ID: 1165618755

View in Genome Browser
Species Human (GRCh38)
Location 19:37226342-37226364
Sequence ATAGACTCTGAGTGTCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165618755_1165618760 18 Left 1165618755 19:37226342-37226364 CCACATGGACACTCAGAGTCTAT 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1165618760 19:37226383-37226405 CTCCTGGTGTTACACATCCAGGG 0: 1
1: 0
2: 2
3: 11
4: 121
1165618755_1165618761 19 Left 1165618755 19:37226342-37226364 CCACATGGACACTCAGAGTCTAT 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1165618761 19:37226384-37226406 TCCTGGTGTTACACATCCAGGGG 0: 1
1: 0
2: 0
3: 8
4: 147
1165618755_1165618763 24 Left 1165618755 19:37226342-37226364 CCACATGGACACTCAGAGTCTAT 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1165618763 19:37226389-37226411 GTGTTACACATCCAGGGGTTTGG 0: 1
1: 0
2: 1
3: 0
4: 89
1165618755_1165618758 2 Left 1165618755 19:37226342-37226364 CCACATGGACACTCAGAGTCTAT 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1165618758 19:37226367-37226389 TTTACATTAGGGTTCACTCCTGG 0: 11
1: 204
2: 564
3: 742
4: 815
1165618755_1165618759 17 Left 1165618755 19:37226342-37226364 CCACATGGACACTCAGAGTCTAT 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG 0: 1
1: 0
2: 0
3: 8
4: 84
1165618755_1165618757 -9 Left 1165618755 19:37226342-37226364 CCACATGGACACTCAGAGTCTAT 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1165618757 19:37226356-37226378 AGAGTCTATAGTTTACATTAGGG 0: 6
1: 61
2: 396
3: 823
4: 1155
1165618755_1165618756 -10 Left 1165618755 19:37226342-37226364 CCACATGGACACTCAGAGTCTAT 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1165618756 19:37226355-37226377 CAGAGTCTATAGTTTACATTAGG 0: 5
1: 62
2: 362
3: 728
4: 1185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165618755 Original CRISPR ATAGACTCTGAGTGTCCATG TGG (reversed) Intronic
901812852 1:11777696-11777718 AAAGAGGCTGAGGGTCCATGTGG - Intronic
903204045 1:21767106-21767128 ATACACCCTGAGTGCCCAGGAGG - Intronic
904891690 1:33784207-33784229 ATAGACTCTGAGGGGCAGTGGGG + Intronic
910394525 1:86778533-86778555 TGAGACTCAGTGTGTCCATGGGG - Intergenic
911065315 1:93782590-93782612 ATACAATCTGAGTGTTCATAAGG + Intronic
913297233 1:117334017-117334039 ATAGAATCTCAGTGTTCGTGGGG + Intergenic
915660860 1:157403838-157403860 GAAGACTCTGGGTGTCCCTGTGG + Intergenic
917744863 1:177997217-177997239 ATAGCCTGGGAGTGGCCATGAGG + Intergenic
919267902 1:195296261-195296283 AGAGAGTCGGAGTGTACATGTGG + Intergenic
920661869 1:207922401-207922423 AGTGACTCTGAATGTCCGTGTGG + Intergenic
920863670 1:209733111-209733133 ATGGCCATTGAGTGTCCATGAGG - Intronic
1066486459 10:35850245-35850267 ATAGAATGTGAGTGTTCAGGTGG + Intergenic
1070431362 10:76341976-76341998 ATAGACTCTGCCTGTTCATGGGG + Intronic
1071366084 10:84901897-84901919 ATATACTCTGATTCTCCATGAGG - Intergenic
1074877648 10:117626439-117626461 ACAGACACTAAGGGTCCATGTGG + Intergenic
1078623549 11:12931996-12932018 ATAAACTCTGAGAGTCCTTGCGG - Intronic
1081749009 11:45494540-45494562 ATAGCCTATGTATGTCCATGGGG + Intergenic
1082811321 11:57480776-57480798 ACAGACTCTGAGAGTCCAGGAGG + Intergenic
1085699012 11:78729717-78729739 ATGGACTCTGGGTGTTCAGGAGG + Intronic
1086056039 11:82647611-82647633 ATAAATTCTGAGTGTCTTTGAGG - Intergenic
1087902242 11:103653957-103653979 ATAGGCTTTGAGTGGCCTTGAGG + Intergenic
1090081880 11:123618916-123618938 AGAGATTCTGAGTTTCCCTGTGG - Intronic
1092438063 12:8469132-8469154 ATATACTATCAGTGGCCATGTGG + Intronic
1093297560 12:17410134-17410156 ATAGTCCCTGAGTCTCCGTGGGG + Intergenic
1093875246 12:24342026-24342048 AGATACTCTGTGTGTCCACGAGG - Intergenic
1098632428 12:72740559-72740581 ATTGGCTCTGAGTTTCCCTGGGG + Intergenic
1098738507 12:74139501-74139523 ATAAACTCTGAATGGCCAGGAGG + Intergenic
1101481642 12:105103781-105103803 ATAGATTCTTAGTGTCCAAGAGG + Intergenic
1101880992 12:108625602-108625624 ATAGTCACTGAGTGTGCCTGTGG + Intronic
1101965954 12:109281907-109281929 AGAGGTTCTGAGTGTCCAAGAGG - Intronic
1103254727 12:119531264-119531286 AAAGCCTCTGAGTTTCCAGGGGG - Intronic
1103925847 12:124423029-124423051 AGAGGCTCTGAGTGCCCGTGGGG + Intronic
1104064689 12:125297123-125297145 AGAGACTCTGGGTTTCCTTGGGG + Intronic
1106694844 13:32162416-32162438 TGAGGCTCTGAGTGTCCCTGTGG + Intronic
1106838709 13:33663723-33663745 ATAGACACTGAGTGGTCAAGTGG + Intergenic
1110907127 13:80905478-80905500 ATATATTCTGAGTGTGTATGAGG + Intergenic
1112097494 13:96150775-96150797 ATAGAATCAGAGTGCCCAAGAGG - Intronic
1112542331 13:100327400-100327422 ATTGACTCTGTGTGTGTATGTGG + Intronic
1116999739 14:51360371-51360393 ATAGATTCTGAGTGCCCAGCTGG - Intergenic
1119805183 14:77477786-77477808 ACAGACTCAGAGTGTGCAGGTGG + Intronic
1122055469 14:99095181-99095203 TAAGACTCTGAGTGTCTATTTGG + Intergenic
1126432805 15:48604399-48604421 AGTGACTCTGATTGTCCCTGTGG - Intronic
1126557556 15:50005651-50005673 TTAAGCTATGAGTGTCCATGAGG - Intronic
1127319347 15:57827266-57827288 AAAGACTCAGAGTGTCTTTGTGG + Intergenic
1128216346 15:65936883-65936905 CTTGACTCTGAGCCTCCATGGGG + Intronic
1132039546 15:98513413-98513435 ACAGACTCAGATTGTCCCTGGGG + Intronic
1133720869 16:8493197-8493219 ATAGACTCTGAGGGACCTAGAGG - Intergenic
1135859772 16:26045020-26045042 AAAGACACTGAGAGCCCATGCGG + Intronic
1138836029 16:60435661-60435683 ATAGCCTCTAAGTGTTCAAGTGG + Intergenic
1138850166 16:60619002-60619024 GTGGTCTCTGGGTGTCCATGAGG - Intergenic
1144921583 17:18768530-18768552 GCAGACTCTCAGTGGCCATGAGG + Exonic
1151735546 17:75937944-75937966 TGAGACTCTGAGTGTCCAGCTGG - Intronic
1152558218 17:81065207-81065229 GTAGACACTCAGTGTCCCTGTGG + Intronic
1153609887 18:6873319-6873341 ATAGATTTAGAGTGTCCAGGTGG + Intronic
1164603175 19:29577455-29577477 ATAGACTCGGTGTTTCCTTGGGG + Intergenic
1165027789 19:32974250-32974272 AGAGCAGCTGAGTGTCCATGAGG - Intronic
1165487903 19:36106447-36106469 ATAGAAGGTGAGTGGCCATGAGG - Intergenic
1165618755 19:37226342-37226364 ATAGACTCTGAGTGTCCATGTGG - Intronic
1166093750 19:40526908-40526930 GAAGACCCTGAGTCTCCATGAGG - Intronic
1166928203 19:46284147-46284169 ACAGACTCTGGGTGGCCAAGGGG - Intergenic
1168274503 19:55269848-55269870 ATGGACTCTGGGTGACAATGAGG + Intronic
1168420522 19:56199392-56199414 ATAGACTGTGAGTTTCCAGAGGG - Intergenic
925720211 2:6820252-6820274 TGAGACCCTGAGTGTCCCTGGGG + Intergenic
926332932 2:11839992-11840014 ATAAACTCTGATTGTCATTGTGG + Intergenic
926634385 2:15164582-15164604 ATAGAATCTGAGTGTGAGTGAGG + Intergenic
926712896 2:15896898-15896920 AGAGAATGTGCGTGTCCATGGGG - Intergenic
927017622 2:18981772-18981794 AGGAACTCTGAGTGACCATGAGG - Intergenic
927522791 2:23710564-23710586 ATCCACTCTGAGCATCCATGAGG + Intergenic
928440402 2:31287335-31287357 TTAGACTCTGAGTGACCCTGAGG - Intergenic
928717127 2:34074012-34074034 ATGGACTGTGAGTGCCAATGGGG + Intergenic
929029844 2:37640126-37640148 AGAGACTGTGAGTTTCCCTGAGG + Intergenic
931158645 2:59664324-59664346 CTAGCCTCTGATCGTCCATGCGG + Intergenic
932016024 2:68027035-68027057 ATAGAGTCTGAGAGTTCAAGTGG - Intergenic
933546913 2:83725777-83725799 TTCTACTCTGTGTGTCCATGAGG + Intergenic
942774611 2:179566417-179566439 ATAGCCTATGAGTGTTTATGAGG + Intronic
943115727 2:183667665-183667687 GTAGTCTCTCATTGTCCATGGGG + Intergenic
946408779 2:219506361-219506383 AGAGGCTCTCACTGTCCATGCGG - Exonic
947454057 2:230237034-230237056 GTAGACACTGAGTTTCCAAGAGG - Intronic
948110888 2:235454979-235455001 ATAGACTCTGATGCTCCAAGTGG - Intergenic
949025183 2:241764490-241764512 ATGGACTATGAGTCTCCAGGTGG + Intronic
1169368641 20:5011354-5011376 AAAGACTAAGTGTGTCCATGAGG - Intergenic
1173274733 20:41569923-41569945 GTAGTCCCTCAGTGTCCATGGGG - Intronic
1174730834 20:52915401-52915423 AGAAACTCTGAGTGTCCAAGTGG - Intergenic
1177613417 21:23484750-23484772 ATAGACTCTCAGTATCCTTCAGG + Intergenic
1181637631 22:24181729-24181751 AGAAATTCTGAGGGTCCATGTGG + Intronic
1181760700 22:25056935-25056957 TTAGACACTGAGTTTCTATGTGG + Intronic
1181804144 22:25365010-25365032 ACAGGTTCTGGGTGTCCATGTGG - Intronic
1184109328 22:42385650-42385672 AATGCCTCTGTGTGTCCATGGGG + Intronic
951305616 3:21057494-21057516 ATAGAGTCTGAATGTCTATATGG + Intergenic
952041593 3:29268056-29268078 ATAGACTCTGCAGGTCCATTTGG + Intergenic
952334636 3:32393169-32393191 CCAGACACTGAGTGTGCATGAGG + Intronic
952989060 3:38815384-38815406 ATTGACTCTGAATGTCAAGGGGG - Intergenic
953502123 3:43446953-43446975 ATATATTCTGATTGTACATGTGG - Intronic
955422089 3:58748866-58748888 ACAGACCCTGAGTGTGCATCAGG - Intronic
956435488 3:69231159-69231181 ATAGAGTCAGAATGCCCATGAGG + Intronic
956543873 3:70377153-70377175 AAATAATCTGAATGTCCATGTGG + Intergenic
958467893 3:94481072-94481094 ACAGACTCTGAATGCCAATGTGG + Intergenic
960769315 3:121174753-121174775 ATTGACTCTGATTTTCCCTGTGG - Intronic
961318235 3:126055108-126055130 AAAGACTCTGAGTGGCCATTAGG + Intronic
963407199 3:144881106-144881128 CAAGAATCTGAGTGTCCATGTGG + Intergenic
965215827 3:165863624-165863646 ATAAAATTTGAGTGTGCATGTGG - Intergenic
974516787 4:62925279-62925301 ACAAAATCTCAGTGTCCATGAGG - Intergenic
976844219 4:89468958-89468980 ATAGTCACTGTGTGTCCATTTGG - Intergenic
977398925 4:96507280-96507302 ATTTGCTGTGAGTGTCCATGAGG - Intergenic
977602302 4:98947408-98947430 AGAGACTCTGAATAACCATGGGG - Intergenic
979265458 4:118696892-118696914 ATATATTCTGGGTGTACATGGGG + Intronic
980327778 4:131370762-131370784 AAAGACTATGAGTTTCAATGTGG - Intergenic
984098222 4:175457399-175457421 ATAGTCTTTGAGTGTTCTTGTGG + Intergenic
993351517 5:86855785-86855807 ACATTCTCTGATTGTCCATGAGG + Intergenic
999036546 5:148357906-148357928 GTTGTCTCTCAGTGTCCATGGGG - Intergenic
999310908 5:150551613-150551635 ATAGCTTCTGACAGTCCATGTGG + Intronic
999586424 5:153094689-153094711 ATGGACTTGGAGTCTCCATGTGG - Intergenic
1000753081 5:165121192-165121214 ATTCACCCTGAGTTTCCATGAGG - Intergenic
1001918931 5:175585526-175585548 ATATACCCTGGGTGTCCCTGGGG - Intergenic
1002445595 5:179288165-179288187 ACAGGCTCTGTGTGTGCATGAGG - Intronic
1010175779 6:73026366-73026388 AAAAACTCTGAGTGTGAATGAGG - Intronic
1010977785 6:82335873-82335895 AGAGACACTGAGAGTCAATGTGG + Intergenic
1014933931 6:127364866-127364888 AGAGACTCTTAGTGGACATGGGG - Intergenic
1016555470 6:145331357-145331379 ATAGATTCTGAATTTACATGAGG - Intergenic
1024424011 7:49204725-49204747 CTAGACTTTCTGTGTCCATGTGG - Intergenic
1028077496 7:86534282-86534304 AGGGACTCTGAGTTTCCATGGGG - Intergenic
1028747254 7:94341342-94341364 ATAGACGCTGAGTGCTAATGTGG - Intergenic
1031937829 7:127753970-127753992 ATAGGCTCTGAGCGTTCAAGGGG - Intronic
1033462903 7:141563514-141563536 GGACACCCTGAGTGTCCATGTGG + Intronic
1035890847 8:3341121-3341143 ATAGAGTCACAGTATCCATGTGG + Intronic
1037149114 8:15614215-15614237 CTAGACTCAGTGTTTCCATGAGG - Intronic
1040833819 8:51709929-51709951 ATAGACTCTAAATGTTAATGAGG + Intronic
1040926536 8:52689725-52689747 AAAGTCTCTGAGTCTTCATGGGG + Intronic
1041430748 8:57778203-57778225 ATAGATTTTGAGTTTGCATGGGG + Intergenic
1041710175 8:60887266-60887288 ATGAACCCTGAGTGTCAATGTGG - Intergenic
1042060821 8:64815437-64815459 AAAGACTTTGAATGTCCAAGTGG - Intergenic
1042970613 8:74404810-74404832 GTAATCTCTTAGTGTCCATGGGG + Intronic
1043950809 8:86307308-86307330 ATAGACTTTAATTGTCCATTTGG + Intronic
1046931350 8:119844956-119844978 ATAGACTCTGAGGTACAATGTGG + Intronic
1047358904 8:124149652-124149674 ATAGCTTCTGAGTGTTCATATGG - Intergenic
1048145544 8:131838443-131838465 AAAGAATCTGAGTGTCTTTGTGG - Intergenic
1048793916 8:138130781-138130803 ATAGACTCTGGTTCTTCATGAGG - Exonic
1050297868 9:4224520-4224542 GTAGAATCTTAGTGTCCATAAGG - Intronic
1051107710 9:13598974-13598996 CTAGACTCTGAGTTTCCTTGAGG - Intergenic
1055198556 9:73627009-73627031 AGAGATTCTGATTATCCATGAGG - Intergenic
1055830948 9:80378189-80378211 AGAGATTTTGAGTGTCCACGGGG - Intergenic
1058566018 9:106286322-106286344 AAAGACTCTCAATATCCATGGGG - Intergenic
1187964485 X:24597092-24597114 AAAGTCTGTGTGTGTCCATGAGG - Intronic
1188502187 X:30839582-30839604 ATGGACTCTGAGTGATTATGAGG + Intronic
1189064256 X:37789407-37789429 ATAGTTTCTGAGAGTCCTTGTGG - Intronic
1190911121 X:54773733-54773755 AAAGACTCTGAGTCTTCCTGAGG - Intronic
1192423581 X:71055483-71055505 ATCAACTCTGAGTTTCAATGGGG + Intergenic
1196000625 X:110781278-110781300 AAAGAATCTGAGTATACATGTGG + Intronic
1197055241 X:122110875-122110897 ATAGCCTCTAATTATCCATGGGG + Intergenic
1198095206 X:133373505-133373527 AGTGACACTGAGTGTCTATGTGG + Intronic
1198594886 X:138225574-138225596 ATAAAGTTTGAGTGTGCATGTGG + Intergenic
1199938242 X:152598826-152598848 ATTGGCTTTGAGTGTCCCTGAGG + Intergenic
1200054189 X:153450188-153450210 GCAGCCTCTGAGGGTCCATGGGG - Intronic
1200169938 X:154065161-154065183 CCAGTCTCTGAGGGTCCATGGGG + Intronic