ID: 1165636927

View in Genome Browser
Species Human (GRCh38)
Location 19:37348084-37348106
Sequence ACGGAGAAGACAAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 370}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165636927 Original CRISPR ACGGAGAAGACAAATGAGGA AGG (reversed) Intronic
902792455 1:18778528-18778550 ACGGAGGACAGAAATGAGGTAGG - Intergenic
902896718 1:19484954-19484976 ATGGAGAAGGCAAAGGGGGAGGG + Intronic
903295338 1:22339828-22339850 AAGGAGAAGACAAATCAACAAGG - Intergenic
903731603 1:25500420-25500442 AGGGAGAAAACAAATGAGAATGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906285749 1:44586697-44586719 ACGTAGAAGACAGAGGAGAAAGG + Intronic
906810009 1:48817098-48817120 ACTGGGAAAAAAAATGAGGAGGG + Intronic
906831593 1:49037484-49037506 AAGTAGAAGCCAAGTGAGGAGGG - Intronic
908312878 1:62903081-62903103 AGGGAGAAAGCAAATGAAGATGG - Intergenic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
910376638 1:86579264-86579286 AAGGAAAAGACAAGTGAAGAAGG + Intronic
911265638 1:95740123-95740145 AAGAAGAAAACAAATAAGGAAGG - Intergenic
911660738 1:100498902-100498924 ATGGAAAACACAAGTGAGGAGGG - Intronic
912781234 1:112550297-112550319 ACTCAGAAAATAAATGAGGAAGG - Intronic
912856093 1:113169896-113169918 CCGGAGAAGACAGATTTGGAAGG - Intergenic
912997814 1:114549253-114549275 ACCGAGAAAACCAAGGAGGAAGG - Intergenic
913016523 1:114742292-114742314 ACAAATAAGACAAATGAGGCCGG + Intronic
915123753 1:153649169-153649191 ACAGAGAAGAGAAAGGAGGTGGG + Intergenic
915274277 1:154777233-154777255 ACCGAGAACACAGATGAGGCAGG - Intronic
916802943 1:168231611-168231633 AAGGAAAAGACAGAGGAGGAAGG - Intronic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG + Intronic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920791553 1:209097642-209097664 AGGCAGAAGAGAAAAGAGGAAGG - Intergenic
921326477 1:213989570-213989592 ACTGGGAAGACTAGTGAGGAGGG + Intronic
922507338 1:226134170-226134192 TGGGAGAAGACACATGGGGAAGG - Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
924064865 1:240210639-240210661 ACTGAGAAGACAAATAACAATGG + Intronic
924628755 1:245717119-245717141 AGGGAGGAGAGAAAAGAGGAGGG + Intergenic
1063312576 10:4968409-4968431 ACGGATAAGAAAGATGAGGTAGG + Intronic
1063315357 10:4999155-4999177 ACGGATAAGAAAGATGAGGTAGG - Intronic
1063695021 10:8326529-8326551 ACGGAGGGGACAAGAGAGGAGGG - Intergenic
1065681353 10:28236564-28236586 ACGGAGAAAAAAAATGAGATCGG + Intronic
1065695045 10:28371972-28371994 AGAGAGAGGAGAAATGAGGAGGG + Intergenic
1069549930 10:69356586-69356608 ACATAAAAGACAAATGAGGCCGG + Intronic
1070308211 10:75252718-75252740 ACAGAGAACACAAGTGAAGATGG - Intergenic
1070421722 10:76243989-76244011 ATGGAGAAGAGATATGAAGATGG + Intronic
1070838909 10:79469574-79469596 CCGTGGAAGACAGATGAGGAAGG + Intergenic
1071148994 10:82610697-82610719 AAGAAGAATACAAATGAGTAAGG - Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071455960 10:85851881-85851903 AGGGAGAAAAAAATTGAGGATGG - Intronic
1071492556 10:86145760-86145782 ATAAAGAACACAAATGAGGAAGG - Intronic
1071807737 10:89142760-89142782 AAGGAGAAGAGAAAGGAGAAGGG + Intergenic
1073204256 10:101760466-101760488 ACAGAGAAGACAGACGAGAATGG - Intergenic
1073476242 10:103755980-103756002 AGGGAGGAGGCAAATGTGGAGGG - Intronic
1074081264 10:110169836-110169858 AGGGAGAAGGGAGATGAGGAGGG - Intergenic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075957248 10:126534672-126534694 ACGGAGTAGAAAAATGAAGGTGG - Intronic
1076566861 10:131404767-131404789 ACAGAGCAGACAAATGGAGATGG + Intergenic
1077036155 11:495499-495521 ACGGGTCAGACAAAAGAGGATGG + Intronic
1077372768 11:2191242-2191264 AGGGAGAAAGCAAAGGAGGAAGG + Intergenic
1078236315 11:9488037-9488059 ACTGAAAAGACAAATGAGGTAGG - Intronic
1078442253 11:11377788-11377810 GAGGAAAAGACAGATGAGGATGG + Intronic
1078941834 11:16014992-16015014 ACGGGAAAGTCAAATGAAGATGG - Exonic
1079206155 11:18416723-18416745 ACGGAGAAGGGAAAGGGGGAAGG - Intronic
1079373210 11:19869831-19869853 GCAGAGAAGAACAATGAGGAAGG + Intronic
1081331120 11:41801332-41801354 AAGGAGAAAACAAATGTGGGTGG - Intergenic
1081867406 11:46367263-46367285 GAGGAGAAGACAGCTGAGGAGGG - Intronic
1083770008 11:64861646-64861668 ATGGATAATACAAATGAGCATGG - Intronic
1084085292 11:66852317-66852339 ACGAAGAACACCAAAGAGGAAGG - Intronic
1085753961 11:79188647-79188669 AAGCAGAAGAGAAGTGAGGATGG + Intronic
1086502192 11:87464819-87464841 GAGGAGAAGACACATGGGGAGGG + Intergenic
1086778906 11:90877883-90877905 ACTGAAAAGACAAATGAAGCTGG - Intergenic
1087937703 11:104054608-104054630 GGGGAGAAAACAAATGAAGATGG + Intronic
1088622024 11:111694811-111694833 AAGGGGAAGAGAAATGAAGAGGG - Intronic
1088922731 11:114272931-114272953 ACAGATAAAACAAATGAGCAGGG + Intronic
1089225559 11:116917787-116917809 AAGGAGAGGACAAGAGAGGAAGG + Intronic
1089233292 11:116999724-116999746 AGGGAGAAAACAAATGAAAATGG - Intronic
1089476934 11:118771611-118771633 AGGGAGAAGGCAAAGGAGGAAGG + Intronic
1089872121 11:121684866-121684888 AGGGTGAAGACACATGAGGAAGG + Intergenic
1090003859 11:122983665-122983687 ACGGAGGAGACTGGTGAGGAGGG + Intergenic
1090249474 11:125241347-125241369 ACAGAGGAGATAAATGAGCAAGG - Intronic
1090510632 11:127371065-127371087 ATGGAGAAGAGAGATGAGAAAGG - Intergenic
1092112976 12:5977050-5977072 ACTGAGAAGATAAATGATAATGG - Intronic
1092719801 12:11430603-11430625 AGGGAGAAGACAAGGGAGGGAGG - Intronic
1093745151 12:22731740-22731762 ATGTCAAAGACAAATGAGGAGGG + Intergenic
1095969824 12:47894069-47894091 AGGGAGATGACAAATGGGTAGGG - Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096553474 12:52389442-52389464 ACAGAGAAGAAAAGGGAGGAAGG - Intergenic
1098017834 12:66125182-66125204 ATGTAGAAGATAAATGAGAAGGG + Intronic
1098564557 12:71918324-71918346 ACGTAGAAGACAAATGTATAGGG + Intronic
1100324926 12:93531649-93531671 AGGGAGAAGACACATGGAGAAGG - Intergenic
1100950704 12:99846274-99846296 ACAGAGAAGAGAGAAGAGGAGGG - Intronic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102997182 12:117360154-117360176 ACGGAGAAGGCAGCCGAGGAGGG - Intronic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104606124 12:130189696-130189718 AAAGAGAAGAGTAATGAGGAGGG - Intergenic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1106436459 13:29727706-29727728 AGGAAGAAGACAAACGAGAATGG - Intergenic
1106720518 13:32430330-32430352 AGAGAGAAGACAGCTGAGGAAGG + Intergenic
1107481027 13:40786458-40786480 ATGGAGAGGAGAAATGTGGAAGG + Intergenic
1107659185 13:42621750-42621772 AAGCAGAAGAGAAAGGAGGAAGG + Intergenic
1108014024 13:46054271-46054293 ACCAAGTAGACAAATGAGGAAGG - Intronic
1109106201 13:58253544-58253566 GCAAAGAAGAAAAATGAGGAGGG - Intergenic
1109132084 13:58599968-58599990 AAAGAGAAGAAACATGAGGATGG - Intergenic
1109187666 13:59289761-59289783 GCTGAGAAGACAAAAGAGGTAGG - Intergenic
1110259676 13:73471425-73471447 ACGGAGAAGACTGAAGAAGATGG + Intergenic
1110873992 13:80487257-80487279 CTGGAGAAGATAAATGTGGATGG + Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1112980514 13:105378946-105378968 CCAGAGAAGACGAATAAGGATGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1114920083 14:27315276-27315298 AGGAATAAGACAAATGAGAAAGG + Intergenic
1115593591 14:34887552-34887574 ACGGAGAAAACAAATGCCGGTGG - Intergenic
1115714765 14:36091114-36091136 ATGGAGTAAACAAATGAAGAGGG - Intergenic
1115915432 14:38307467-38307489 ACAGAGAAGACTTATGAGCAAGG + Intergenic
1116171063 14:41403275-41403297 ACGAAGAAAACAAGGGAGGAAGG + Intergenic
1116761692 14:49022758-49022780 AAGGACAAGGCAACTGAGGAAGG - Intergenic
1118333469 14:64832396-64832418 ACAGAGCAGGCAAAGGAGGAAGG - Intronic
1118969032 14:70616356-70616378 ACTGGGGAGAGAAATGAGGAAGG + Intergenic
1119041514 14:71278711-71278733 AGGGAGAAGAAAAGAGAGGAAGG + Intergenic
1119055105 14:71411474-71411496 AGAGAGAAGACAACTGGGGAAGG - Intronic
1119084867 14:71730431-71730453 AGAGAGAGGGCAAATGAGGAAGG - Intronic
1119886873 14:78150915-78150937 AGGGAGGAGAAAAATGATGAGGG - Intergenic
1120815675 14:88855274-88855296 AAGGAGATGAAAAATGAAGAAGG - Intronic
1121976942 14:98413602-98413624 GTGGAAAAGACAAATGAGGGGGG + Intergenic
1124179812 15:27462053-27462075 ACGAGGAAGACAACTGAGCAAGG - Intronic
1124493003 15:30169640-30169662 AAGGAGAAAACAAACGAGGGGGG + Intergenic
1124750531 15:32368685-32368707 AAGGAGAAAACAAATGAGGGGGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125800087 15:42438084-42438106 CCGGATAAGACAGATGAGAAAGG + Intronic
1126869863 15:52976377-52976399 ACGGCAAAGTCAAATGTGGATGG + Intergenic
1127761115 15:62139985-62140007 AAGGTGAAGACAAATGCTGAGGG - Intergenic
1127762634 15:62153962-62153984 AGGTAGAAGAAAAATGGGGAAGG + Intergenic
1127886560 15:63206633-63206655 ACAGAGAAGACAGATGACGGAGG - Intronic
1129950157 15:79579353-79579375 AATGAGAAGATAAATGAGAAGGG - Intergenic
1131321113 15:91392103-91392125 CTGGAGAAGACAAATATGGATGG + Intergenic
1133572359 16:7054072-7054094 ACAGAGAACAAAAATGAAGAGGG - Intronic
1134291726 16:12907069-12907091 AAGGAAAAAACAAAGGAGGAAGG - Intronic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1135637683 16:24093057-24093079 ATGGAGAAGACAGAAAAGGAGGG - Intronic
1136786550 16:32938535-32938557 ACGGAGCAGTCATAGGAGGAGGG - Intergenic
1136883218 16:33915259-33915281 ACGGAGCAGTCATAGGAGGAGGG + Intergenic
1137507145 16:49064008-49064030 ACAGATAAGAAAAATGAGGCTGG + Intergenic
1137946878 16:52741701-52741723 ACCGATAAGACAAATTAAGACGG + Intergenic
1140657040 16:77151687-77151709 AAGGAGAGGAAAAATGAGAATGG - Intergenic
1141796325 16:86277786-86277808 ACTGAGAAGTCAAATGACCAGGG + Intergenic
1144262491 17:13536130-13536152 TGGGAGATGACAAATGAGAATGG - Intronic
1145086609 17:19947273-19947295 ACTCAGAAAACAAATTAGGAAGG + Intronic
1146490618 17:33278893-33278915 AAGGAGATGACAGCTGAGGAAGG + Intronic
1147146895 17:38490667-38490689 ACGGAGCAGTCATAGGAGGAGGG - Intronic
1147374637 17:40016354-40016376 AAGGATAAGGCTAATGAGGAGGG + Intronic
1147881567 17:43657561-43657583 AAGGAGATGGCAAAGGAGGAAGG + Intronic
1148628663 17:49089889-49089911 CTGGAGAAGACATATGTGGATGG + Intergenic
1150273747 17:63882800-63882822 GAGGAGGAGACAAAAGAGGAGGG - Intergenic
1150535520 17:66035393-66035415 CAGGTGAAGACAAATAAGGATGG - Intronic
1150631742 17:66884956-66884978 AGGGAGAAGACAGCAGAGGATGG - Intronic
1151090287 17:71431603-71431625 ACAGAAAATACAAATTAGGAAGG - Intergenic
1151389722 17:73777814-73777836 ACAGAGAAGAAAACTGAGGTAGG - Intergenic
1152099457 17:78292520-78292542 ATGGAGAGGGCAGATGAGGAGGG - Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153901347 18:9619858-9619880 ACAGAGAAGTGAAATGAGAATGG - Intergenic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1155242515 18:23877116-23877138 TTGGAGAAGACAGATGAGGGAGG + Intronic
1155758531 18:29533729-29533751 ATGGAAAAGACAAGAGAGGATGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156134265 18:34017771-34017793 ACGCAGAAGAAAAATCAGAAGGG - Intronic
1156232366 18:35165958-35165980 ATGGAAAAGAAAAAGGAGGATGG + Intergenic
1157331883 18:46710219-46710241 AGTGAGAAGACAAATGCAGAAGG + Intronic
1157763301 18:50280702-50280724 AAGGAGAAGAAAAATAAGGGGGG - Intronic
1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG + Intergenic
1158585743 18:58732723-58732745 ATGGAGGAGACAAATGAGTCAGG + Intronic
1159238073 18:65703426-65703448 AGGGAGAAGAGAAACAAGGAGGG + Intergenic
1159402322 18:67954471-67954493 TTGGAGAAGACAAAAGGGGATGG + Intergenic
1159850340 18:73519906-73519928 AAGCAGATGACAAATGAGGTAGG - Intergenic
1160035477 18:75297746-75297768 ACAGAGAAGATAGAAGAGGAAGG + Intergenic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1161288139 19:3479193-3479215 ACGGAGTTTACAAATCAGGAGGG + Intronic
1161847308 19:6719119-6719141 AGGGAGAAGACAGAAGGGGAGGG + Intronic
1162203745 19:9040206-9040228 AGGGAGAAGATAGAAGAGGAAGG + Intergenic
1163322571 19:16583212-16583234 AGGGAGAATCCAAAGGAGGAGGG - Intronic
1164455303 19:28401899-28401921 AGGGAGAAGACAAAAGAAAACGG - Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167298028 19:48663292-48663314 GGGCAGAAGACAAATGGGGAGGG - Intronic
925703215 2:6659506-6659528 ACGGAGCAGTCACATGAGCAAGG + Intergenic
925984389 2:9204307-9204329 AAGGCGAAGAAAAAGGAGGAAGG - Intergenic
926097411 2:10091208-10091230 AAGCAGAAGAAAAATGAGAAGGG + Intergenic
926546383 2:14245541-14245563 AGTGAAAAGACAAATCAGGAGGG - Intergenic
926783199 2:16494579-16494601 GCTGAGAAGACAAATGAGTAAGG - Intergenic
926887212 2:17609254-17609276 AAGGAGAAGACAGAGGAGTAGGG + Intronic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927267987 2:21174453-21174475 ACTGAGAAGACTAAGGAGGGAGG - Intergenic
928620012 2:33079248-33079270 ATGGAGAAAACAAATGAATAAGG + Intronic
929593196 2:43160067-43160089 AGGGAGGAGAAAAAGGAGGAGGG - Intergenic
930288652 2:49466516-49466538 ACAGAGAAGACAAAACAGAAAGG - Intergenic
930391226 2:50764051-50764073 ACTGAGGAGACAAGGGAGGAGGG - Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930704517 2:54490969-54490991 ACCCAAAAGACAAGTGAGGAGGG + Intronic
931999789 2:67874159-67874181 ACGAAGAAGACAAAAAAGGATGG - Intergenic
933338319 2:80988227-80988249 ACAGAGGAGACAAAAGAGAAAGG + Intergenic
933744668 2:85561768-85561790 ACGGAGAGGACTAATGGGGTCGG - Intronic
934873072 2:97885873-97885895 AAGGAGAAGAGAAAGGAGAAAGG - Intronic
935489523 2:103699017-103699039 AAGGATAAGAAAAATGGGGAAGG - Intergenic
935917699 2:107973879-107973901 GCAGATAAGAGAAATGAGGAAGG + Intergenic
936401941 2:112171309-112171331 ACTGAGAAGTCAAATGGAGAAGG + Intronic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
936654480 2:114468961-114468983 AAGGAAAAGACAAATGAAAATGG + Intronic
937503582 2:122511105-122511127 ACGTACAAGAAAAATGAGAAAGG - Intergenic
937776212 2:125779024-125779046 ACAGAGAAGACCTATGAGGTAGG + Intergenic
937806152 2:126147979-126148001 ACAGAGAAGATAACTGAGCAGGG - Intergenic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
941382026 2:164805035-164805057 ATCTAGAAGACAAATGATGATGG + Intronic
942296625 2:174523816-174523838 AAGGAAAAAACAAATCAGGAAGG - Intergenic
942854068 2:180524969-180524991 ACTATGAAGACAAATGAGGGAGG - Intergenic
945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG + Intergenic
946580562 2:221124016-221124038 ACGAAGAAAACACATGAGGAAGG + Intergenic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947766648 2:232642086-232642108 ATGAAAAAGACAAATGAGGCCGG + Intronic
947960281 2:234230466-234230488 AGGGAGAAGAGAAATGAGCTTGG + Intergenic
948131691 2:235605514-235605536 AGGGAGAAGATAAATGATGCCGG - Intronic
948281820 2:236752889-236752911 AAGGAGAAGACAGCAGAGGAGGG - Intergenic
949000942 2:241612788-241612810 ACGTAGAAGGCGCATGAGGAGGG + Intronic
1169024156 20:2353370-2353392 ACAGAGAAGAGAAAGGGGGAGGG - Intergenic
1169894789 20:10491414-10491436 ATGGAGAAGACAAAGGAGCAAGG - Intronic
1171340239 20:24421643-24421665 AGGGAGAAAATAAATGAGTAAGG - Intergenic
1171422419 20:25026087-25026109 AGAGGGAAGACAAATGAAGAGGG + Intronic
1171770911 20:29322509-29322531 AGGAAGAAGTCAAATGAGCATGG - Intergenic
1172324900 20:34026735-34026757 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1172788730 20:37487682-37487704 AAGGGGAAGACAAGTGAGGGTGG - Intergenic
1172835333 20:37869675-37869697 ACAGAGAAGACATCTCAGGAGGG + Intronic
1173332935 20:42090423-42090445 ACCCAGAAGATAAAAGAGGAAGG + Intronic
1174709531 20:52690281-52690303 AAGGAGAAGAAAAAGGAGAAGGG - Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175155294 20:56967287-56967309 ACGGAGAAGAAAGAGGAGGCTGG - Intergenic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1175287694 20:57848717-57848739 AGGGAGAAAGGAAATGAGGAAGG - Intergenic
1175836258 20:61996967-61996989 CCGGAGATGGCAAATAAGGAGGG + Intronic
1178213131 21:30560576-30560598 AGGAAGAAGACAAAGGAGAAGGG + Intronic
1178399781 21:32275615-32275637 AGGGTGAAGAGAAATGAAGAAGG + Intronic
1178676046 21:34632601-34632623 ACAGAGAAGTCAAAGGAAGAAGG + Intergenic
1178778721 21:35578486-35578508 ATTCAGAAGACAAATGAGGCAGG + Intronic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181911732 22:26243814-26243836 CCAGAGAAGAAAAATGAGCAGGG + Intronic
1183020905 22:35024942-35024964 AAAGAGAAGACAAAGCAGGAAGG + Intergenic
949767580 3:7544061-7544083 CCAGAGAAGACAAATGAGATAGG + Intronic
950043101 3:9932927-9932949 CCGGAGAAAACAGATGGGGAGGG - Intronic
950718740 3:14867733-14867755 CAGTGGAAGACAAATGAGGATGG - Intronic
951729598 3:25796061-25796083 AAGGAGAAGATAAAGAAGGAAGG + Intergenic
951911652 3:27756214-27756236 ACGGAGATGAAAGAGGAGGAAGG + Intergenic
952259285 3:31724137-31724159 ACGGAAAAGAGAAAAGGGGAAGG + Intronic
952333983 3:32389410-32389432 ACAGAGAAGACACACGTGGAAGG + Intergenic
955655249 3:61238874-61238896 GCAGAGAAGTCAAATCAGGAGGG + Intronic
955961727 3:64347557-64347579 AAGGAAAAGAAAAACGAGGACGG + Intronic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957544938 3:81624981-81625003 ACAGGGAAGACAAAAGAGTAGGG + Intronic
958477005 3:94597305-94597327 TCAGAGGAGAGAAATGAGGAAGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959284384 3:104389755-104389777 ACATAGAATACATATGAGGAGGG + Intergenic
959369061 3:105500275-105500297 AAGGAGATGAGAAAAGAGGAAGG - Intronic
959931672 3:111990972-111990994 ACTGAAAAGAAAAATGAAGAGGG - Intronic
960394240 3:117116999-117117021 TCAAAGAAGACAAATGAGGATGG - Intronic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960846671 3:122010219-122010241 ACAGAGAAGATAAATAAGGCGGG + Intronic
962334468 3:134514375-134514397 AAGGAGAAAAAAAATGAGAATGG + Intronic
962865938 3:139448083-139448105 AGGAAGAAGAGAAAGGAGGAAGG - Intergenic
963129108 3:141841640-141841662 GCTGAGAAGGCAATTGAGGAAGG + Intergenic
963221595 3:142818971-142818993 ACTGAGAAGCCATCTGAGGATGG - Intronic
963905562 3:150771075-150771097 TCGGAGAAGACAGAAGGGGAAGG - Intergenic
964233257 3:154495482-154495504 AGGGAGAGGAGAAATGAGAACGG - Intergenic
965462015 3:168977659-168977681 AAGGGAAAGTCAAATGAGGAAGG + Intergenic
966354412 3:179064416-179064438 AAGGATAAGACCAATGAGTAAGG - Intronic
966767405 3:183475674-183475696 AAGGAGAAGAAAAATGTAGATGG + Intergenic
966829762 3:183997513-183997535 ACAGGGAAGACATAGGAGGAAGG - Intronic
967664887 3:192159085-192159107 AGGAAGTAGAGAAATGAGGAGGG - Intronic
967861998 3:194159453-194159475 AGGGAGGAGACAAAAGAGGTAGG - Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
969089832 4:4685422-4685444 AGGGAGAGGGCAAAGGAGGATGG + Intergenic
969668671 4:8577033-8577055 GCGGAAAAGAGAAAGGAGGAAGG - Intronic
970197736 4:13569206-13569228 ACAGAGAAGAGGAATGAAGAGGG + Exonic
970274619 4:14385141-14385163 TGGGAGAAGAAAAAGGAGGAGGG - Intergenic
971399322 4:26261429-26261451 AAGTAGAAAAGAAATGAGGAAGG + Intronic
972450844 4:39196819-39196841 TTGGAGCAGACAAATGAGGAGGG - Intronic
972649867 4:41006347-41006369 ACTGAGAAGACATAACAGGAAGG + Intronic
972868112 4:43259506-43259528 AAAGAGGAGAGAAATGAGGATGG - Intergenic
973713224 4:53649967-53649989 ACAGAGAAGAAAAAGGAGCAGGG + Intronic
973885773 4:55319417-55319439 ACTAAGAAGAAAAAGGAGGAGGG + Intergenic
975100673 4:70509397-70509419 AAGGAGAAGAGATCTGAGGAGGG + Intergenic
975437099 4:74365409-74365431 AAAGAGGAGACAAATAAGGAAGG + Intronic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976615273 4:87069631-87069653 AAGGAGAAGAGAAAAAAGGAAGG - Intronic
976767295 4:88610601-88610623 ACAGAGAAGACAGACAAGGAGGG - Intronic
976779563 4:88743938-88743960 AAGGAGAAGACAAAATGGGATGG + Intronic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977565601 4:98577404-98577426 TGGGAGAAGGCAAATGATGAGGG - Intronic
977902634 4:102439610-102439632 AGGAAGAAAACAAATAAGGAAGG + Intergenic
978021240 4:103815487-103815509 AAGGAGAAGAAAAAAGAGAAGGG - Intergenic
980643938 4:135617259-135617281 AGGCAGATGTCAAATGAGGAAGG - Intergenic
981116861 4:141001366-141001388 GTAGAGAAGACAAATGAAGAGGG - Intronic
981892194 4:149751859-149751881 ACAGAGAACACAAAGAAGGATGG + Intergenic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
984579031 4:181488387-181488409 ACAGAGATGAGAAATCAGGAGGG - Intergenic
984951271 4:185009490-185009512 AGGGAGAAGGCAAGTGAGGATGG + Intergenic
986857881 5:11892290-11892312 ATCGAGAAGACAAATAAGGTAGG - Intronic
987068072 5:14308900-14308922 ATGGACTAGACAAATGTGGATGG - Intronic
987190883 5:15477198-15477220 AGGGAGAAGGAAAATGGGGAGGG - Intergenic
987442158 5:17968967-17968989 GAGAAGAAGACTAATGAGGAGGG - Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
989813540 5:45708071-45708093 AAGGTCAACACAAATGAGGAAGG - Intergenic
990905266 5:60796184-60796206 AGTGAGAAAACAGATGAGGAAGG - Intronic
992629661 5:78667956-78667978 AAGGGGAAGAAAAAGGAGGAGGG - Intronic
993346923 5:86795719-86795741 AAGGAGAAAACAAAGGAGGAAGG + Intergenic
994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG + Intronic
996391851 5:122970858-122970880 ACAGAGATGAGAAAAGAGGAGGG - Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
999551762 5:152695265-152695287 GCTGAGAAGAAAAATGAGGCTGG - Intergenic
999860494 5:155640510-155640532 AAGGGGAAGAGAAAAGAGGAAGG - Intergenic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
1001685303 5:173590238-173590260 AAGGAAAAGAGAAAAGAGGAAGG + Intergenic
1003040027 6:2679142-2679164 ACCTAGAAGGCAACTGAGGATGG + Intronic
1003140955 6:3470933-3470955 ACGGAGAGGACATATGGGCAAGG - Intergenic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1004199391 6:13533804-13533826 AAGGAGAAGACAGAGGAAGAAGG + Intergenic
1004294458 6:14397563-14397585 GAGGAGAAGGCAATTGAGGAAGG - Intergenic
1004365568 6:15009663-15009685 ACGAGGAAGAGAAAGGAGGACGG - Intergenic
1004948073 6:20637260-20637282 GGGGAGTAAACAAATGAGGAAGG + Intronic
1005377582 6:25199726-25199748 AAGGAGAAGGCACATGAGCAAGG - Intergenic
1006609444 6:35285040-35285062 AGGAAGAAGAGAAATGAGAAAGG - Intronic
1007326006 6:41060123-41060145 AAGGAGAAGAAAAAAGAGAAGGG - Intronic
1008228674 6:48956013-48956035 ACAGAGAAGACCAAACAGGAAGG - Intergenic
1009044449 6:58221110-58221132 ATGGAAAACACAAATTAGGAAGG - Intergenic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1010047982 6:71469801-71469823 GAAGAGAAGGCAAATGAGGAGGG - Intergenic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010909266 6:81533502-81533524 ACAGAAAAGATAAATAAGGAAGG - Intronic
1011869439 6:91874080-91874102 CCAGAGAAGAAAAATGAGGCTGG + Intergenic
1014761175 6:125358348-125358370 AAGGAGGGAACAAATGAGGAAGG - Intergenic
1015333395 6:132007047-132007069 AAGGAGTGGACTAATGAGGACGG - Intergenic
1015434971 6:133174743-133174765 AAGAAGAAGACAAAGGAGAAGGG - Intergenic
1016701157 6:147055825-147055847 ACAGAGAAGAGAAAGGAGGTAGG - Intergenic
1018772223 6:166981007-166981029 ACTCTGAAGACATATGAGGAGGG - Intergenic
1021351569 7:19600630-19600652 ACGGAGAACAGAAAAGAGCAGGG - Intergenic
1023595914 7:41829318-41829340 ACAGAGAAGACAATTCAGGAGGG - Intergenic
1024207793 7:47178647-47178669 ACAGAGAAGAAACATGAGAAAGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026284830 7:68954035-68954057 AGGAAGAAGAAAAATCAGGAGGG - Intergenic
1026451865 7:70536448-70536470 ACGGTGAGGACCAATGAGAAAGG - Intronic
1028304149 7:89241145-89241167 ACGTAGAAGAGATATGAGGCTGG + Intronic
1029320255 7:99752501-99752523 TCAGAGAAGACAGTTGAGGAAGG - Intergenic
1030719133 7:112848625-112848647 AAGGAGAAGACTATTGAGGTGGG + Intronic
1032457258 7:132082790-132082812 ACAAAGAAGAAAAAGGAGGAAGG + Intergenic
1034432992 7:151050259-151050281 AGGGAGCACACAAATGAGGCTGG + Intronic
1035743593 8:1946177-1946199 ATGGAGGAAAGAAATGAGGAGGG + Intronic
1036651603 8:10647485-10647507 GGGGAGAGGAGAAATGAGGATGG - Intronic
1036928498 8:12930642-12930664 ACTGAGAAGAGACATTAGGAGGG + Intergenic
1038547685 8:28438379-28438401 AAGAAGAAGAGAAATGGGGACGG + Intronic
1039327092 8:36497450-36497472 TCAGAGAAGAAAAATGAGAAAGG + Intergenic
1039351613 8:36769878-36769900 GAGGAGCAGCCAAATGAGGAGGG - Intergenic
1040652548 8:49465271-49465293 ACGGAGAAGACACAAGTGGTTGG + Intergenic
1041622978 8:59994930-59994952 ACAGAGAAGGAAAATAAGGAGGG - Intergenic
1042098056 8:65240717-65240739 AAGGAGACCACAAAAGAGGAAGG + Intergenic
1042555816 8:70033116-70033138 AGGGAGAGGAGAAAGGAGGAAGG + Intergenic
1044275461 8:90294392-90294414 AGGTAGAAGAAAAAAGAGGAAGG - Intergenic
1046258734 8:111737466-111737488 ACTGAGAAGTGAGATGAGGAGGG + Intergenic
1046974026 8:120253358-120253380 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1050950249 9:11582033-11582055 ACAGAGAAGTCAAATAATGATGG - Intergenic
1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1053601181 9:39611105-39611127 AAGGAGAAGACCAAGGAGCAGGG - Intergenic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1053858830 9:42364903-42364925 AAGGAGAAGACCAAGGAGCAGGG - Intergenic
1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054252355 9:62731334-62731356 AAGGAGAAGACCAAAGAGCAGGG + Intergenic
1054566470 9:66765833-66765855 AAGGAGAAGACCAAGGAGCAGGG + Intergenic
1054637341 9:67506852-67506874 ATGAAGAAGCCAACTGAGGAAGG - Intergenic
1055240292 9:74176524-74176546 ACAGAGAAGAGCAAGGAGGAGGG - Intergenic
1055664890 9:78543497-78543519 AGGGAGAAGAGAAATGAAGCGGG - Intergenic
1055688796 9:78807949-78807971 AGGGAGAAAATAAATGGGGAGGG - Intergenic
1056395102 9:86174744-86174766 ATGAACAAGACAAATGAGGTGGG - Intergenic
1056523180 9:87418861-87418883 AGGGAGAAGAGAACTGAGCAAGG - Intergenic
1057394482 9:94667535-94667557 ACAGAGAAACCAAAAGAGGACGG + Intergenic
1057426235 9:94952039-94952061 AGGAAGAAGGCAAATGAGAATGG + Intronic
1057640003 9:96810337-96810359 AGGTAGAAGACAAATAAGGAAGG + Intergenic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1058092570 9:100822158-100822180 ACTGAGAGGGCAAATAAGGATGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1059561472 9:115338830-115338852 AAGGAGAAGGGAAATGTGGAAGG - Intronic
1060152580 9:121298372-121298394 ACAGAGAAGACAATTCAGGCTGG - Intronic
1060259837 9:122064760-122064782 AGTAAGAAGACAAAGGAGGAGGG + Intronic
1061563013 9:131418562-131418584 AAGAAGAAGACAAATCAGGCTGG - Intronic
1061689645 9:132315814-132315836 AAGGAGAAATCAAATGATGAGGG - Intronic
1061751607 9:132781936-132781958 ACAGAGATGAGAAAGGAGGAAGG + Intronic
1185613730 X:1407793-1407815 ACAGAGAAGATAAAGGAGGAAGG + Intronic
1186924700 X:14320435-14320457 AAGGAGAAGAGAAACAAGGATGG - Intergenic
1187331491 X:18344306-18344328 ACTGATAAGACAGAAGAGGAGGG - Intronic
1188211624 X:27432424-27432446 AGGGAGAAAACAGAAGAGGATGG + Intergenic
1190146807 X:47900031-47900053 AAGTAGAAGACAAATTAGTAAGG - Intronic
1192474910 X:71432041-71432063 AGAGAGAAGACCAAAGAGGATGG + Intronic
1196699087 X:118646524-118646546 ACGGAGTAGTCAAATAAGAAAGG + Intronic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic
1197421733 X:126243986-126244008 TGGCAGAAAACAAATGAGGATGG - Intergenic
1197636021 X:128915633-128915655 AAGGAAAAGACAGAAGAGGAGGG + Intergenic
1198237303 X:134747345-134747367 GAAGAGAAGATAAATGAGGAGGG + Intronic
1198875939 X:141226503-141226525 ACTGGCAAGACAAATAAGGAAGG - Intergenic
1201629668 Y:16056266-16056288 AAGGAAAAGATAAATGAGCAAGG - Intergenic