ID: 1165621453

View in Genome Browser
Species Human (GRCh38)
Location 19:37251952-37251974
Sequence GCGCTCAGCCGAACATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165621453_1165621455 -9 Left 1165621453 19:37251952-37251974 CCTTGGGATGTTCGGCTGAGCGC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1165621455 19:37251966-37251988 GCTGAGCGCCTGCCTAACATGGG 0: 1
1: 0
2: 0
3: 6
4: 58
1165621453_1165621454 -10 Left 1165621453 19:37251952-37251974 CCTTGGGATGTTCGGCTGAGCGC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1165621454 19:37251965-37251987 GGCTGAGCGCCTGCCTAACATGG 0: 1
1: 0
2: 0
3: 4
4: 92
1165621453_1165621460 20 Left 1165621453 19:37251952-37251974 CCTTGGGATGTTCGGCTGAGCGC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1165621460 19:37251995-37252017 TGCCTAACCCTCCTGACTGGAGG 0: 1
1: 0
2: 0
3: 38
4: 727
1165621453_1165621458 17 Left 1165621453 19:37251952-37251974 CCTTGGGATGTTCGGCTGAGCGC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1165621458 19:37251992-37252014 GCCTGCCTAACCCTCCTGACTGG 0: 1
1: 0
2: 1
3: 71
4: 1620
1165621453_1165621461 21 Left 1165621453 19:37251952-37251974 CCTTGGGATGTTCGGCTGAGCGC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1165621461 19:37251996-37252018 GCCTAACCCTCCTGACTGGAGGG 0: 1
1: 0
2: 1
3: 92
4: 4033
1165621453_1165621465 28 Left 1165621453 19:37251952-37251974 CCTTGGGATGTTCGGCTGAGCGC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1165621465 19:37252003-37252025 CCTCCTGACTGGAGGGTCAGCGG 0: 1
1: 0
2: 3
3: 22
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165621453 Original CRISPR GCGCTCAGCCGAACATCCCA AGG (reversed) Intergenic
917067918 1:171117168-171117190 GGGCAAAGCCCAACATCCCATGG + Exonic
921672908 1:217946264-217946286 GCGCTGAGCTGAACAGCTCATGG - Intergenic
924070616 1:240274611-240274633 GCACTCAGCAGAGCATCCCTTGG - Intronic
1062879319 10:965257-965279 GTGCTCAGCGGAACGTCCCAAGG + Intergenic
1069521198 10:69123493-69123515 GCGCTCCCCCGAAAGTCCCACGG - Exonic
1076252618 10:128996074-128996096 GCTCTCAGCCAGCCATCCCACGG + Intergenic
1077064661 11:635754-635776 GCGCCCAGCCGGAGACCCCAGGG + Intergenic
1095865212 12:46964331-46964353 GCATTCAGCCAAACCTCCCAAGG + Intergenic
1102476956 12:113195040-113195062 GCCCTCAGCCTCACATTCCAGGG - Intergenic
1116020301 14:39452798-39452820 GCCCTCAGCCCAAAATCACAGGG - Intergenic
1120792851 14:88600831-88600853 GGGCTCAGCAGTACATACCAAGG - Intronic
1122955276 14:105067489-105067511 GAAGTCACCCGAACATCCCACGG + Intergenic
1126376962 15:48006409-48006431 GCTCTCAGCCAACCACCCCATGG - Intergenic
1141705052 16:85660176-85660198 GCGCTCATCCGCACTTTCCATGG - Intronic
1142979604 17:3663978-3664000 GCCCCCAGCCTAACATCCCAGGG + Intronic
1143110535 17:4550372-4550394 GCGCTGAGCCCACCAGCCCAGGG + Intronic
1165621453 19:37251952-37251974 GCGCTCAGCCGAACATCCCAAGG - Intergenic
925052832 2:830608-830630 GGGCTCAGCCGAACACAGCAAGG - Intergenic
934807270 2:97243492-97243514 GCTCTCAGCTGAATATCCCCTGG + Intronic
934830239 2:97513695-97513717 GCTCTCAGCTGAATATCCCCTGG - Intronic
947197060 2:227578824-227578846 GTGCTCAGCCTCATATCCCATGG + Intergenic
948840882 2:240648316-240648338 CCTCCCAGCAGAACATCCCAGGG + Intergenic
1171223471 20:23421297-23421319 GCGCTCACCCAAACAGCCCTCGG + Exonic
1172055409 20:32151052-32151074 GCTCGCAGCAGAACCTCCCAGGG + Intronic
1172106936 20:32522605-32522627 GCCCTCAGCAGAGCAGCCCAGGG + Intronic
1175627752 20:60503049-60503071 GCGCTCATCAAAACTTCCCAGGG + Intergenic
1176369753 21:6055705-6055727 GCACACAGCAGAAAATCCCAAGG - Intergenic
1178628159 21:34235872-34235894 GTGTTCAACAGAACATCCCAGGG - Intergenic
1179753766 21:43482836-43482858 GCACACAGCAGAAAATCCCAAGG + Intergenic
953417003 3:42728273-42728295 GTGCTCATCCCAGCATCCCAGGG - Intronic
969831859 4:9804423-9804445 CTGCTCAGCTGAACAGCCCATGG - Intronic
972715414 4:41641148-41641170 GCCCTCATCCCAACAGCCCAAGG + Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
1002536578 5:179879344-179879366 GCGCTGAGCCACACCTCCCAAGG + Intronic
1016545194 6:145213989-145214011 GCCCAAAGCCTAACATCCCAGGG + Intergenic
1016914790 6:149234601-149234623 GCTGTCAGCCAGACATCCCAGGG + Intronic
1036922983 8:12875577-12875599 GTGATCAGCCGAACCTCCCCTGG - Intergenic
1040772500 8:50994516-50994538 GCGTTCAGCAGAAAATACCAAGG - Intergenic
1041734415 8:61094709-61094731 GCCCTCAGCAGAACTTCCCTTGG - Intronic
1049183300 8:141234644-141234666 GCGCGCAGGAGAATATCCCACGG - Intronic
1053281459 9:36822675-36822697 GTGATTAGCCAAACATCCCATGG + Intergenic
1054771796 9:69090370-69090392 GGGCTCATCCTAACATCCCCAGG - Intronic
1186363956 X:8872456-8872478 GGGCTCACCCGGACAACCCAGGG - Intergenic