ID: 1165634408

View in Genome Browser
Species Human (GRCh38)
Location 19:37328459-37328481
Sequence GGTGGGTTAGTTATCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 2, 2: 3, 3: 13, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1165634400_1165634408 0 Left 1165634400 19:37328436-37328458 CCCTCATGAATGGATGAAGGTAG 0: 1
1: 2
2: 7
3: 86
4: 492
Right 1165634408 19:37328459-37328481 GGTGGGTTAGTTATCTTGGGAGG 0: 1
1: 2
2: 3
3: 13
4: 110
1165634401_1165634408 -1 Left 1165634401 19:37328437-37328459 CCTCATGAATGGATGAAGGTAGG 0: 1
1: 0
2: 2
3: 20
4: 236
Right 1165634408 19:37328459-37328481 GGTGGGTTAGTTATCTTGGGAGG 0: 1
1: 2
2: 3
3: 13
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165634408 Original CRISPR GGTGGGTTAGTTATCTTGGG AGG Intronic
900714558 1:4135849-4135871 AGTGGGTTAGTGATCATGGGAGG + Intergenic
900714598 1:4136109-4136131 AGTGGGTTAGTGATCATGGGAGG + Intergenic
900714614 1:4136209-4136231 AGTGGGTTAGATATCATGAGTGG + Intergenic
901136951 1:7003667-7003689 GGTAGGTTGGTGATCATGGGAGG + Intronic
903476249 1:23620859-23620881 AGTGGGTGAGTTGTCCTGGGAGG - Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
904965940 1:34372626-34372648 GGGGGGTTTGTTTTCTAGGGAGG - Intergenic
906046600 1:42835760-42835782 GGTGGGTAAGTGTTCTTGGCTGG + Exonic
908700878 1:66898515-66898537 AGTGGATTAGTTATCATGAGAGG + Intronic
912210184 1:107548532-107548554 AGTGGGTTAATTATGTTTGGAGG - Intergenic
913609509 1:120496434-120496456 GGTGGGTGATTTATTTCGGGTGG - Intergenic
914204311 1:145514082-145514104 GGTGGGTGATTTATTTCGGGTGG + Intergenic
914483434 1:148087270-148087292 GGTGGGTGATTTATTTCGGGCGG + Intergenic
914581682 1:149025410-149025432 GGTGGGTGATTTATTTCGGGTGG + Intronic
917026760 1:170651915-170651937 AATGGGTTAGTTATCATGAGAGG - Intergenic
917871204 1:179243585-179243607 AGTGGGTTAGTTATCAAGAGTGG + Intergenic
919167796 1:193918176-193918198 GGTGGGTTAGTGGTCTTGCTGGG + Intergenic
920094267 1:203475752-203475774 GGTGGGGAGGTTAGCTTGGGGGG - Intergenic
921973534 1:221176782-221176804 GCTGGCTTTGTAATCTTGGGTGG + Intergenic
922816474 1:228452924-228452946 GGCTGGTTTGTTATCTTGGCAGG + Intergenic
1068117026 10:52746889-52746911 GGTGGATGAGTTATATGGGGTGG - Intergenic
1070311974 10:75280523-75280545 GGTGGGCTTGGTATCTTGGAGGG + Intergenic
1075635267 10:124026361-124026383 AGTGAGTTAATAATCTTGGGTGG + Intronic
1083523868 11:63342518-63342540 AGTGGGTTAGTAATCATGGGAGG - Intronic
1084942223 11:72618864-72618886 GGTGGGCTGTTTATGTTGGGAGG - Intronic
1092625474 12:10322537-10322559 GGTGGGTAAGAGCTCTTGGGAGG - Intergenic
1100096291 12:91041731-91041753 GGTGTGTTAGCTTTCTAGGGCGG - Intergenic
1100962375 12:99977046-99977068 AGTGGGTTAGGTGTCATGGGAGG - Intronic
1101810378 12:108102718-108102740 GGTGGCTTCGTTGTCTTGGTGGG - Intergenic
1104087514 12:125490056-125490078 GATGTTTTAGTTATGTTGGGGGG + Intronic
1104922510 12:132298466-132298488 AGTGGTTTGGTTATCTCGGGTGG - Intronic
1104922634 12:132299074-132299096 AGTGGCTTGGTTATCTCGGGTGG - Intronic
1110583397 13:77158791-77158813 GGTGTGTCTGTTCTCTTGGGTGG + Intronic
1110817108 13:79874140-79874162 TGTGGCTAAGTTATTTTGGGGGG + Intergenic
1111309042 13:86457383-86457405 TGAAGGTGAGTTATCTTGGGTGG - Intergenic
1112885525 13:104166226-104166248 GGAGGGGTAGTGATCTTAGGGGG - Intergenic
1113214273 13:108020049-108020071 GGTGGCTCAGTGATCTAGGGTGG - Intergenic
1116532814 14:45993624-45993646 GGAGGGGTATTTATCTTGGGAGG + Intergenic
1117286956 14:54295111-54295133 AGTGGGTTAGTTATCATGAGTGG - Intergenic
1118456699 14:65951459-65951481 GCTGGGTCAGTTCTCATGGGAGG - Intergenic
1118791165 14:69094326-69094348 GGTGGGTCAGGGAGCTTGGGTGG - Intronic
1118825322 14:69374914-69374936 AGTGAGTTAGTTATCATGAGTGG - Intergenic
1120224377 14:81774076-81774098 GCTGGGATATTTATCTTGGTTGG + Intergenic
1121179310 14:91916549-91916571 GGAGAGTTAGTTTTCTTTGGGGG + Intronic
1121613389 14:95296271-95296293 AGTGGGTTAGTTATCACAGGAGG - Intronic
1122703979 14:103608583-103608605 GGTGGGCTGGTAACCTTGGGAGG + Intronic
1126394839 15:48203795-48203817 GGTGCCTTAGTTTTTTTGGGGGG + Intronic
1126519338 15:49573552-49573574 AGTGGGTTTGTTATCATAGGAGG + Intronic
1126952740 15:53899937-53899959 GGTGGGGTAGTTATCTGTTGGGG - Intergenic
1132138405 15:99367481-99367503 AGTGGGTTAGTTATCGTGGGAGG - Intronic
1137905351 16:52316131-52316153 GGTGGTATGGTTATTTTGGGGGG + Intergenic
1141461246 16:84179915-84179937 GGTGGGGGAGTGAGCTTGGGGGG - Intronic
1142051564 16:87961811-87961833 GGTGGGTTAGTGATCATGACAGG + Intronic
1150301509 17:64050907-64050929 GGTGGGTCAGTCATCTTGAGTGG - Intronic
1159064305 18:63552804-63552826 GGTTGCTTGGTTATTTTGGGGGG - Intergenic
1165521359 19:36316764-36316786 AGTGGGTTAGTTATCTTGGGAGG - Intergenic
1165622702 19:37261825-37261847 AGTGGGTTAGTTATCTTGGGAGG + Intergenic
1165634408 19:37328459-37328481 GGTGGGTTAGTTATCTTGGGAGG + Intronic
1166055929 19:40288824-40288846 AATGGCTTAGTTATCTTTGGGGG + Intergenic
929408029 2:41665626-41665648 AGTGGGTTAGTTATTGTGGGAGG - Intergenic
931883429 2:66590417-66590439 GGTGGGTTAGCTTTCTTCTGGGG - Intergenic
933963444 2:87418897-87418919 GCTGGTTTAGCTGTCTTGGGTGG - Intergenic
934245025 2:90298390-90298412 GCTGGTTTAGCTGTCTTGGGTGG - Intergenic
934263717 2:91498639-91498661 GCTGGTTTAGCTGTCTTGGGTGG + Intergenic
934917740 2:98313975-98313997 GGTGTGTTAGTTGTTTTGGTGGG - Intergenic
935558257 2:104534125-104534147 GGTGGGTTATTTAGTGTGGGAGG - Intergenic
937039702 2:118811347-118811369 GGTGGGTGAGTTACAGTGGGTGG - Intergenic
941778276 2:169416474-169416496 GGTGGGGTAGTTATCCTGCATGG - Intergenic
1169293483 20:4372568-4372590 AGTGGGTGACTTCTCTTGGGAGG - Intergenic
1170330223 20:15201285-15201307 GGTATGTTAGATATCTGGGGAGG - Intronic
1176189526 20:63801656-63801678 GGTGGGTTCGTGGTCTTGGCTGG - Intronic
1177323810 21:19557087-19557109 GGTGGGTAAGTTAATTTAGGTGG - Intergenic
1177356029 21:20009062-20009084 GGTGGGTTAGTTATCAGGAGAGG - Intergenic
1178249910 21:30992642-30992664 GGTCGGTTGGTTGTTTTGGGGGG + Intergenic
1178508093 21:33179470-33179492 GGTGGGAGATTTATTTTGGGAGG - Intergenic
1181041793 22:20195749-20195771 GGTGGGGTAATGATGTTGGGTGG + Intergenic
1182130324 22:27845675-27845697 GGTGGTTTTGTTAGCGTGGGGGG - Intergenic
1183578874 22:38710882-38710904 GGTGGGTTAATTGCCATGGGTGG - Intronic
1184765057 22:46567874-46567896 AGTGGGTTAGTTATCATAGGAGG - Intergenic
1184765074 22:46567952-46567974 AGTGGGTTAGTTATCATAGGAGG - Intergenic
950409269 3:12824471-12824493 AGTGGGTCAGTGATCATGGGAGG - Intronic
952685035 3:36137355-36137377 ATTGGGTTACTTTTCTTGGGTGG + Intergenic
953234120 3:41091322-41091344 GGAGGTTTAAGTATCTTGGGAGG + Intergenic
953731197 3:45449484-45449506 TGTGGGTTAGTTATCAAGAGTGG - Intronic
956220245 3:66894614-66894636 GCTGGGGAAGTTCTCTTGGGTGG - Intergenic
958614959 3:96481494-96481516 AGTTGGTTAGTTATCCTGAGTGG - Intergenic
960039733 3:113138745-113138767 GGTGGGTTAATTTGCTTGGCTGG - Intergenic
964336186 3:155657148-155657170 TGTGGGTTACTCATCTTGGTTGG - Intronic
968399761 4:283125-283147 AGTGGGTTAGTCATCATGAGTGG + Intronic
972286760 4:37656694-37656716 AGTGAGTTAGTTCTCATGGGAGG + Intronic
972857916 4:43130496-43130518 GGTGGGTTTTTAATCATGGGGGG - Intergenic
974257926 4:59486338-59486360 AGTGTGTTTCTTATCTTGGGAGG + Intergenic
975455768 4:74588004-74588026 GTTGTGTAAATTATCTTGGGTGG + Intergenic
975860536 4:78672032-78672054 GGAGAGGTAGTAATCTTGGGGGG - Intergenic
978723445 4:111942154-111942176 AGTGGGTTAGTTATCTCAGGAGG - Intergenic
991464769 5:66899220-66899242 GGTTGGCTTGTTTTCTTGGGTGG + Intronic
994698889 5:103108026-103108048 AGTGGGATATTTATCTTGGAAGG - Intronic
996512941 5:124337878-124337900 GATAGGTTAGTTATCATGGGAGG - Intergenic
999356250 5:150934845-150934867 AGTGGGTTAGTTTTCGTGAGAGG + Intergenic
999908497 5:156169852-156169874 GGTGGGTTAGTCATGGGGGGTGG + Intronic
1000473114 5:161671123-161671145 AGTGGGTTAGTTATCATGGGAGG - Intronic
1002721937 5:181266797-181266819 GGTGGTTTTGTTCTTTTGGGGGG - Intergenic
1002979464 6:2121812-2121834 GGTGGGGTAGTGATGGTGGGTGG - Intronic
1003757437 6:9137525-9137547 AGTGAGTTAGTTATCTCAGGAGG + Intergenic
1004265808 6:14147716-14147738 GGAGGCTTAGTTCTCTTGGGGGG + Intergenic
1008119494 6:47595914-47595936 GGTGGAGTAGGTTTCTTGGGTGG - Exonic
1017815763 6:158015443-158015465 TGAGGATTAGTTTTCTTGGGTGG + Intronic
1018154740 6:160975154-160975176 AATGGGTTTGTTATCCTGGGAGG + Intergenic
1021874660 7:25037230-25037252 GGTGGGTTAGGTCACTTGGTGGG + Intergenic
1028988100 7:97023530-97023552 AGAGGGTTAGTGAGCTTGGGCGG - Intronic
1031295567 7:119998181-119998203 GGTGGGCTAGATATCTTGGGAGG + Intergenic
1032894288 7:136233761-136233783 GGAAGGTTAGTTTGCTTGGGGGG - Intergenic
1035887265 8:3305490-3305512 AGTGGGTTAGCTATAGTGGGAGG + Intronic
1037749260 8:21669624-21669646 GCTGGTTTTGTTATCTCGGGTGG - Intergenic
1044343892 8:91080395-91080417 GGTAGGTTTGTTATATAGGGAGG + Intronic
1044573488 8:93744643-93744665 GGTGGATTTGTTAGCTTGGAAGG - Intergenic
1044720094 8:95136938-95136960 GGGGAGAAAGTTATCTTGGGTGG - Intronic
1047089183 8:121555052-121555074 GGTTGGTTAGATATCTTTGCTGG - Intergenic
1047981959 8:130192579-130192601 GGTGGGTAAGTAAGGTTGGGGGG + Intronic
1050477141 9:6051822-6051844 AGTGAGTTAGTTCTCATGGGAGG - Intergenic
1050928514 9:11296704-11296726 GGTGGGTTGGTCATGTTGGCAGG + Intergenic
1054486944 9:65735637-65735659 GGTTGGTTATTTATCTGGGACGG - Intergenic
1060533982 9:124368231-124368253 GGAGGTTTTGTTTTCTTGGGTGG - Intronic
1061053498 9:128209544-128209566 GGTGTGTTTGTTATGGTGGGAGG - Intronic
1062028931 9:134353238-134353260 GGTGGGCTTGTTTTCTTCGGTGG + Intronic
1190247060 X:48697358-48697380 GGTGACTCAGTTATGTTGGGGGG + Intronic
1192670352 X:73133499-73133521 GGTGAGATAGTTGTTTTGGGTGG - Intergenic
1195747585 X:108134462-108134484 GGAGGTTTAGTTGTCTAGGGAGG - Intronic
1197659409 X:129153883-129153905 GATAGGTGTGTTATCTTGGGTGG - Intergenic