ID: 1165618759

View in Genome Browser
Species Human (GRCh38)
Location 19:37226382-37226404
Sequence ACTCCTGGTGTTACACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165618755_1165618759 17 Left 1165618755 19:37226342-37226364 CCACATGGACACTCAGAGTCTAT 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG 0: 1
1: 0
2: 0
3: 8
4: 84
1165618754_1165618759 18 Left 1165618754 19:37226341-37226363 CCCACATGGACACTCAGAGTCTA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165618759 Original CRISPR ACTCCTGGTGTTACACATCC AGG Intronic
901924872 1:12559866-12559888 CCTCCTGGAGTCACACAGCCAGG + Intergenic
902031339 1:13424793-13424815 ACTCATCCTGTTACACATTCTGG - Intergenic
902277605 1:15350704-15350726 ACTCCTCATGTTACACCTCTAGG - Intronic
902834082 1:19035599-19035621 ACTGCAGGTGTCACACATCCAGG - Intergenic
903099232 1:21013789-21013811 ACTCCTGATGTTACCCATCATGG + Intronic
903429701 1:23285315-23285337 ACTTCTGCTCTTAGACATCCTGG + Intergenic
903825245 1:26140138-26140160 GCTCCCTGTGTTTCACATCCTGG - Intergenic
910734578 1:90438583-90438605 CCTCATGGTGGTACACATTCAGG + Intergenic
910777310 1:90889916-90889938 ACTTCTGCTGATACAGATCCAGG - Intergenic
912907016 1:113718253-113718275 ACTCCAGGTCTCACACATCCAGG + Intronic
915202192 1:154239321-154239343 GCTCCTGGTATGATACATCCAGG + Intronic
918115396 1:181491919-181491941 ACACCTGGTCTTACAGGTCCTGG - Intronic
1067989875 10:51199818-51199840 AGCTCTGCTGTTACACATCCTGG + Intronic
1075559156 10:123456097-123456119 GCTTCTTGTGTTAGACATCCTGG - Intergenic
1076034000 10:127183836-127183858 AATCCTGGTGTTACTCTGCCAGG + Intronic
1079512694 11:21229537-21229559 ACTCTTGGTGGAACACAGCCAGG + Intronic
1082201385 11:49374058-49374080 ACTCGTTGTATTACAGATCCAGG - Intergenic
1086139344 11:83477541-83477563 TATCCTGGAGTTACACATCGTGG - Intronic
1086654288 11:89332183-89332205 ACTCGTTGTATTACAGATCCAGG + Intronic
1091751096 12:3021666-3021688 ACTCCTTTTGTTTTACATCCTGG - Intronic
1093436870 12:19145643-19145665 ACTCCTGTTGTTGGACATCGAGG + Intronic
1104128674 12:125872053-125872075 ACTCATGGTGTGCCCCATCCAGG - Intergenic
1106477004 13:30107663-30107685 GCTCATGGTCTGACACATCCAGG - Intergenic
1106641821 13:31592567-31592589 TCTCCTTGTGTTACACATTTGGG - Intergenic
1106782835 13:33076870-33076892 GCTGCTGCTGTTACACATGCTGG - Intergenic
1107241732 13:38243471-38243493 ACTCCTGGGGTTACAGATGTGGG - Intergenic
1108151447 13:47539988-47540010 GCTCTTGGTGTTTTACATCCTGG - Intergenic
1108995206 13:56722839-56722861 ACTCTTGGTGTTTTACATTCTGG - Intergenic
1114535748 14:23421187-23421209 ACCGCAGGTGTTACACTTCCAGG - Intronic
1114821016 14:26019405-26019427 ACTCCTGGTGTGCCTCAGCCTGG + Intergenic
1124662056 15:31557907-31557929 ACTCCTGGGATGACACATCTGGG + Intronic
1126937303 15:53725315-53725337 ATTCCTGTTGCTCCACATCCCGG - Intronic
1130722556 15:86403743-86403765 ACAGCTGGTGTTACAGAGCCAGG + Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133641709 16:7723488-7723510 TCTCCTGATGTTACCCAGCCTGG - Intergenic
1147441258 17:40448571-40448593 CCACCTGGTGCTACTCATCCTGG - Intronic
1148736818 17:49869650-49869672 ACTTCTGGTGCTGCAGATCCAGG + Intergenic
1149651600 17:58279519-58279541 GCACCTGTTGTTGCACATCCCGG + Exonic
1152940021 17:83164100-83164122 GCTCCTGTTGCTACACATCCTGG + Intergenic
1156658055 18:39310662-39310684 ACACCTCCTGTTGCACATCCTGG + Intergenic
1157683983 18:49628348-49628370 ACTCCTGGTGAGACATTTCCTGG + Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
925781901 2:7389102-7389124 ACTCCAGGTCTCTCACATCCAGG + Intergenic
931838081 2:66120742-66120764 ACTCCTGTTGCTCCACATTCTGG + Intergenic
932131418 2:69190779-69190801 TCTCCTGGTATTATACATCTAGG + Intronic
932918356 2:75881237-75881259 ATTCCTGGGGTTACACATTAAGG + Intergenic
942082247 2:172411250-172411272 AGTCCTGGAGATAGACATCCAGG - Intergenic
944437983 2:199711805-199711827 ATTCCTGGGTTTCCACATCCTGG + Intergenic
945896711 2:215491186-215491208 ATTCGTGTTGTTCCACATCCTGG + Intergenic
945897028 2:215495023-215495045 ATTCCTGTTGTTCCACATCCTGG - Intergenic
947968697 2:234303588-234303610 ACTCATGGTGTTAAACCTTCAGG + Intergenic
1169145977 20:3252601-3252623 ACTCCTGCTGTTCCAGCTCCTGG + Exonic
1171170952 20:23015038-23015060 GCTCATGGTGTTCCCCATCCTGG - Intergenic
1182566587 22:31204644-31204666 ACTCCTGGTGTTTGGCTTCCTGG + Exonic
1184881340 22:47306376-47306398 GGTCCTGGTGTTAGACATCTTGG + Intergenic
953173501 3:40528631-40528653 AGTTCTGTTGTTTCACATCCTGG + Intronic
953465069 3:43112679-43112701 AGTCCATGTGGTACACATCCTGG + Intergenic
955512838 3:59698552-59698574 ATTCCTGGAGCCACACATCCAGG - Intergenic
955575751 3:60361033-60361055 AATACTGGTGTAATACATCCTGG + Intronic
962118275 3:132534934-132534956 ATTCCTGGAGTTCCACATCATGG - Intronic
971265575 4:25093759-25093781 CCTCCTGGTGCTCCACATGCAGG + Intergenic
971770753 4:30893703-30893725 ACTCCTGGTGTTACACACAAAGG - Intronic
979558574 4:122077754-122077776 ACTCCTGGTGTTTGGCTTCCTGG - Intergenic
979628473 4:122873182-122873204 ACTCCTGGCTTTCCACATCTTGG + Intronic
988040123 5:25878036-25878058 AGTCTTGCTCTTACACATCCAGG - Intergenic
988168806 5:27629020-27629042 ACTCCTGGGGTAACCCATGCAGG + Intergenic
989826309 5:45860532-45860554 ACTCCTGGCCTTACATAACCAGG + Intergenic
990243048 5:53834786-53834808 ACTTCTGGAGTTAGACATCGTGG + Intergenic
993853031 5:93034997-93035019 ACTCCAGGAGCAACACATCCAGG - Intergenic
996794446 5:127329897-127329919 ATTACAGGTGTTACACACCCGGG + Intronic
998605527 5:143630529-143630551 ATTCCTGGTGCTATACATTCTGG + Intergenic
1005006200 6:21289945-21289967 ACTCTTGGCTTTACACTTCCAGG + Intergenic
1005533491 6:26732094-26732116 GCTCTTTGTGTTATACATCCTGG - Intergenic
1005535159 6:26747581-26747603 GCTCTTTGTGTTATACATCCTGG + Intergenic
1005537303 6:26769560-26769582 GCTCTTTGTGTTATACATCCTGG + Intergenic
1009006182 6:57791023-57791045 GCTCTTTGTGTTATACATCCTGG + Intergenic
1009008187 6:57811989-57812011 GCTCTTTGTGTTATACATCCTGG + Intergenic
1012316418 6:97786455-97786477 ACTCTTGGTGTTATATATACTGG + Intergenic
1012379559 6:98604031-98604053 TCACCTGGTGTTACACAGGCTGG + Intergenic
1013623950 6:111918912-111918934 ACTCCTGGACTCACACATCTGGG - Intergenic
1014084864 6:117330644-117330666 CCTCCTTGAGTTACATATCCAGG + Intronic
1018553278 6:165023457-165023479 ATTCTTGTTGTTCCACATCCTGG - Intergenic
1023501253 7:40852010-40852032 ACTTCTGATTTTACACATGCTGG + Intronic
1024589701 7:50870738-50870760 ATTCCTGGAGTCACACATCCTGG + Intergenic
1025935584 7:66033538-66033560 ACTCCTGGTTTAAGACATACAGG - Intergenic
1029298814 7:99562349-99562371 ACTCCTGAAATAACACATCCTGG - Intronic
1038454753 8:27665849-27665871 GCTCCTTGTGTTACTCATCGAGG + Intronic
1039708828 8:40034988-40035010 ACTCCTGGTCTTACAATTGCAGG - Intergenic
1187977885 X:24722082-24722104 ACTCCTTTTTTCACACATCCTGG - Intronic
1190254658 X:48753577-48753599 ACTCCTGGGGCCACACATACTGG - Intergenic
1190254760 X:48754152-48754174 ACTCCTAGTGTTACACAGACTGG - Intergenic
1191158940 X:57306249-57306271 ACTCTAAGTGTTACACATTCTGG - Intronic