ID: 1165616035

View in Genome Browser
Species Human (GRCh38)
Location 19:37201409-37201431
Sequence CTACTTTATCAAATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165616035 Original CRISPR CTACTTTATCAAATGGAGCT GGG (reversed) Intronic
902187756 1:14738146-14738168 GTCATTTATCACATGGAGCTGGG - Intronic
904958558 1:34310776-34310798 CGAATTTATTAAATGGCGCTGGG + Intergenic
906637410 1:47418389-47418411 CTCCTTTATCCATGGGAGCTGGG - Intergenic
906983535 1:50657351-50657373 CTACTGTATCAAATGAAGTTAGG + Intronic
907649511 1:56281377-56281399 CTTATTTAACAAATGGTGCTGGG - Intergenic
909482755 1:76143146-76143168 GTACTTAATGAAATGGATCTTGG + Intronic
909778186 1:79510450-79510472 CTACTTTATCAAAACAAACTTGG + Intergenic
911800793 1:102135043-102135065 CCTATTTAACAAATGGAGCTGGG + Intergenic
913524096 1:119674699-119674721 TTACTTTTACAAATGTAGCTTGG - Intronic
915787420 1:158630403-158630425 CTTCTTTAACAAATAGTGCTGGG + Intronic
917645169 1:177022587-177022609 TTATACTATCAAATGGAGCTGGG - Intronic
919541566 1:198853039-198853061 CTACTTCAACAAATGGTGTTGGG + Intergenic
920425446 1:205871617-205871639 GTACTTTAACAACTGGAACTGGG - Intergenic
920812950 1:209304215-209304237 CTACCTTCTCCAATGGAACTGGG - Intergenic
920866485 1:209757885-209757907 CTCATTTATAAAATGGGGCTAGG - Intronic
921249892 1:213287507-213287529 CAACTTTATGAAATGGACTTGGG + Intergenic
921919160 1:220646812-220646834 CTATTTTAACAAATTGTGCTGGG + Intronic
922684948 1:227631942-227631964 GTACTTTAACAACTGGAACTAGG - Intronic
924887394 1:248233973-248233995 CTTCTTTATCCAAGGGAGCCAGG - Intergenic
1063914084 10:10863511-10863533 CTTATCTATCAAATGGGGCTAGG + Intergenic
1065018079 10:21479877-21479899 GCACTTTATCACATGCAGCTGGG - Intergenic
1065317053 10:24473471-24473493 CTTCTTTCTAAAATGGCGCTTGG - Exonic
1066619583 10:37331514-37331536 CCTCTTCATCAAATGGTGCTTGG + Intronic
1066673842 10:37867245-37867267 TTACATGATCACATGGAGCTTGG - Intergenic
1066704584 10:38164344-38164366 CTACATTCTCACATGGAGGTAGG - Intergenic
1067126431 10:43519849-43519871 TGACTTTACCAAATGGAGTTAGG - Intergenic
1068640570 10:59400940-59400962 CTATTTAAACAAATGGTGCTGGG - Intergenic
1071881791 10:89907030-89907052 CTATTTGATAAAATGGTGCTGGG - Intergenic
1071900355 10:90114308-90114330 CTTATTTAACAAATGGTGCTGGG - Intergenic
1072124478 10:92433439-92433461 CTATTTTATCAAAGTGAACTAGG + Intergenic
1072953057 10:99865025-99865047 CTAATTTAATAAATGGTGCTGGG - Intergenic
1073893578 10:108127604-108127626 ATAATTTATAAAAAGGAGCTGGG + Intergenic
1074970400 10:118531677-118531699 CTAACTTATCAAAGGGAGCCAGG + Intergenic
1075536241 10:123274677-123274699 ATACTTCATCAAATGCAGCCTGG - Intergenic
1078870419 11:15339094-15339116 CTATTCTAACAAATGGAGCATGG - Intergenic
1078991814 11:16655338-16655360 CAACTTTATTAAATGAAACTGGG + Intronic
1079324480 11:19479870-19479892 CTTCTTTTTCAACTGGAGGTGGG - Intronic
1079934048 11:26596418-26596440 GTACTTTAACAACTGGAACTGGG - Intronic
1081070378 11:38603215-38603237 GTACTTTAACAACTGGAACTGGG + Intergenic
1081979137 11:47255300-47255322 GTTCTCTGTCAAATGGAGCTCGG + Intronic
1082754630 11:57062362-57062384 CTTCTTTAATAAATGGTGCTGGG + Intergenic
1084803217 11:71560036-71560058 GTACTTCAACAAATGGTGCTGGG + Intronic
1086050205 11:82580408-82580430 CTTCTTTAATAAATGGTGCTGGG + Intergenic
1087442511 11:98204746-98204768 CCACTTCAACAAATGGTGCTGGG + Intergenic
1087878483 11:103387734-103387756 CTATTTTAATAAATGGTGCTGGG - Intronic
1091023420 11:132121472-132121494 TTACTTAAATAAATGGAGCTGGG - Intronic
1091101265 11:132875983-132876005 CTATTTTAACAAATGAAACTTGG + Intronic
1092048631 12:5451986-5452008 CTTATTTATAAAAGGGAGCTGGG - Intronic
1092293816 12:7182364-7182386 GTACTTTAACAACTGGAACTCGG + Intergenic
1092684928 12:11032285-11032307 CTAAATTCTCAAAGGGAGCTTGG + Intronic
1092689606 12:11093177-11093199 CTAAATTCTCAAAGGGAGCTTGG + Intronic
1093319813 12:17700608-17700630 CTATTTAATAAAATGGTGCTGGG - Intergenic
1097644957 12:62225273-62225295 CTACTTTAGCAAATGGTGTTGGG + Intronic
1097660152 12:62421323-62421345 CCACTTCAACAAATGGTGCTGGG + Intergenic
1097942549 12:65327602-65327624 CTAATTTATACCATGGAGCTTGG + Intronic
1098824551 12:75278441-75278463 CTAATTTATCAAATTGACCATGG + Intronic
1098917311 12:76270960-76270982 CAACTTTATGATTTGGAGCTAGG + Intergenic
1099730405 12:86492555-86492577 CTATTTAATAAAATGGTGCTGGG + Intronic
1100106751 12:91184297-91184319 CTAATTTAGCAAATGTATCTTGG - Intergenic
1103080142 12:118017113-118017135 CTTCTTCGGCAAATGGAGCTGGG - Intronic
1106074427 13:26445451-26445473 CTCATTTATAAAATGGAGATGGG + Intergenic
1107443979 13:40453570-40453592 CTACTTTAACACAAGAAGCTTGG - Intergenic
1109220488 13:59636448-59636470 CTACTTCAACAGATGGAGGTTGG + Intergenic
1110394872 13:75018087-75018109 CTTATTTAACAAATGGTGCTGGG + Intergenic
1110504437 13:76269074-76269096 CCTATTTAACAAATGGAGCTGGG - Intergenic
1111663873 13:91243523-91243545 CTTACTTATCAAATGGAGGTAGG - Intergenic
1116302728 14:43206136-43206158 ATACTTTATTAAATGGTGTTGGG - Intergenic
1116437892 14:44914336-44914358 CAACTTTATCAAACGCATCTTGG - Intergenic
1119628341 14:76203223-76203245 TTTCTTTATCAAAGGGAGGTGGG + Exonic
1119865666 14:77971422-77971444 CTACATTTTCATTTGGAGCTCGG - Intergenic
1124570695 15:30860647-30860669 CTAGTATATAAGATGGAGCTTGG + Intergenic
1125685438 15:41560690-41560712 CAACCTTACCAAATGGAGCAGGG - Intronic
1126566317 15:50103990-50104012 CCAATTTAACAAATGGTGCTGGG + Intronic
1126604786 15:50465272-50465294 CTACTTTATCACATTTAGCTTGG - Intronic
1129152886 15:73700088-73700110 CTATTTTATACAAGGGAGCTAGG - Intronic
1130435165 15:83891110-83891132 CTACATTTTCAAATAGAACTGGG + Intronic
1130786987 15:87109516-87109538 CTTCTTTAATAAATGGTGCTTGG + Intergenic
1135224363 16:20642685-20642707 GTACTTTAACAACTGGAACTGGG + Intronic
1137080917 16:36052499-36052521 CTACTCTATCAAAAGGAGGGAGG - Intergenic
1137436447 16:48457867-48457889 CAACATTATGAAATGCAGCTGGG + Intergenic
1137753000 16:50880449-50880471 CTGCTTTAGAGAATGGAGCTTGG + Intergenic
1138926967 16:61604166-61604188 CTTATTTATTAAATGGTGCTGGG - Intergenic
1139012991 16:62656300-62656322 CTATTTTAGGAAATGGGGCTAGG + Intergenic
1139515399 16:67449704-67449726 CAGCTTTAGCAAATGGAACTGGG - Intronic
1143221797 17:5268127-5268149 CTTCTTCAACAAATGGTGCTGGG + Intergenic
1149967339 17:61178721-61178743 ATAATTTATCAAATAGAGGTGGG + Intronic
1150203494 17:63381178-63381200 ATACTTCGTCAAATGAAGCTTGG - Intronic
1153425490 18:4958756-4958778 CTTATTTAACAAATGGTGCTGGG + Intergenic
1155100871 18:22608473-22608495 CTACTTTCTCACAGGGAGATGGG + Intergenic
1155135971 18:22993210-22993232 TTTCTTTATCAAAAGAAGCTTGG - Exonic
1155467624 18:26155560-26155582 CCACTTCAATAAATGGAGCTGGG + Intronic
1156580789 18:38372386-38372408 CTAATCTGTGAAATGGAGCTGGG + Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158377670 18:56889255-56889277 CTATTTTAACAAATGGAGAGAGG + Intronic
1159453655 18:68634173-68634195 CCTCTTTAACAAATGAAGCTGGG - Intergenic
1160467503 18:79093837-79093859 CAACTTTATCTCATGGAGCGTGG + Intronic
1163208910 19:15825710-15825732 CTATTTTAAAAAATGGTGCTGGG + Intergenic
1165616035 19:37201409-37201431 CTACTTTATCAAATGGAGCTGGG - Intronic
1168091875 19:54091009-54091031 CTTTTTTATGAGATGGAGCTTGG + Intergenic
926649020 2:15321153-15321175 CTTATTTAACAAATGGTGCTTGG + Intronic
926951448 2:18247943-18247965 CTACTTTATAGAATGTGGCTAGG + Intronic
927386697 2:22542711-22542733 CTACTTTCTCAGATGCTGCTGGG + Intergenic
928347881 2:30517541-30517563 GTACTTTAACAACTGGAACTGGG + Intronic
928476235 2:31630214-31630236 GTACTTTAACAACTGGAACTGGG + Intergenic
928766693 2:34654871-34654893 CTTATTTAACAAATGGTGCTGGG + Intergenic
929039313 2:37728037-37728059 CTTATTTAACAAATGGTGCTGGG + Intronic
929339659 2:40799638-40799660 CCATTTTAACAAATGGTGCTGGG - Intergenic
930373119 2:50529973-50529995 CTACATTTTCAAATTGTGCTGGG - Intronic
930631352 2:53757927-53757949 GTACTTTAACAACTGGAACTGGG + Intronic
932293055 2:70599197-70599219 CAACATTTTCAAATGGTGCTGGG - Intergenic
934672218 2:96221960-96221982 GTACTTTAACAATTGGAACTGGG - Intergenic
935863171 2:107356490-107356512 CTGATTTATTAAGTGGAGCTTGG + Intergenic
936387523 2:112043634-112043656 GTACTTTAACAACTGGAACTGGG - Intergenic
936860047 2:117006027-117006049 CTTATTTAACAAATGGTGCTGGG + Intergenic
938158144 2:128958851-128958873 CTACTTTAACATATGGATTTAGG - Intergenic
939179732 2:138790129-138790151 CTTATTTAACAAATGGTGCTGGG - Intergenic
939759100 2:146152359-146152381 CTTATTTAACAAATGGTGCTGGG - Intergenic
940056902 2:149523031-149523053 CTTATTTATTAAATGGTGCTGGG - Intergenic
942341582 2:174954202-174954224 CTAATTCAACAAATGGTGCTGGG + Intronic
944004612 2:194889407-194889429 TTTATTTATCAAATGGTGCTGGG - Intergenic
944039585 2:195338690-195338712 GTACTTTAACAAACGGAACTAGG - Intergenic
944361174 2:198859020-198859042 CCTCTTTAACAAATGGTGCTAGG + Intergenic
944608399 2:201374528-201374550 CTATTTAATAAAATGGTGCTGGG + Intergenic
945378148 2:209104128-209104150 CCTATTTAACAAATGGAGCTGGG + Intergenic
946750047 2:222885176-222885198 CTACTTTATTAAATGGCCCAAGG - Intronic
947002595 2:225474042-225474064 CTTATTTAACAAATGGTGCTGGG - Intronic
948810730 2:240476250-240476272 CCTCTTTAGCAAATGGCGCTTGG + Intergenic
1171422663 20:25028525-25028547 CCTCTTTAGCAAATGGCGCTGGG + Intronic
1173801201 20:45895606-45895628 CTACGTAATGAAATGGGGCTGGG - Intronic
1175658366 20:60791650-60791672 CTCCTTTAGCAGGTGGAGCTGGG + Intergenic
1178729243 21:35083901-35083923 CTACTTTGACCAATGGAGTTTGG + Intronic
1178946462 21:36952320-36952342 CTAATTTATAAAATGGAGCTCGG + Intronic
1181445671 22:22971902-22971924 CTATTTTTTAAAATGGTGCTGGG + Intergenic
949649567 3:6140623-6140645 GTACTTTATCAAATGGAATTTGG + Intergenic
949687534 3:6593016-6593038 CTAATTTACAAAATGGACCTTGG + Intergenic
951548277 3:23851123-23851145 CTTTTTTATCAAATGGTGTTGGG - Intronic
954980292 3:54739621-54739643 CCTCCTTATCAACTGGAGCTGGG + Intronic
956619425 3:71206041-71206063 CTTATTAAACAAATGGAGCTGGG - Intronic
956829735 3:73034460-73034482 CATAGTTATCAAATGGAGCTAGG - Intronic
957341742 3:78907579-78907601 CTTGTTTATCAAATGTAACTAGG - Intronic
960020095 3:112940077-112940099 CTTCTTTAATAAATGGCGCTGGG + Intronic
960510065 3:118539471-118539493 CTATTTTAACAAATGGTGATAGG - Intergenic
963380799 3:144527466-144527488 CTACTTTTCCAAATGTGGCTTGG - Intergenic
963545991 3:146658891-146658913 CTCCATGATCAAATGGAGGTGGG - Intergenic
964925035 3:161945230-161945252 CTTCTTTAATAAATGGTGCTGGG - Intergenic
965128937 3:164669620-164669642 CTAATTTAACAAATGGTGTTGGG + Intergenic
966492015 3:180538457-180538479 CTTATTTAACAAATGGTGCTGGG - Intergenic
966800473 3:183759026-183759048 ATAATTTTTCAAATGGAGATGGG + Intronic
968391411 4:196111-196133 GTACTTTAACAACTGGAACTGGG - Intergenic
970015427 4:11507447-11507469 GCACTTTATTAAATGGATCTGGG - Intergenic
970856638 4:20656736-20656758 CTTATTCATCAAATGGTGCTGGG + Intergenic
972179354 4:36444241-36444263 GTACTTTACCAACTGGAACTGGG + Intergenic
973122558 4:46540639-46540661 CTAATTTATGACATGGAGTTAGG - Intergenic
973546220 4:51984594-51984616 CTTATTTAACAAATGGCGCTGGG - Intergenic
974520160 4:62972615-62972637 GTACTTTAACAACTGGAACTGGG + Intergenic
975158475 4:71098257-71098279 CTATTTAATAAAATGGTGCTGGG - Intergenic
976083266 4:81380000-81380022 CTATTTTAACAAATGGAGGTGGG + Intergenic
976189555 4:82475180-82475202 GTACTTTAACAACTGGAACTGGG + Intergenic
977385320 4:96331950-96331972 CTATTTTATAAAATGGGGCTAGG + Intergenic
977587212 4:98787000-98787022 CTCCTTTATCAAATGGAAGCAGG + Intergenic
977588987 4:98805804-98805826 CTTATTTAACAAATGGTGCTGGG + Intergenic
977618247 4:99108705-99108727 GTACTTTAACAACTGGAACTGGG - Intergenic
978912940 4:114086558-114086580 ATACTTAATCTAATGGAGCCAGG - Intergenic
979420930 4:120504078-120504100 CAAATTTATAAAATGGAGTTTGG + Intergenic
980444019 4:132883636-132883658 GTACTTTAACAACTGGAACTGGG + Intergenic
980524606 4:133973187-133973209 CTTGTTTATGAAATGGAGCAGGG + Intergenic
982510340 4:156274938-156274960 CTACTTTAGCAAAATGTGCTTGG - Intergenic
984377524 4:178952112-178952134 CTTCTTCAACAAATGGTGCTGGG + Intergenic
985439350 4:189968594-189968616 CTTATTTAACAAATGGTGCTGGG + Intergenic
986025831 5:3850112-3850134 ATACTTTGTCAAATGGAATTGGG - Intergenic
986232885 5:5883308-5883330 CTTCTTTTTCAGATGGAGCTTGG - Intergenic
986627815 5:9739094-9739116 CTGCTTTATTAATGGGAGCTTGG + Intergenic
988319374 5:29672376-29672398 CTACATCATCAAATGGTGATGGG - Intergenic
990078645 5:51884493-51884515 GTTATTTATCAAATGGAGTTTGG - Intergenic
990238014 5:53788721-53788743 CCTCTTTAACAAATGGTGCTGGG + Intergenic
990482593 5:56226240-56226262 CCTCTTTATTAAATGGTGCTGGG + Intronic
992293680 5:75305670-75305692 GTACTTTAACAACTGGAACTGGG + Intergenic
993764488 5:91838937-91838959 CTACTTCATCAGAATGAGCTTGG - Intergenic
994187851 5:96835780-96835802 AAACTTTATCAACTGGAGCAGGG + Intronic
997661732 5:135594495-135594517 CTAATTTGTAAAATGGAGCCAGG + Intergenic
999624538 5:153506511-153506533 CTCAATTAACAAATGGAGCTTGG - Intronic
1000083747 5:157870848-157870870 CTACTTGATGAAATGAAGTTAGG + Intergenic
1002515265 5:179753431-179753453 CTACTTGTCCAAATGGATCTGGG - Intronic
1003297078 6:4839651-4839673 CTTATTTAACAAATGGTGCTGGG - Intronic
1004052893 6:12106239-12106261 TTATTTTCTCAAATGGAGATTGG + Intronic
1004759020 6:18645503-18645525 TTACTTTTTCAAATCCAGCTAGG - Intergenic
1005343682 6:24868243-24868265 CTACTCTGTGAAGTGGAGCTGGG - Intronic
1006420227 6:33928756-33928778 AGACTTTAACAAATGGTGCTGGG + Intergenic
1006421216 6:33935395-33935417 CTACTTTCACAAATGAAGCCTGG + Intergenic
1006974296 6:38083435-38083457 CTACTCTACCTAGTGGAGCTTGG - Intronic
1008429165 6:51394555-51394577 CAACTTTACCAGATGAAGCTTGG + Intergenic
1009581233 6:65536404-65536426 CACCTTTATCAAATGGTACTGGG + Intronic
1011086088 6:83542650-83542672 CTTGTTTAACAAATGGTGCTAGG - Intergenic
1011361655 6:86532065-86532087 TCACTTTATCAAATGGAAGTGGG + Intergenic
1012686319 6:102255047-102255069 CTACTTTACCAAATGTGGCATGG - Intergenic
1015464754 6:133536319-133536341 CTACTTTATCTACTGGAAATTGG - Intergenic
1016343474 6:143086468-143086490 GTACTTTAACAACTGGAACTGGG - Intronic
1017598701 6:156058431-156058453 CTACTTTATCTATTTGAGCTGGG + Intergenic
1021372028 7:19861098-19861120 CTAAATTATCAAATGGTCCTGGG + Intergenic
1022483568 7:30760049-30760071 CTACCTTATGAAATGGGGCTGGG + Intronic
1022990764 7:35705053-35705075 CTGCTATATCAAATTTAGCTGGG + Intergenic
1023439570 7:40172152-40172174 GTACTTTAACAACTGGAACTGGG - Intronic
1024361191 7:48470299-48470321 TTACTCTATAAAAGGGAGCTAGG + Intronic
1024702556 7:51920498-51920520 TTACTTTATCAAAGGGAACTTGG - Intergenic
1027599065 7:80215783-80215805 CTAATTAATCAAATCTAGCTGGG - Intronic
1028792514 7:94868764-94868786 CTAATTCAACAAATGGTGCTGGG - Intergenic
1030289936 7:107862019-107862041 CTAATATATAAAATGGAGGTAGG - Intergenic
1030436484 7:109528709-109528731 CTACCTTAACAAATAGAGCATGG + Intergenic
1031849761 7:126849850-126849872 GTTCTTTTTCGAATGGAGCTGGG - Intronic
1032725522 7:134586917-134586939 GTACTTTAACAACTGGAACTGGG + Intergenic
1033462232 7:141557368-141557390 ATATTTTAACAAATGGAGCATGG + Intronic
1033496149 7:141898501-141898523 CCTATTTAACAAATGGAGCTGGG - Intergenic
1033772791 7:144572011-144572033 CTACTTAATAAATTGGAGCTGGG - Intronic
1037565887 8:20118183-20118205 CTGCCTTATCTAATGGTGCTGGG + Intergenic
1037798971 8:22021151-22021173 CTTCTTTAATAAATGGTGCTGGG + Intergenic
1039342595 8:36667633-36667655 CTTATTTATTAAATGGTGCTGGG - Intergenic
1040585033 8:48732198-48732220 CTACATTCTCAAATGGGGATTGG - Intronic
1042055882 8:64764314-64764336 GTACTTTAACAACTGGAACTGGG + Intronic
1042673483 8:71289692-71289714 CAACTCTATCTCATGGAGCTGGG + Intronic
1042995899 8:74698265-74698287 CTTATTTAACAAATGGTGCTGGG + Intronic
1045400053 8:101805793-101805815 CTAGTTTATCAAAGAGAACTAGG + Intronic
1049149976 8:141028504-141028526 CTTATTTATCAGATGAAGCTGGG + Intergenic
1050258597 9:3817823-3817845 CTTCTTTCTCAAATGGATTTGGG - Intergenic
1050816042 9:9812766-9812788 ACACTATATCAAATGGACCTTGG + Intronic
1051897402 9:22002608-22002630 ATAATTTATCATATGAAGCTAGG - Intronic
1054783530 9:69188415-69188437 CAAATTCATCAAATGGACCTTGG - Intronic
1055325291 9:75122083-75122105 ACACTTTATTAAAAGGAGCTGGG - Intronic
1056158349 9:83862408-83862430 CCTCTTTAACAAATGGTGCTGGG - Intronic
1058224405 9:102342104-102342126 CTTATTTAACAAATGGTGCTGGG + Intergenic
1058652196 9:107186732-107186754 CTTCTTTAATAAATGGTGCTAGG + Intergenic
1058771158 9:108233422-108233444 CTTCTTCAACAAATGGTGCTGGG + Intergenic
1059022778 9:110594757-110594779 CCTGTTTATCAAATGGTGCTGGG - Intergenic
1059363025 9:113761998-113762020 ATAATTTAACAAATGGTGCTAGG + Intergenic
1059675271 9:116532594-116532616 CTTATTTAACAAATGGTGCTGGG - Intronic
1059685113 9:116627608-116627630 CTAATCTATAAAATGGGGCTAGG - Intronic
1060172324 9:121472005-121472027 CAACTTTGACAAATGAAGCTGGG + Intergenic
1060871517 9:127045408-127045430 CAACTTTATCAAATGGAGTATGG - Intronic
1187421901 X:19142448-19142470 CTATTTCAACAAATGGTGCTGGG + Intergenic
1189349008 X:40263219-40263241 GGACTTTATCAAAAGGATCTTGG + Intergenic
1189404596 X:40709101-40709123 AAACTTTATGAAATGGGGCTGGG - Intronic
1189486070 X:41433191-41433213 CTCCTTCATCCACTGGAGCTGGG + Intergenic
1189716774 X:43875168-43875190 CAACCTGATCAAATGGTGCTGGG - Intronic
1190967531 X:55315105-55315127 CCACTTCAACAAATGGTGCTGGG - Intergenic
1191167304 X:57404464-57404486 GTACTTTAACAACTGGAACTGGG - Intronic
1192475913 X:71442894-71442916 CTAATTTAATAAATGGTGCTGGG - Intronic
1192929860 X:75794676-75794698 CTTATTTAACAAATGGCGCTGGG - Intergenic
1193172192 X:78349273-78349295 GTACTTTAACAACTGGAACTGGG - Intergenic
1194401599 X:93443956-93443978 GTATTTTATCACATGGAGGTAGG + Intergenic
1195523767 X:105861596-105861618 GTCTTTTAACAAATGGAGCTGGG - Intronic
1196375969 X:115032862-115032884 CTTCTTTATTAAATCGAGATCGG + Intergenic
1197566754 X:128097541-128097563 CTACTTTATCAAATCAAGCAAGG + Intergenic
1198609405 X:138381136-138381158 TAACTTTATCAGATGGATCTGGG + Intergenic
1199240307 X:145540668-145540690 CCACTTTGTCAAATGCAGTTAGG - Intergenic