ID: 1165610689

View in Genome Browser
Species Human (GRCh38)
Location 19:37149737-37149759
Sequence GATCTCAGGAGACCACAAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 281}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165610689_1165610691 -7 Left 1165610689 19:37149737-37149759 CCAGCTTGTGGTCTCCTGAGATC 0: 1
1: 0
2: 0
3: 16
4: 281
Right 1165610691 19:37149753-37149775 TGAGATCTCCAGATCATCCCTGG 0: 1
1: 0
2: 1
3: 15
4: 124
1165610689_1165610693 3 Left 1165610689 19:37149737-37149759 CCAGCTTGTGGTCTCCTGAGATC 0: 1
1: 0
2: 0
3: 16
4: 281
Right 1165610693 19:37149763-37149785 AGATCATCCCTGGCCCACCCTGG 0: 1
1: 0
2: 0
3: 21
4: 232
1165610689_1165610704 29 Left 1165610689 19:37149737-37149759 CCAGCTTGTGGTCTCCTGAGATC 0: 1
1: 0
2: 0
3: 16
4: 281
Right 1165610704 19:37149789-37149811 CATCATTCCATTGTGCCTTGGGG 0: 1
1: 0
2: 2
3: 17
4: 152
1165610689_1165610705 30 Left 1165610689 19:37149737-37149759 CCAGCTTGTGGTCTCCTGAGATC 0: 1
1: 0
2: 0
3: 16
4: 281
Right 1165610705 19:37149790-37149812 ATCATTCCATTGTGCCTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 125
1165610689_1165610694 4 Left 1165610689 19:37149737-37149759 CCAGCTTGTGGTCTCCTGAGATC 0: 1
1: 0
2: 0
3: 16
4: 281
Right 1165610694 19:37149764-37149786 GATCATCCCTGGCCCACCCTGGG 0: 1
1: 0
2: 0
3: 34
4: 194
1165610689_1165610701 27 Left 1165610689 19:37149737-37149759 CCAGCTTGTGGTCTCCTGAGATC 0: 1
1: 0
2: 0
3: 16
4: 281
Right 1165610701 19:37149787-37149809 TCCATCATTCCATTGTGCCTTGG 0: 1
1: 0
2: 1
3: 19
4: 150
1165610689_1165610703 28 Left 1165610689 19:37149737-37149759 CCAGCTTGTGGTCTCCTGAGATC 0: 1
1: 0
2: 0
3: 16
4: 281
Right 1165610703 19:37149788-37149810 CCATCATTCCATTGTGCCTTGGG 0: 1
1: 0
2: 0
3: 23
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165610689 Original CRISPR GATCTCAGGAGACCACAAGC TGG (reversed) Exonic
900089402 1:913281-913303 GAGCTCTGGGGACCCCAAGCCGG - Intergenic
900767839 1:4517430-4517452 GATTTCAGGGAACCACAAGTGGG - Intergenic
904551827 1:31325215-31325237 GCTCTCAGGAGACCCAAAGTAGG - Intronic
904732660 1:32606628-32606650 GCTCTCAGGAGACCTGAAGTGGG + Intronic
904777019 1:32915955-32915977 GATCTCACGGGACCACAATGTGG - Intergenic
905600585 1:39246837-39246859 GCTCTCATGAGTCCATAAGCTGG - Intronic
906685919 1:47763256-47763278 GATCTCTGAGGACCACCAGCTGG - Exonic
907899338 1:58723202-58723224 CATGTAAGGACACCACAAGCAGG - Intergenic
908745551 1:67372828-67372850 GATGTCAGGAAAACACAAGGAGG + Intronic
909197826 1:72649185-72649207 GCTCTCAGGAGACCTAAAGCTGG - Intergenic
911025729 1:93434200-93434222 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
911935136 1:103960509-103960531 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
912062115 1:105686645-105686667 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
912094506 1:106121492-106121514 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
916963776 1:169914656-169914678 GCTCTCAGAAGACAAAAAGCGGG - Intergenic
919302798 1:195791404-195791426 GTTCTCAGGAGACCCGAAGTAGG - Intergenic
921334573 1:214073488-214073510 GATCTCAAGAGACCAAAAGGGGG + Intergenic
921674649 1:217964790-217964812 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
921766891 1:218983105-218983127 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
922141640 1:222893957-222893979 GTTCTCAGGAGACCCGAAGTGGG + Intronic
923051393 1:230393346-230393368 GAACACAGGAGACCACTGGCGGG + Intronic
924710692 1:246527910-246527932 GGTCTCAGCAGATCACAAGATGG + Intergenic
1063620050 10:7638209-7638231 GAATTCAGGACACCACAAGATGG + Intronic
1065852965 10:29805991-29806013 TATCCCAGGAGACCTCCAGCAGG + Intergenic
1066044956 10:31586848-31586870 TATTTCAGGGGGCCACAAGCTGG - Intergenic
1066308373 10:34170172-34170194 GATCTCTTGAGCCCAGAAGCTGG - Intronic
1067258667 10:44667038-44667060 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1068130531 10:52889988-52890010 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1068137466 10:52965080-52965102 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1068290972 10:55001197-55001219 GCTCTCAGGAGACCCGAAGTGGG - Intronic
1068919281 10:62465653-62465675 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1069561738 10:69435601-69435623 GCTCTCAGGAGACCTAAAGTGGG + Intergenic
1070201141 10:74207507-74207529 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1071052970 10:81473618-81473640 GCTCTCAGGAGACAAAAAGTGGG - Intergenic
1071166751 10:82816335-82816357 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1071819318 10:89264322-89264344 GCTCTCAGGAGACCCAAAGTGGG + Intronic
1074949920 10:118323175-118323197 GATCACAGGACTCAACAAGCTGG - Intronic
1075092554 10:119451858-119451880 AATGTCAGGAGACTATAAGCAGG + Intronic
1075132049 10:119748561-119748583 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1077056493 11:596534-596556 GCTGTCAGGATACCACAGGCTGG + Intronic
1078112399 11:8407834-8407856 GAGCTCAGCAAACCCCAAGCAGG + Intronic
1079503911 11:21132957-21132979 GCTCTCAGGAGACCCGAAGTAGG + Intronic
1081280625 11:41205378-41205400 GATTTCAGGAGCCCCCAAGTTGG - Intronic
1081767322 11:45620758-45620780 GCTCTCAGGAGACCAAAAGTGGG + Intergenic
1082965113 11:58959203-58959225 GATTTCAGGAGCCCACCAACAGG + Intronic
1083661951 11:64255553-64255575 GTTCTCAGCAGACAAGAAGCGGG + Exonic
1085403979 11:76250835-76250857 GCTCTCAGGAGACCTGAAGTAGG - Intergenic
1086988760 11:93279457-93279479 CATCACAGGAGTTCACAAGCAGG + Intergenic
1087755167 11:102047547-102047569 GCTCTAAGGAGATCACCAGCCGG + Exonic
1087806252 11:102558646-102558668 GACCTCAGGACTCCCCAAGCTGG + Intergenic
1089849487 11:121483947-121483969 GCTGTCAGGAGCCCTCAAGCAGG + Intronic
1091594491 12:1867191-1867213 AATCTCAGCAAACCCCAAGCAGG - Intronic
1091757149 12:3061340-3061362 GATCGCAGGAGACTATAATCAGG - Intergenic
1092070197 12:5625769-5625791 GAGCACAGAAGACCAGAAGCAGG - Intronic
1092418067 12:8307346-8307368 GATCTCAGGGGACCACAGCAAGG - Intergenic
1092851976 12:12637652-12637674 AATCTCAGCAGAACTCAAGCAGG + Exonic
1093502392 12:19827803-19827825 GCTCTCAGGAGACCCAAAGAGGG + Intergenic
1093866509 12:24233813-24233835 GATCCCAGGAGAGAACAAGCTGG + Intergenic
1096355483 12:50937717-50937739 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1097360756 12:58655941-58655963 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1099049724 12:77768002-77768024 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1101084340 12:101220410-101220432 GATCCCATGAGGCCAAAAGCAGG + Intergenic
1101866329 12:108523207-108523229 TATCTCAGGACACCACATCCTGG + Exonic
1103607403 12:122097531-122097553 GATCTCTTGAGACCAGAAGTTGG + Intronic
1103900707 12:124302443-124302465 GATCCCAGGAGACCCCGAGTGGG - Intronic
1105901460 13:24757982-24758004 GATCTCATGAGAACACTATCAGG - Intergenic
1106253472 13:28001615-28001637 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1107841206 13:44459422-44459444 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1108249644 13:48551485-48551507 GTTCTCAGGAGACCCTAAGTGGG - Intergenic
1109780816 13:67107599-67107621 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1111243775 13:85508604-85508626 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1111268121 13:85845848-85845870 GAGCTCGGGAAACCCCAAGCAGG - Intergenic
1111268875 13:85854058-85854080 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1111595433 13:90404474-90404496 GCTCTCAGGAGACCCGAAGTGGG - Intergenic
1111920179 13:94402119-94402141 GCTCTCAGGAGAACACAGGTGGG + Intronic
1112552015 13:100430198-100430220 GATCTCAGCTCACCACAACCCGG - Intronic
1113518512 13:110921332-110921354 GATGTCAGGAAACCACCTGCGGG - Intergenic
1116159715 14:41253370-41253392 GCTCTCAGGAGACCGGAAGTGGG + Intergenic
1116617312 14:47155158-47155180 GGTCTCAGGAGACCTGAAGTGGG - Intronic
1116789952 14:49329669-49329691 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1116961696 14:50973723-50973745 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1117953907 14:61108172-61108194 CATCTCAGGAGCCCAGATGCGGG - Intergenic
1118393127 14:65313099-65313121 GATCTCAGGAGAACTCTATCAGG - Intergenic
1119269755 14:73292269-73292291 GATCACTTGAGACCACAAGTTGG - Intronic
1119307065 14:73616030-73616052 GATCACAGGTCACCACAAACTGG + Intronic
1119972495 14:78987220-78987242 GTTCTCAGACGACCACAACCTGG - Intronic
1120592352 14:86390853-86390875 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1122364785 14:101188211-101188233 GATCTCTGGAGAGCAGAAGAGGG - Intergenic
1122850426 14:104525283-104525305 GATCTCATGAGACCAGTAACGGG - Intronic
1123410647 15:20056227-20056249 GGGCTCAGGACATCACAAGCGGG - Intergenic
1123519977 15:21062933-21062955 GGGCTCAGGACATCACAAGCGGG - Intergenic
1126430297 15:48576473-48576495 GATCCCAACAGACCATAAGCTGG + Intronic
1128799281 15:70487241-70487263 GAGGCCAGGAAACCACAAGCAGG + Intergenic
1129452730 15:75659844-75659866 GACCTCAGGATACCAGGAGCAGG - Exonic
1130920939 15:88344083-88344105 GATCTCATGAGAACAGCAGCAGG + Intergenic
1131605651 15:93900456-93900478 GCTCTCAGTAGACCTGAAGCAGG + Intergenic
1132009589 15:98264561-98264583 AATCTCAGAGAACCACAAGCAGG + Intergenic
1132155068 15:99489901-99489923 GAACTCAGCAAACCCCAAGCAGG - Intergenic
1133695432 16:8258387-8258409 CAACTCTGCAGACCACAAGCTGG - Intergenic
1134321407 16:13167621-13167643 GATCTCATGAGAACACTATCAGG - Intronic
1135986836 16:27190115-27190137 GCTCTCAGGAGACCAGAAGTGGG - Intergenic
1138925065 16:61581115-61581137 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1138998261 16:62478394-62478416 GCTCTCAGGAGACCTGAAGTTGG - Intergenic
1139148035 16:64345862-64345884 GTTCTCAGGGGACCAGAAGAGGG - Intergenic
1139151006 16:64381686-64381708 GATCTCAGGAGACCCGAAATGGG - Intergenic
1139639938 16:68284105-68284127 ACTCTCAGGGGACCACATGCCGG - Intronic
1140804398 16:78519740-78519762 CATGTGAGGAGCCCACAAGCAGG + Intronic
1141748814 16:85944718-85944740 GATCCCAGTAGACCACAAAGTGG - Intergenic
1143544883 17:7590013-7590035 GAACTCCGGAGACCACAAAGGGG - Exonic
1146591496 17:34131600-34131622 GCTGTCAGCAGACCACAAGCTGG - Intronic
1149169490 17:53792433-53792455 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1149660320 17:58331389-58331411 GATCTTAGGAAGCCACAAGGAGG - Intergenic
1150868647 17:68880299-68880321 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1155680822 18:28483538-28483560 GATCTAAGGGGCCCACAGGCAGG - Intergenic
1157151968 18:45227457-45227479 GATCTCACCAGACCAAATGCTGG - Intronic
1158691359 18:59664115-59664137 GAACTCAGCAGCCCACAACCTGG - Intronic
1158699595 18:59734272-59734294 GATCCCAGGAGCCCACATTCTGG - Intergenic
1160083537 18:75753552-75753574 GGTCTCAGGAGACCTAAAGTGGG + Intergenic
1162716933 19:12640164-12640186 GATCTCAGGAGAGCCCATGATGG + Intergenic
1162862901 19:13521232-13521254 GACCCCAGCAGACCACAAGGGGG - Intronic
1165610689 19:37149737-37149759 GATCTCAGGAGACCACAAGCTGG - Exonic
1168454321 19:56494187-56494209 GATCGCAGGAGAGCACAGACTGG + Intergenic
927662285 2:25003126-25003148 GACCTCAGAAGAACACAAGTTGG + Intergenic
928427351 2:31190068-31190090 GAGCTCAGAAGACCAAAATCAGG + Intronic
928823464 2:35391406-35391428 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
929847082 2:45541552-45541574 GCTCTCAGAAGACCCAAAGCGGG + Intronic
930197387 2:48523067-48523089 GATTACAGGAGTGCACAAGCAGG - Intergenic
930313585 2:49771596-49771618 GCTCTCAGGAGACCTAAAGTGGG + Intergenic
930914670 2:56672358-56672380 GTTATCAGGAGACCTGAAGCTGG - Intergenic
932081696 2:68721694-68721716 GATTTCAGGAGAGTAGAAGCTGG + Intronic
932585573 2:73025966-73025988 GCTCTGAGGACACCACAGGCAGG + Intronic
933042632 2:77487885-77487907 GGTCTCAGGAGACCCGAAGTGGG - Intronic
933420888 2:82043698-82043720 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
933454955 2:82508393-82508415 GTTCTCAGGAGACCCAAAGTCGG - Intergenic
933606485 2:84389621-84389643 GCTCTCAGGAGACCCAAAGTTGG + Intergenic
935337797 2:102033479-102033501 GCTTTCAGGAGTGCACAAGCTGG - Intergenic
935383503 2:102477838-102477860 GAGCTCAGGAGACCACCACAGGG - Intronic
937370802 2:121296044-121296066 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
940008354 2:149030371-149030393 GAAGTCAGGAGTCCACAACCAGG - Intergenic
940956916 2:159738526-159738548 GCTCTCAGGAGACCCAAAGTGGG + Intronic
943064147 2:183069466-183069488 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
943179391 2:184524321-184524343 GCTCTCAGGAGACCCCAAATGGG + Intergenic
943191652 2:184685569-184685591 GCTCTCAGGAGACTAAAAGTGGG + Intronic
943932212 2:193868482-193868504 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
945007902 2:205428885-205428907 GATATCTAGAGACCACAATCTGG - Intronic
945721370 2:213421936-213421958 GCTCTCAGGAGACCCAAAGTGGG - Intronic
947865959 2:233397902-233397924 GAGCTCAGGAGTCCAGAAGAGGG + Intronic
948334890 2:237200212-237200234 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1169598447 20:7227734-7227756 GAACTCAGGAGACAGCAAACAGG - Intergenic
1172687615 20:36768319-36768341 GATCACTTGAGACCACGAGCTGG + Intronic
1173676329 20:44838889-44838911 GTTCTCAGGAGCACACAAACTGG + Intergenic
1174318101 20:49718455-49718477 AATCTCAGGAGAGCACAGGTTGG + Intergenic
1175138610 20:56843114-56843136 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1175326412 20:58131617-58131639 GTCCTCAGGAGACCACAGGAAGG + Intergenic
1178947416 21:36959729-36959751 GCTCTCAGGAGACCTGAAGTGGG - Intronic
1179346561 21:40563277-40563299 GATCTCAGGTGACTTCAAGCTGG - Intronic
1179413607 21:41180474-41180496 GATCTAAGGAGCCCAGAGGCAGG + Intronic
1180658041 22:17441021-17441043 GATCTCAGCTTACCACAACCCGG + Intronic
1180747956 22:18104566-18104588 GATGTCACGAGGCCACAGGCTGG + Exonic
1181464506 22:23103643-23103665 GCTAACACGAGACCACAAGCTGG + Intronic
1181843824 22:25689798-25689820 GTTCTCAGAAGCCCAGAAGCTGG + Intronic
1182942247 22:34287856-34287878 GATCTCCGGAGAGCACAAAGAGG - Intergenic
1185403306 22:50629805-50629827 GAACCCAGGAGCCGACAAGCTGG + Intergenic
950882670 3:16335872-16335894 GGTCTCAGGAGGCCACAGGCAGG + Intronic
951462385 3:22965202-22965224 GATCAAAGGAAACCACAAGATGG - Intergenic
951752808 3:26055926-26055948 TATCCCAGGTGACCACATGCAGG - Intergenic
953616813 3:44498086-44498108 GATCTCAGAAGCTTACAAGCTGG + Intergenic
953956660 3:47236718-47236740 GAAGACAGGAGACCACAGGCAGG + Intronic
954472387 3:50708615-50708637 GATCTCAGGAGCCCACACAATGG - Intronic
957156531 3:76551360-76551382 GCTCTCAGGAGACCTGAAGTGGG - Intronic
957459359 3:80497146-80497168 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
957579521 3:82052868-82052890 GATCTGAGGATACCAGAAGCTGG - Intergenic
958714344 3:97762303-97762325 GATCTCCGGAGGCCAGAAGTTGG - Intergenic
959252575 3:103966458-103966480 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
959897139 3:111617635-111617657 GCTCTCAGGAGACCTGAAGTGGG - Intronic
960156506 3:114301965-114301987 GATGTAAGGACACCACAAGGAGG + Intronic
960993631 3:123327354-123327376 GACATCAGAAGTCCACAAGCTGG - Intronic
964075137 3:152684197-152684219 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
965599014 3:170436896-170436918 GTTCTGAAGAGACCACATGCAGG + Intronic
968038550 3:195569183-195569205 AATCTCAGGACAACACAAGAAGG + Intronic
968142908 3:196273495-196273517 GCCCTCAGGAGACCCCAAGCGGG + Intronic
968663562 4:1809072-1809094 CACCTCAGGAACCCACAAGCTGG - Intergenic
969179275 4:5424622-5424644 GCTCTCAGGAGACCTGAAGTGGG - Intronic
969388434 4:6872605-6872627 AAGCCCAGGAGACCACAATCTGG - Intronic
970484685 4:16513167-16513189 GAGCTCAGAGGACCAAAAGCAGG - Intronic
971834600 4:31747726-31747748 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
974023484 4:56711813-56711835 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
974432619 4:61817552-61817574 GCTCTCAGGAGACCTGAAGTGGG - Intronic
975023598 4:69521092-69521114 GCTCTCAGGAGACCCTAAGTGGG - Intronic
975299772 4:72775626-72775648 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
976347341 4:84019731-84019753 GTTTTCAGTAGACTACAAGCAGG + Intergenic
979637832 4:122977790-122977812 GCTCTCAGGAGACCTGAAGTGGG + Intronic
979647944 4:123093752-123093774 GATCTAAGGAGCCCAACAGCAGG + Intronic
981889162 4:149715731-149715753 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
982435863 4:155383258-155383280 GACCTCAGCAGATCACAAGATGG - Intergenic
984375381 4:178922596-178922618 GTTCTCAGGAGACCCAAAGTGGG - Intergenic
984763855 4:183384687-183384709 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
985775449 5:1839137-1839159 GATCCCAGGAGAACAGAAGAGGG - Intergenic
985947285 5:3196105-3196127 GAACTCAGGAGAGCAAAAGGTGG - Intergenic
987168068 5:15221506-15221528 CATCTCAGGAGAGCACTACCAGG + Intergenic
988346398 5:30042464-30042486 GTTCTCAGGAGACCTGAAGTGGG - Intergenic
989537650 5:42582465-42582487 GTTCTCAGGAGACCTGAAGTGGG - Intronic
989730422 5:44641582-44641604 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
990952933 5:61316131-61316153 GATCTCAGGTCACTGCAAGCGGG + Intergenic
991039626 5:62162266-62162288 GCTCTCAGGAGACCCAAAGAGGG + Intergenic
992491279 5:77247186-77247208 GATCTCAGGAGCCAACCAGAAGG - Intronic
994082144 5:95718867-95718889 GGTCCCAGGAGAGCACAAGCAGG + Intronic
994692322 5:103034309-103034331 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
995927058 5:117386754-117386776 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
997847269 5:137298256-137298278 GCTCTCAGGAGACCCCATTCTGG - Intronic
998421405 5:141990568-141990590 GAGCTCAGGAGTTCACAACCTGG - Intergenic
998770813 5:145542939-145542961 GAGTTCAGGAGACTAAAAGCAGG - Intronic
1000854192 5:166379096-166379118 GCTCTCAGGAGACTGCAAGTGGG + Intergenic
1001337833 5:170815160-170815182 GATTACAGTAGACCTCAAGCTGG + Intergenic
1003700632 6:8461138-8461160 AATCTCAGGAAACCATCAGCAGG - Intergenic
1005217330 6:23546481-23546503 GATCTCAGGAGAGAACCAACTGG + Intergenic
1005566992 6:27106120-27106142 GATCACTCGAGATCACAAGCTGG + Intergenic
1005594768 6:27368525-27368547 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1006766205 6:36509235-36509257 GCTCTCAGGAGACCCAAAGTGGG + Intronic
1007749773 6:44064752-44064774 GATCACAGGAGATCACAGGAGGG + Intergenic
1008691076 6:53979647-53979669 TATCTCAGGATACCACCAGATGG + Intronic
1008954044 6:57195389-57195411 AATATCAGGAGTCCACAACCAGG - Intronic
1010559690 6:77333858-77333880 GTTCTCAGGAGACCTGAAGTGGG - Intergenic
1012100858 6:95084217-95084239 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1012709598 6:102582268-102582290 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1013277346 6:108598433-108598455 GAACTGAGGCAACCACAAGCAGG + Intronic
1013438539 6:110138542-110138564 GCTCTCAGGACACCGGAAGCGGG + Intronic
1013471204 6:110468051-110468073 GCTATCAGGACACCACAGGCTGG + Intronic
1014227118 6:118861540-118861562 GCTCTCAGGAGACCCGAAGTGGG + Intronic
1014384766 6:120786469-120786491 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1014418704 6:121214912-121214934 GCTCTCAGGAGACCAGAAGTGGG + Intronic
1015036330 6:128659473-128659495 GATGTTAGGAGACCACAAACAGG + Intergenic
1015189357 6:130456454-130456476 GAATTTTGGAGACCACAAGCAGG + Intergenic
1016163258 6:140907848-140907870 GCTCTCAGGAGACCCAAAGTGGG + Intergenic
1017587977 6:155947588-155947610 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1017842097 6:158230917-158230939 GATCCCTGGAGACCAGGAGCTGG - Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1019024163 6:168943234-168943256 GACCTCAGGAGAACCCAAGGAGG + Intergenic
1021431096 7:20559926-20559948 GCTCTCAGGAGACCTAAAGCGGG + Intergenic
1021677715 7:23097739-23097761 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1021879672 7:25082504-25082526 GATCTCAGGAGAACTCTAACAGG + Intergenic
1021894759 7:25223362-25223384 GGTCTTAGCAAACCACAAGCAGG - Intergenic
1022186750 7:27976667-27976689 GCTCTCAGAAGACCATAAACAGG + Intronic
1023059817 7:36316272-36316294 GAGCTCAGGAAAACAGAAGCAGG - Intergenic
1023300531 7:38766184-38766206 AACCTCAGGAGACGAGAAGCAGG + Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024857000 7:53794224-53794246 GTTCTCAGGAGACCCAAAGTGGG + Intergenic
1026391989 7:69911583-69911605 GCTCCCAGGAGACCTCAAGTGGG + Intronic
1026996830 7:74622542-74622564 GATCTCTTGAGCCCACAAGTTGG + Intergenic
1028136809 7:87230926-87230948 GCTCTCAGGAGACCCGAAGTGGG - Intergenic
1029533103 7:101138406-101138428 GGTCTCAGGCGGCCACAAGGTGG - Exonic
1030468108 7:109927920-109927942 GATCTCTTGAGACCAGAAGTTGG + Intergenic
1031754371 7:125619082-125619104 GATCCCAGGAGACCAAAAGATGG - Intergenic
1034101759 7:148456980-148457002 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1036370177 8:8155765-8155787 GATCTCAGGGGACCAGAGGAAGG + Intergenic
1036621869 8:10429574-10429596 GATCTCAGGAGACCTCCTTCAGG + Intergenic
1036880715 8:12509866-12509888 GATCTCAGGGGACCAGAGGAAGG - Intergenic
1036907684 8:12720770-12720792 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1037657635 8:20899265-20899287 AATCTCAGAAAACCTCAAGCAGG - Intergenic
1038139422 8:24826955-24826977 GAGCTCAGGTGCTCACAAGCCGG + Intergenic
1038282896 8:26181857-26181879 CATGTCAGGACACCACAAGAAGG + Intergenic
1038884770 8:31651074-31651096 GTTCTCAGGAGAACACATGTGGG + Intronic
1041011361 8:53547151-53547173 CAAATGAGGAGACCACAAGCAGG + Intergenic
1043180538 8:77082605-77082627 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1043798600 8:84578562-84578584 GCTCTCAGGAGACCTGAAGTGGG + Intronic
1045300684 8:100907902-100907924 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1046195772 8:110860978-110861000 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1047543904 8:125797266-125797288 GCTCTCAGGAGACCTGAAGTAGG + Intergenic
1047707821 8:127518586-127518608 AAGCTCAGCAAACCACAAGCTGG + Intergenic
1047806986 8:128371196-128371218 GATCTCTTGAGTCCAGAAGCTGG - Intergenic
1048547897 8:135404370-135404392 GCTCTCAGGAGACCTGAAGTGGG + Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049140530 8:140950066-140950088 GCTCTCAGGAGACCCAAAGTGGG - Intronic
1049426512 8:142540318-142540340 GTTCACAGGAGACCCCAAGGGGG - Intronic
1049750297 8:144279902-144279924 GATCTCAGGTGAGCACAGCCGGG - Intronic
1050289856 9:4142514-4142536 GAACACAGGAGACCACATCCTGG - Intronic
1052691496 9:31821314-31821336 GTTCTCAGGAGACCTGAAGTGGG - Intergenic
1055680782 9:78712787-78712809 TGTCTCAGGAGACCACAAAGTGG + Intergenic
1055816571 9:80213366-80213388 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1056321668 9:85440927-85440949 GATCTCAGCAGGCTACAATCAGG - Intergenic
1058194536 9:101956540-101956562 GATCTAAGGTGACCAAAGGCAGG - Intergenic
1059104853 9:111502160-111502182 GCTCTCAGGAGACCTGAAGTGGG - Intergenic
1060618842 9:125044524-125044546 GCTCTCAGGAGACCCCTAGTAGG - Intronic
1061743196 9:132722287-132722309 GCTCTCAGGAGACCCGAAGTGGG + Intergenic
1061967802 9:134025804-134025826 GATGTCAGGAGAAAACAAACAGG - Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1185963074 X:4567043-4567065 GATCACGGGAGACCACTTGCAGG - Intergenic
1188194974 X:27222373-27222395 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1188434940 X:30148909-30148931 GTTCTCAGGAGACCAGAAGTGGG - Intergenic
1194212248 X:91082909-91082931 GTTCTCAGGAGACCCAAAGTGGG - Intergenic
1197035718 X:121870833-121870855 GCTCTCAGGAGACCCAAAGTGGG - Intergenic
1197174878 X:123474854-123474876 GAATCCAGGAGACCACCAGCTGG + Intronic
1200749123 Y:6928932-6928954 GCTCTCAGGAGACCTAAAGTGGG + Intronic
1200977316 Y:9227074-9227096 GATCTCAGGAGACACAAAGTGGG + Intergenic
1201855625 Y:18537345-18537367 GCTCTCAGGAGACAGAAAGCAGG - Intergenic
1201877696 Y:18783040-18783062 GCTCTCAGGAGACAGAAAGCAGG + Intronic
1202133496 Y:21635817-21635839 GATCTCAGGATACAAAAAGTGGG - Intergenic