ID: 1165618754

View in Genome Browser
Species Human (GRCh38)
Location 19:37226341-37226363
Sequence TAGACTCTGAGTGTCCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165618754_1165618761 20 Left 1165618754 19:37226341-37226363 CCCACATGGACACTCAGAGTCTA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1165618761 19:37226384-37226406 TCCTGGTGTTACACATCCAGGGG 0: 1
1: 0
2: 0
3: 8
4: 147
1165618754_1165618758 3 Left 1165618754 19:37226341-37226363 CCCACATGGACACTCAGAGTCTA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1165618758 19:37226367-37226389 TTTACATTAGGGTTCACTCCTGG 0: 11
1: 204
2: 564
3: 742
4: 815
1165618754_1165618756 -9 Left 1165618754 19:37226341-37226363 CCCACATGGACACTCAGAGTCTA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1165618756 19:37226355-37226377 CAGAGTCTATAGTTTACATTAGG 0: 5
1: 62
2: 362
3: 728
4: 1185
1165618754_1165618757 -8 Left 1165618754 19:37226341-37226363 CCCACATGGACACTCAGAGTCTA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1165618757 19:37226356-37226378 AGAGTCTATAGTTTACATTAGGG 0: 6
1: 61
2: 396
3: 823
4: 1155
1165618754_1165618759 18 Left 1165618754 19:37226341-37226363 CCCACATGGACACTCAGAGTCTA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG 0: 1
1: 0
2: 0
3: 8
4: 84
1165618754_1165618760 19 Left 1165618754 19:37226341-37226363 CCCACATGGACACTCAGAGTCTA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1165618760 19:37226383-37226405 CTCCTGGTGTTACACATCCAGGG 0: 1
1: 0
2: 2
3: 11
4: 121
1165618754_1165618763 25 Left 1165618754 19:37226341-37226363 CCCACATGGACACTCAGAGTCTA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1165618763 19:37226389-37226411 GTGTTACACATCCAGGGGTTTGG 0: 1
1: 0
2: 1
3: 0
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165618754 Original CRISPR TAGACTCTGAGTGTCCATGT GGG (reversed) Intronic
900460726 1:2801150-2801172 TGACCCCTGAGTGTCCATGTCGG + Intronic
902477810 1:16697381-16697403 TGGACTCTGCATGTCCATGGAGG - Intergenic
905499215 1:38423090-38423112 TAGATTCGGATTATCCATGTGGG - Intergenic
907505711 1:54916603-54916625 TAGACTCTGAGGCTTCCTGTAGG + Intergenic
909479216 1:76113540-76113562 TTCACACTGAGTGTCCATCTTGG - Intronic
915578944 1:156801810-156801832 TACAGCCTGAGTGTCCCTGTGGG - Intergenic
919267903 1:195296262-195296284 GAGAGTCGGAGTGTACATGTGGG + Intergenic
920105187 1:203547643-203547665 TGGACTCTGAGTGTTGGTGTGGG - Intergenic
1066261872 10:33737251-33737273 TAGACTCTGATTTTGCATGAAGG + Intergenic
1069587759 10:69619964-69619986 TTGACTCTGAATGTCCTTATGGG + Intergenic
1074877649 10:117626440-117626462 CAGACACTAAGGGTCCATGTGGG + Intergenic
1075214217 10:120517755-120517777 TGTACTCTTAGTGACCATGTTGG + Intronic
1075919325 10:126197455-126197477 AAGACTGTGAGTGACCCTGTGGG + Intronic
1077092689 11:786879-786901 TAGCCCCTGGGTGTCCATCTTGG + Intergenic
1090081879 11:123618915-123618937 GAGATTCTGAGTTTCCCTGTGGG - Intronic
1094801939 12:34047766-34047788 TAGACCTTGAGTTTCCCTGTGGG - Intergenic
1095650056 12:44597055-44597077 TAGACTCTGATTGAACATGCAGG + Intronic
1098044663 12:66387894-66387916 TGGACTCTGACTGCACATGTTGG + Intronic
1100580506 12:95935281-95935303 TCTACTCTGAGTGTTCATTTAGG - Intronic
1101880993 12:108625603-108625625 TAGTCACTGAGTGTGCCTGTGGG + Intronic
1101990725 12:109482365-109482387 TCCACTCTGTTTGTCCATGTGGG + Intronic
1103802396 12:123547511-123547533 TAGACACAGAAAGTCCATGTTGG - Intergenic
1104233024 12:126903633-126903655 GAGACTCTGAGCATCCACGTGGG - Intergenic
1104393482 12:128411081-128411103 TATTCTCTGTGTGTGCATGTTGG + Intronic
1105643741 13:22294182-22294204 TATACTTTGGGTGTCAATGTAGG - Intergenic
1107385222 13:39900940-39900962 AAGATTATGAGTGTCCCTGTGGG + Intergenic
1111521016 13:89404374-89404396 TAGTCATTGAGTGGCCATGTTGG + Intergenic
1113314554 13:109164443-109164465 AACACTTTTAGTGTCCATGTTGG - Intronic
1113467645 13:110523627-110523649 TGGACTCAGACTGTGCATGTTGG - Exonic
1116999738 14:51360370-51360392 TAGATTCTGAGTGCCCAGCTGGG - Intergenic
1118917418 14:70119345-70119367 AAGCCTCACAGTGTCCATGTAGG - Intronic
1122055470 14:99095182-99095204 AAGACTCTGAGTGTCTATTTGGG + Intergenic
1125447152 15:39770422-39770444 TAATCTCTGAGTGTTCAGGTAGG - Exonic
1128110185 15:65071406-65071428 TGGACACTGAGTGTCCCTCTGGG - Intronic
1130845068 15:87736454-87736476 TAGACAGTGTGTGTCCATGCAGG + Intergenic
1130909643 15:88262276-88262298 TGGCCTCTGAGTGTCCTGGTGGG + Intergenic
1132154372 15:99485406-99485428 GGGACTCAGAGTGTCCATGGTGG + Intergenic
1132198561 15:99932254-99932276 GAGATTCTGAGTGTCCAACTGGG + Intergenic
1133144221 16:3771657-3771679 TAGTCACTGAGTGTCCACCTTGG - Intronic
1137759283 16:50927509-50927531 TGGAGTCTGAGTGTCAAGGTAGG + Intergenic
1137991115 16:53156515-53156537 TAGAGTGTGAATGTCCTTGTTGG - Exonic
1138605768 16:58087407-58087429 TCGAGTGTGAGTGTGCATGTGGG - Intergenic
1138733075 16:59217453-59217475 TAGATTCAGAGGGTACATGTAGG - Intergenic
1138850165 16:60619001-60619023 TGGTCTCTGGGTGTCCATGAGGG - Intergenic
1139217120 16:65136954-65136976 TATAGTCTGAGTTTCCATGCTGG - Intergenic
1140678194 16:77355155-77355177 TAGCATCTAAGTGTCCTTGTGGG + Intronic
1143925362 17:10364766-10364788 TATCCTCTGAGTGTCGATTTTGG + Intronic
1144921584 17:18768531-18768553 CAGACTCTCAGTGGCCATGAGGG + Exonic
1147401337 17:40181751-40181773 TAGGCTCTGAGATTGCATGTGGG - Intronic
1149900133 17:60468654-60468676 TAGGTTCTGTGTGTCCATCTGGG + Intronic
1149966033 17:61164978-61165000 TTCAATCTGAATGTCCATGTGGG - Intronic
1151933127 17:77245293-77245315 CAGACTCTGAGAGTCCGTGTAGG + Intergenic
1155978142 18:32153974-32153996 TAGACACGGGGTTTCCATGTTGG - Intronic
1157436045 18:47670132-47670154 CAGGCTCTGACTGTCCATGCTGG - Intergenic
1165618754 19:37226341-37226363 TAGACTCTGAGTGTCCATGTGGG - Intronic
1166093749 19:40526907-40526929 AAGACCCTGAGTCTCCATGAGGG - Intronic
1202711827 1_KI270714v1_random:23207-23229 TGGACTCTGCATGTCCATGGAGG - Intergenic
929969210 2:46559479-46559501 TTGACTCTGAGCTTCCCTGTTGG + Intronic
930972376 2:57411427-57411449 TAGTCTATGTGTGTCCTTGTAGG - Intergenic
932016023 2:68027034-68027056 TAGAGTCTGAGAGTTCAAGTGGG - Intergenic
932962321 2:76428104-76428126 TAGACCGTGAGTGTCCATGCTGG + Intergenic
935165676 2:100566720-100566742 CAGACACAGAGTGTCCATGCTGG - Intronic
936076388 2:109404393-109404415 TGGCCTCTGAGTAGCCATGTGGG + Intronic
936747003 2:115589384-115589406 TAGACTGTGATTGTCCACCTGGG - Intronic
941871626 2:170391703-170391725 TAGACTGTGAGTTTCCAGTTAGG - Intronic
942313062 2:174673323-174673345 TAGACCCTGAGTCCCCATATGGG - Intronic
942421739 2:175814759-175814781 TAGATTCAGAGGGTACATGTGGG - Intergenic
942452171 2:176115115-176115137 AAAACTCTGAGTTTCCATGGTGG + Intronic
943115728 2:183667666-183667688 TAGTCTCTCATTGTCCATGGGGG + Intergenic
943511751 2:188835506-188835528 AAGACTGTAAGTGTCCATGGTGG - Intergenic
945585052 2:211651119-211651141 TAAGGTCTCAGTGTCCATGTTGG - Intronic
1173274732 20:41569922-41569944 TAGTCCCTCAGTGTCCATGGGGG - Intronic
1175205947 20:57311205-57311227 TAGAATGTGAGTGTGCATTTTGG - Intergenic
1175584369 20:60126307-60126329 TGGATGCTGAGTGGCCATGTGGG - Intergenic
1180292509 22:10858719-10858741 TAGAGTCTGGGTGTCCACATAGG + Intergenic
1180495315 22:15888141-15888163 TAGAGTCTGGGTGTCCACATAGG + Intergenic
1184224176 22:43119667-43119689 CAGACTCTGAGGGTCCAAGAAGG + Intronic
1185421038 22:50734550-50734572 CAGACTCTGAGTCCCCATGGAGG + Intergenic
953502122 3:43446952-43446974 TATATTCTGATTGTACATGTGGG - Intronic
957534459 3:81483308-81483330 TTGAATCTGAATGTCTATGTTGG - Intergenic
958467894 3:94481073-94481095 CAGACTCTGAATGCCAATGTGGG + Intergenic
962410454 3:135137068-135137090 TAGACTCGGAGTGTCAAAGTTGG + Intronic
963047688 3:141115098-141115120 TAGTGTCTGAGTGTCCAGATTGG - Intronic
965467589 3:169050646-169050668 TAGACTGTGTGTGATCATGTTGG - Intergenic
965851809 3:173035937-173035959 TAGAGGCTGAGTGTCCATAATGG - Intronic
967978988 3:195054212-195054234 GAGACTCTGGGTGTACAGGTGGG + Intergenic
969466269 4:7358537-7358559 TAGACTGTGAGTCACCATCTGGG - Intronic
969889804 4:10249378-10249400 TAACCTCTGAGCATCCATGTTGG + Intergenic
970765286 4:19541020-19541042 TAGACTCTCAGTATCTGTGTGGG + Intergenic
971450267 4:26793536-26793558 TAGAGACGGAGTTTCCATGTTGG - Intergenic
974134904 4:57803348-57803370 TGGACTCTGAGTGTCAGTGATGG + Intergenic
977112891 4:92982678-92982700 TGGAATCTGAATGTCCATGGAGG - Intronic
978430095 4:108624519-108624541 TAGACTTTGAGCCTCCATCTAGG - Intronic
983956204 4:173701912-173701934 CTGACTCTGAGTCTTCATGTAGG - Intergenic
985561861 5:591994-592016 TGGACTCTGAGGGTCCTTGGTGG + Intergenic
990333178 5:54747209-54747231 TAGAGTGTGAATGTTCATGTGGG - Intergenic
990879043 5:60519643-60519665 TAGAGGCTGAGTGTCTCTGTTGG + Intronic
991338471 5:65577873-65577895 TGGACTCTGGGTGTCAATGTAGG - Intronic
999310909 5:150551614-150551636 TAGCTTCTGACAGTCCATGTGGG + Intronic
999586423 5:153094688-153094710 TGGACTTGGAGTCTCCATGTGGG - Intergenic
999935272 5:156479461-156479483 TTCTCTCTGAGTTTCCATGTGGG + Intronic
1001789340 5:174442252-174442274 TAGACCCTGTGTGTCAATTTTGG - Intergenic
1002149945 5:177219970-177219992 AAGACTCTGTGTGACCATATTGG + Intronic
1004465236 6:15879051-15879073 TAGACTCTGAGCCTCCTTGACGG + Intergenic
1007772714 6:44204031-44204053 TAGAGACTGGGTTTCCATGTTGG + Intergenic
1010977786 6:82335874-82335896 GAGACACTGAGAGTCAATGTGGG + Intergenic
1011355411 6:86468257-86468279 TAGACTCTGAGTGGTCTTGCAGG - Intergenic
1011720412 6:90150341-90150363 TAGACTCTGAGGCTCCATTGAGG - Intronic
1018192022 6:161317516-161317538 TAGAGACGGAGTTTCCATGTTGG + Intergenic
1024424010 7:49204724-49204746 TAGACTTTCTGTGTCCATGTGGG - Intergenic
1028978013 7:96935444-96935466 AAGACTGTGAGTGTCCACTTTGG - Intergenic
1031123969 7:117752246-117752268 AAGACTCTGAATGTCCAGGATGG - Intronic
1032898005 7:136273799-136273821 TAGACTTTAATTGACCATGTTGG + Intergenic
1034640013 7:152595040-152595062 GAGTCTCTGAGGGCCCATGTTGG + Intergenic
1035890848 8:3341122-3341144 TAGAGTCACAGTATCCATGTGGG + Intronic
1037182175 8:16020485-16020507 TAGACTCTGGGTGTTCACATTGG - Intergenic
1037493721 8:19419435-19419457 TAGACTTAGAGTGTCCAGGGTGG + Intronic
1042210315 8:66373548-66373570 TAGCCCCTAAGTGCCCATGTTGG - Intergenic
1042970614 8:74404811-74404833 TAATCTCTTAGTGTCCATGGGGG + Intronic
1044239292 8:89869913-89869935 TAAGTTCTAAGTGTCCATGTTGG - Intergenic
1046846700 8:118924485-118924507 TAGACTCTGAGTGACAGTTTTGG + Exonic
1046863582 8:119121374-119121396 TAGAGACGGAGTTTCCATGTTGG - Intergenic
1047358903 8:124149651-124149673 TAGCTTCTGAGTGTTCATATGGG - Intergenic
1047964742 8:130038308-130038330 TTGACTCTGAGTCTCCACATAGG + Intergenic
1050041360 9:1497095-1497117 AAGACTCTAAATGTCAATGTTGG - Intergenic
1053223450 9:36330940-36330962 TAGATTTTGATTCTCCATGTGGG + Intergenic
1053302796 9:36963717-36963739 CAGATTCTGAGTCTCCATGACGG + Intronic
1055276981 9:74629074-74629096 TTGACTCTTCGTTTCCATGTCGG + Intronic
1057817063 9:98303643-98303665 TAGACTCTTAGTGACCAGGAAGG - Intronic
1189736287 X:44073017-44073039 TTGATTCTGAGAATCCATGTAGG - Intergenic
1191232930 X:58110607-58110629 TGGAGTCTGAGTGTCCTTCTAGG - Intergenic