4:121051101-121051123 GAAACTTTTAAATATAAAAATGG + Intronic
979571427 4:122230773-122230795 GCACATATTAAATATACAATGGG - Intronic
979600069 4:122577615-122577637 GGACATTAGAAAAATAAAGATGG + Intergenic
980237665 4:130130442-130130464 AATCAATTTAAATATAAAGAAGG + Intergenic
980669994 4:135993082-135993104 CCACATTTGAAATATAAAACAGG - Intergenic
981191970 4:141874282-141874304 GCGTTTTTTAAATATAAAAATGG + Intergenic
982051574 4:151507497-151507519 ACACATATTAAATGGAAAGAGGG - Intronic
982279411 4:153668068-153668090 GTTCATTTTAAAAATAAATATGG + Intergenic
982441645 4:155442646-155442668 GCATATGGTAAATAGAAAGACGG + Intergenic
983490779 4:168386535-168386557 GCCCCATTTAAAGATAAAGAAGG + Intronic
983907031 4:173194306-173194328 GGGCAATTTAAATTTAAAGAAGG + Intronic
983908417 4:173208719-173208741 GAACCATTTAAATAAAAAGACGG - Intronic
984002852 4:174271645-174271667 GCCAATTGTAAATATAAGGAGGG - Intronic
984115867 4:175680809-175680831 GCACATTTCATGTAAAAAGAAGG - Intronic
984185921 4:176543765-176543787 GCACATTCTGAATTTAAAGTAGG + Intergenic
984676495 4:182554134-182554156 AAACATTTTAAATATAACAAAGG + Intronic
985811515 5:2093389-2093411 ACACATTTAAAATATAAAATTGG - Intergenic
985860895 5:2469968-2469990 GTATATTTTAAAGATAAAGATGG - Intergenic
986997949 5:13628746-13628768 CCACATTATAAAAATAAATATGG + Intergenic
987106367 5:14643712-14643734 ACAAATTTTAAAAATAAAGAAGG - Intergenic
988078900 5:26390486-26390508 GCACATTTTAACTTCCAAGAAGG - Intergenic
988171763 5:27666784-27666806 GCACATTTTACATCTCAATAAGG + Intergenic
988452226 5:31354968-31354990 GACCATTTTAAATATAGAAATGG - Intergenic
988793826 5:34633953-34633975 GCACATATTAAAAATAAACGGGG + Intergenic
989000397 5:36754159-36754181 GAACATTTTGAATAGCAAGATGG + Intergenic
989687058 5:44102066-44102088 GTACAGTTTAAAAATAAATAGGG + Intergenic
991526094 5:67559731-67559753 GCTTATTTTTAATATCAAGATGG + Intergenic
992672413 5:79073548-79073570 GTACTTTTGAAATATAAAAAAGG - Intronic
992751021 5:79860980-79861002 GCAGATTTCAGAGATAAAGAGGG - Intergenic
993558223 5:89368251-89368273 GGAAATTTTACACATAAAGAGGG - Intergenic
993725016 5:91357090-91357112 GTATATTTTAAATTTAGAGATGG + Intergenic
993787155 5:92156615-92156637 TCCTATTTTAAATATAAAGTTGG - Intergenic
994719147 5:103360830-103360852 GCTCAATTTAACTACAAAGAAGG + Intergenic
995321972 5:110844936-110844958 GTAGATTTTAAATAAAAAGTGGG + Intergenic
996485966 5:124034551-124034573 GCGCATTTTAAACATAAGGCAGG + Intergenic
996522804 5:124446163-124446185 GCACAGTTTAAATTAAAAAACGG - Intergenic
996647369 5:125832548-125832570 GCACATTAAAAAAATAAAAATGG - Intergenic
996916887 5:128722781-128722803 GCACAGTTGAAAGACAAAGATGG - Intronic
997790375 5:136754255-136754277 GAAAATTTTAACTATAAATAAGG + Intergenic
998543047 5:143001322-143001344 GTACATTTTACATTTAAAAATGG + Intronic
998842504 5:146270464-146270486 GCACATTTTAAAAATTAAAGAGG + Intronic
998894308 5:146782361-146782383 GCATATTCTAAATGTAAAGTTGG - Intronic
998999648 5:147906707-147906729 ACAAATTTTAAAAATCAAGAGGG - Intergenic
999617900 5:153444415-153444437 GCACATTTTAAAGATCCTGAAGG + Intergenic
999643361 5:153694335-153694357 GAACATTCTATACATAAAGAAGG + Intronic
1000573312 5:162942452-162942474 GCATAATACAAATATAAAGATGG + Intergenic
1000882892 5:166717592-166717614 GGACAGATCAAATATAAAGATGG - Intergenic
1003582541 6:7354297-7354319 GCAAGTTTTAAATTTGAAGAGGG - Intronic
1005102880 6:22192197-22192219 GCAAATTACAAATATAAAAAAGG + Intergenic
1005638864 6:27775914-27775936 GCCCATATTTAATATAAAAATGG + Intergenic
1006883837 6:37363283-37363305 GCACTTTTTAAAAATACTGATGG + Intronic
1006934440 6:37707605-37707627 GCCCATTTTTCAGATAAAGATGG + Intergenic
1008371008 6:50730559-50730581 GCACATTTTAAGTAAAAATGTGG + Intronic
1008941683 6:57052727-57052749 GCATTTTTTAAATGTGAAGAAGG + Exonic
1009815910 6:68734534-68734556 GTAAAATTTAAATATACAGACGG - Intronic
1010397540 6:75409290-75409312 TCACATTTGTAATATAAAGGAGG + Intronic
1010583847 6:77633439-77633461 GTACATTCTAAAATTAAAGAAGG + Intergenic
1010874222 6:81081777-81081799 GAAAATTTTAAACAAAAAGAGGG - Intergenic
1010889532 6:81289276-81289298 GTTCATTTTAAATGTAAATATGG + Intergenic
1011554260 6:88558092-88558114 CCTCATTTTTAATATATAGATGG + Intergenic
1011759198 6:90542162-90542184 TGACATTTTAATTGTAAAGAAGG - Intronic
1011827991 6:91333169-91333191 GCACATTCATAATATAAAGCAGG + Intergenic
1012051559 6:94351612-94351634 GCATATTTTAAATTGAAGGAGGG + Intergenic
1012503639 6:99919375-99919397 ACACAATTGAAATATAAAAATGG + Intergenic
1013143708 6:107365630-107365652 GCACACTTTATAGAAAAAGACGG + Intronic
1013518783 6:110913787-110913809 GCACATTTAAAATAAAAAATTGG - Intergenic
1013778460 6:113704407-113704429 GCAAATTTTGAATATAGAGCAGG + Intergenic
1014847332 6:126293485-126293507 GAACATTTTAAATAATAATATGG + Intergenic
1014989925 6:128061919-128061941 ACACATTTTAAATGTACAGTTGG + Intronic
1015942699 6:138467728-138467750 AAACATTTTAAATAGAAAAATGG + Intronic
1016565482 6:145448178-145448200 GCACTTTTTAAATTAAAAAATGG - Intergenic
1016799829 6:148157281-148157303 GTAGATTTTAAATATAATAAAGG - Intergenic
1016920801 6:149290941-149290963 GTAAATTTTTAATGTAAAGAAGG - Intronic
1018103676 6:160463763-160463785 GCACATTGTAAACCTACAGATGG - Intergenic
1020985282 7:15126266-15126288 TAACATTTTAAATATAAATGAGG + Intergenic
1021218558 7:17947520-17947542 TCTCATTTTAAATAGAAAGGTGG - Intergenic
1021957847 7:25843980-25844002 GTAAATTTTAAATATAAGAAAGG + Intergenic
1022001142 7:26227452-26227474 GCACAGTTAGAATATAAAGCAGG + Intergenic
1022016949 7:26358366-26358388 GCACATTCTAAATTATAAGAGGG - Intronic
1022212950 7:28229481-28229503 GAAAATTATAAATATTAAGATGG - Intergenic
1022812250 7:33881270-33881292 GCACATGTTAAATAAAATGAAGG - Intergenic
1022851994 7:34273258-34273280 GAACACTTTAAGCATAAAGACGG + Intergenic
1023109863 7:36798910-36798932 GAACATTCTAAAAATAAATAAGG + Intergenic
1023155032 7:37241193-37241215 ACACATTTAAAATAAAAAGGAGG + Intronic
1023810861 7:43910529-43910551 GTAAATTTTTAATAAAAAGATGG - Intronic
1024396298 7:48871986-48872008 GAATTTTTTAAATATAAAGGAGG - Intergenic
1024454697 7:49590671-49590693 GCACACTTAAATTATTAAGATGG + Intergenic
1024822037 7:53343243-53343265 AAAAATTTTAAAAATAAAGAGGG + Intergenic
1024925811 7:54614189-54614211 ACACATTTAAAAAATAAAGTGGG + Intergenic
1025867609 7:65400239-65400261 GAACATTACAAATAGAAAGAGGG + Exonic
1026145858 7:67745903-67745925 TCATATTATAAAAATAAAGAGGG - Intergenic
1026669393 7:72374934-72374956 GCGCTTTTTACATATAAATATGG + Intronic
1027537643 7:79425297-79425319 GCACATTTGAAATAGCAGGAAGG - Intronic
1027982655 7:85246176-85246198 ACAAATTGTAAACATAAAGAAGG - Intergenic
1028263953 7:88700226-88700248 GCACATGTCAAAAATACAGAGGG - Intergenic
1029019964 7:97354515-97354537 GCAGATTTTAAATCTTAGGATGG - Intergenic
1029065621 7:97844956-97844978 GCACTTCTTACATAGAAAGAAGG + Intergenic
1029206598 7:98872763-98872785 GCCCATTTTAAAGAAAAAGGGGG - Intergenic
1029823217 7:103164404-103164426 GCACAATTTTATTTTAAAGATGG + Intergenic
1030430955 7:109447280-109447302 GGACATTTTAGCAATAAAGAAGG - Intergenic
1031176273 7:118355904-118355926 ACCCAATTTAAATATAAAAATGG - Intergenic
1031199866 7:118668504-118668526 GCAAATTAAAAATATAAATAAGG + Intergenic
1031287720 7:119892008-119892030 ACACACTTCAAATCTAAAGAAGG + Intergenic
1032759612 7:134927706-134927728 GCACATTTTAGAGCAAAAGAGGG + Intronic
1032925228 7:136596826-136596848 TCATATTTTAAGTATAAAGGAGG - Intergenic
1033290837 7:140081445-140081467 GCACAGTTAGAATATAAAGCAGG + Intergenic
1033312593 7:140272588-140272610 CCACATTTTAAAAATCAACATGG + Intergenic
1033511827 7:142067067-142067089 GCACATTTTAAATGTGAGGATGG - Intronic
1034108832 7:148516317-148516339 GCACATACAGAATATAAAGATGG + Intergenic
1035110846 7:156480437-156480459 GGACATTTTTAAAATAAAAATGG + Intergenic
1035847042 8:2876276-2876298 CCACGTTTTTAATATTAAGAAGG - Intergenic
1036293504 8:7516897-7516919 GAACACATTAAATATAAAGATGG + Intergenic
1036329055 8:7804098-7804120 GAACACATTAAATATAAAGATGG - Intergenic
1036663556 8:10724488-10724510 GCACCTTTTGAATCTACAGAGGG + Intergenic
1036969322 8:13336682-13336704 ACTCATTTTATAGATAAAGAAGG - Intronic
1037059117 8:14484727-14484749 AAACATTTTAGATATAAATATGG - Intronic
1037104346 8:15086896-15086918 GTACATTTCACATATAAAGAAGG + Intronic
1037629726 8:20643690-20643712 GCACATCTGAAAAATACAGAAGG - Intergenic
1038060126 8:23903367-23903389 TCACATTTTAAATATATATGGGG - Intergenic
1039056088 8:33537997-33538019 CCACATTTTAAATATGAAATAGG + Intergenic
1039421702 8:37449013-37449035 GCCCATTTTAAATCTATACATGG - Intergenic
1039775261 8:40729985-40730007 GCAGATTTTAAACATAATTATGG - Intronic
1040034554 8:42857717-42857739 TCACATTTTAAAAATAATGAAGG + Intronic
1040395479 8:46995816-46995838 GCATATTCTGAATATAAAGACGG - Intergenic
1041029871 8:53725740-53725762 GCACAATTTAAACAAAGAGAAGG + Intronic
1041509175 8:58635608-58635630 GTACATTTTAACTAGAAAGCAGG + Intronic
1042042856 8:64612598-64612620 GCACACTTTGATTATAAAGCAGG - Intronic
1042074498 8:64975864-64975886 GTACATTTTAAATAATAAGTAGG - Intergenic
1042897818 8:73690394-73690416 TCCCATTTTAGATATAATGAAGG - Intronic
1043203142 8:77397633-77397655 GCAGATTTAAACTATAAAAATGG + Intergenic
1043429141 8:80177649-80177671 AAACATTTTAAAAATAAATAAGG - Intronic
1043504813 8:80891846-80891868 GAACATTGTAAATGTAAATAAGG - Intergenic
1043699985 8:83273923-83273945 ACACATTATAAATTAAAAGATGG + Intergenic
1044640769 8:94379099-94379121 GCACATTTCAAATAAAAATCTGG + Intronic
1045126891 8:99101432-99101454 GCAGATTTTAAAAACAAAAATGG - Intronic
1045196473 8:99935918-99935940 GCACACTTAAAATTTTAAGAAGG + Intergenic
1045966817 8:108034430-108034452 GAAGATTTTATACATAAAGAAGG + Intronic
1046270783 8:111895154-111895176 ACCCATTTAAAATCTAAAGAAGG - Intergenic
1046402352 8:113720335-113720357 GCAGAATAGAAATATAAAGATGG - Intergenic
1046846583 8:118922863-118922885 GCATAAATTAAATATAAAGTAGG - Intergenic
1047040440 8:120988747-120988769 GTCAATTTTAAATATAAACAGGG - Intergenic
1047144037 8:122176910-122176932 ACATATTTTAAATATAGACATGG - Intergenic
1047472748 8:125194873-125194895 GAAAAATTTAAATATAAAAAAGG - Intronic
1047635736 8:126760091-126760113 GCTAATTTTAGATATTAAGATGG - Intergenic
1047640631 8:126817788-126817810 GCAAAATATAAAAATAAAGAAGG - Intergenic
1047685387 8:127300105-127300127 GCTCATTTTATATATATTGAGGG - Intergenic
1048744128 8:137594307-137594329 GAAAATTATAAATATAAAGGCGG - Intergenic
1049066796 8:140322506-140322528 GCACTTTTTAAATAGAGATATGG + Intronic
1049943569 9:572829-572851 AGAAATTTTTAATATAAAGATGG - Intronic
1051119877 9:13741046-13741068 GCAAAATATAAATACAAAGAAGG + Intergenic
1051495612 9:17719400-17719422 GCAGCTTATAAATATGAAGAAGG + Intronic
1051622546 9:19066481-19066503 CCACATTTCAAAGATAAGGAGGG - Intronic
1052171393 9:25401360-25401382 TCACATTTTTTATATAAACATGG - Intergenic
1052200883 9:25778426-25778448 GCACATTTTTCAAATAAACAGGG + Intergenic
1052399092 9:27978207-27978229 GCTCATTTAGAATCTAAAGAAGG - Intronic
1052611661 9:30783773-30783795 GTACAATTTAAATATAGATATGG + Intergenic
1053702650 9:40712673-40712695 AAACATTACAAATATAAAGAGGG + Intergenic
1054412709 9:64836137-64836159 AAACATTACAAATATAAAGAGGG + Intergenic
1055395661 9:75871506-75871528 ACTCATTTTAAAAATAGAGATGG + Intergenic
1057102454 9:92375936-92375958 GTACATTTTGAATATTATGATGG + Intronic
1057382382 9:94580848-94580870 GCACATATTTCATCTAAAGAAGG + Intronic
1058069357 9:100585935-100585957 GCACATTGATAATATCAAGAAGG + Exonic
1058686241 9:107482838-107482860 GCACTTAGCAAATATAAAGATGG + Intergenic
1060678762 9:125542515-125542537 GCATATTTTCTATATAAAGTTGG + Intronic
1061629866 9:131865543-131865565 AGACATTTTAAAAATAAAGGGGG - Intronic
1185894455 X:3844957-3844979 GTAAATTTTATATAAAAAGAAGG + Intergenic
1185899573 X:3883381-3883403 GTAAATTTTATATAAAAAGAAGG + Intergenic
1185904689 X:3921810-3921832 GTAAATTTTATATAAAAAGAAGG + Intergenic
1186007680 X:5091999-5092021 ATAGATTTTAAATATAAAGTAGG + Intergenic
1186025709 X:5308748-5308770 GCACAATATAAAGATAAAAATGG - Intergenic
1186160158 X:6768998-6769020 GCACATTTTGTACATAGAGAAGG + Intergenic
1186605601 X:11087072-11087094 TCTAACTTTAAATATAAAGATGG - Intergenic
1186796998 X:13056680-13056702 GAATTTTTTAAATATATAGAAGG - Intergenic
1187062622 X:15802343-15802365 ACAAATTTCTAATATAAAGAGGG - Intronic
1187230780 X:17420658-17420680 TGGCATTTTAAATATAAAGTTGG + Intronic
1187467846 X:19542384-19542406 TCACATTTAAAATACATAGAAGG - Intronic
1187761468 X:22590863-22590885 TAACATTTTAAATATTAAAATGG - Intergenic
1188373909 X:29404061-29404083 GCAAATTTTAAATATAATTCAGG - Intronic
1188634288 X:32408949-32408971 TGACATTTTAAATATAGAGATGG - Intronic
1188682846 X:33032518-33032540 GCTTATTTTAAATTTAATGATGG - Intronic
1188840985 X:35017041-35017063 GCAAATTGGGAATATAAAGAGGG + Intergenic
1188949731 X:36355831-36355853 GCACTTTAAAAATATTAAGAGGG + Intronic
1189318311 X:40071687-40071709 GCCCATTTTAATTACATAGATGG - Exonic
1192823184 X:74666060-74666082 AGATATTTTAAATATATAGATGG - Intergenic
1192839442 X:74838661-74838683 CAACAATTTAAATAAAAAGAAGG - Intronic
1193223790 X:78957777-78957799 CCACATTTAAAAAATAAAAAAGG + Intronic
1193322648 X:80141060-80141082 CCAAATTTTAAATGTAAAGATGG - Intergenic
1193330448 X:80230158-80230180 GCACAGTGTAAAAATAAATAAGG - Intergenic
1194183929 X:90748145-90748167 CCACATTTAAAAAAAAAAGAGGG - Intergenic
1194202149 X:90965453-90965475 GCAGATTATAATTATAAAGAAGG - Intergenic
1195095615 X:101498469-101498491 GGATATATTAAATATAAGGAAGG + Intronic
1195291738 X:103436667-103436689 CCACATTGTCCATATAAAGAGGG + Intergenic
1195390267 X:104354392-104354414 GCACATTTTATAGATAAAACTGG + Intergenic
1195503146 X:105626547-105626569 GAAGATTTTAAATATAAACATGG + Intronic
1195642423 X:107191110-107191132 GCACATTCTAAATAGAAAAAAGG + Intronic
1196073612 X:111550249-111550271 GCAGAATTTAAATATACTGATGG + Intergenic
1196665533 X:118311919-118311941 GCAAATTTAAAATATGAAGTAGG - Intergenic
1197835688 X:130691316-130691338 TCACATTTTAAATGGAAGGAAGG - Intronic
1198038621 X:132826602-132826624 TCACATTTTATATATATATATGG + Intronic
1200547986 Y:4540905-4540927 GCAGATTATAATTATAAAGAAGG - Intergenic
1200605118 Y:5253995-5254017 ACATATTTTAACTAGAAAGAGGG - Intronic
1200844454 Y:7817095-7817117 GCACTTTTTAAATATAACAGGGG - Intergenic
1201379580 Y:13359343-13359365 GTAGATGTTAAATATAAAGAGGG + Intronic