ID: 1165637573

View in Genome Browser
Species Human (GRCh38)
Location 19:37355102-37355124
Sequence CTGAGAAAGGGGAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1481
Summary {0: 1, 1: 0, 2: 13, 3: 143, 4: 1324}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1165637573 Original CRISPR CTGAGAAAGGGGAAGGAAGG AGG (reversed) Intronic
900015081 1:142777-142799 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900016684 1:155599-155621 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900045348 1:501386-501408 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900046945 1:514191-514213 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900067545 1:743116-743138 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900069148 1:755909-755931 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
900471963 1:2859488-2859510 GGGAGGAAGAGGAAGGAAGGAGG + Intergenic
900471973 1:2859520-2859542 GGGAGGAAGAGGAAGGAAGGAGG + Intergenic
900471983 1:2859552-2859574 GGGAGGAAGAGGAAGGAAGGAGG + Intergenic
900679898 1:3910971-3910993 ATGAGACAGGGGAACGAAGTCGG + Intergenic
900790452 1:4676479-4676501 CTGAGAAGGGGTAATGCAGGTGG - Intronic
900926664 1:5710316-5710338 CTGAGAGACTGGAAAGAAGGAGG + Intergenic
900968799 1:5977866-5977888 CGGTGAAAGGGAAAGGGAGGGGG + Intronic
901176618 1:7305292-7305314 CTGAAAAAGAGGAATAAAGGTGG - Intronic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
901439039 1:9266332-9266354 CTGAGACTGGGGAAGTAAGCGGG + Exonic
901826414 1:11864676-11864698 CTAAGCAAGGGGAGGGAGGGAGG - Intergenic
901842249 1:11961006-11961028 CAGAGAAAGAGGAAGGACTGGGG + Intronic
902059642 1:13631297-13631319 CTGACAAAGGGCATGGCAGGTGG + Intergenic
902158019 1:14505302-14505324 CTAAGCAAGTGGATGGAAGGAGG + Intergenic
902387311 1:16083303-16083325 CTGAGGAAGGGGCTGGCAGGGGG - Intergenic
902652077 1:17843660-17843682 AAGTGAAAGGAGAAGGAAGGTGG - Intergenic
902688037 1:18091634-18091656 TTGAAAAATGGGAAGGAGGGGGG - Intergenic
902718809 1:18290827-18290849 CGGGGAAAGGGGCAGGGAGGGGG - Intronic
902767296 1:18625855-18625877 TTGAGAAATGGAAAGGAAAGAGG + Intergenic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
903139497 1:21330730-21330752 CTGAGTCAGGGGGAGGAAGAAGG - Intronic
903227885 1:21904156-21904178 GTGCTGAAGGGGAAGGAAGGGGG + Intronic
903331725 1:22600100-22600122 GAGAGAAGGAGGAAGGAAGGAGG + Intronic
903331791 1:22600338-22600360 AGGAGAAAGGAGAAGGAAGTGGG + Intronic
903418518 1:23201367-23201389 CTGGGAGAGGAGAATGAAGGAGG + Intergenic
903552556 1:24168132-24168154 TGGAAAAATGGGAAGGAAGGAGG - Intronic
903799460 1:25955717-25955739 AAGAGAAAAAGGAAGGAAGGAGG + Intergenic
903978883 1:27170904-27170926 CTGAGAGAGGGAAAGGAGTGAGG - Intergenic
903984476 1:27215813-27215835 CTGGGAAAGGGGAGAGAAGGAGG - Intergenic
903985962 1:27228812-27228834 CTAAGAAAGAGGAAGAAAAGAGG - Intergenic
904320904 1:29697371-29697393 CTGAGACAGGGCAGGGGAGGAGG - Intergenic
904351143 1:29907463-29907485 CTGAAAAAAGGTAAGGAAGTTGG - Intergenic
904810033 1:33157484-33157506 CTGACAAAGAATAAGGAAGGGGG - Intronic
904894053 1:33800806-33800828 CTGTAAAAGGGAAAGGAATGAGG + Intronic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905325460 1:37148737-37148759 GGGAGATAGGGGAAGGAGGGAGG + Intergenic
905489366 1:38331680-38331702 CTGAGGAGGAGGAAGGCAGGTGG - Intergenic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
905619947 1:39436359-39436381 GTGAGAGATGGGACGGAAGGTGG - Intronic
905806701 1:40882423-40882445 CTGAGAGATGGGGAGGAGGGGGG + Intergenic
905837712 1:41142591-41142613 CTGAGAGAGAGAATGGAAGGAGG - Intronic
905874100 1:41421450-41421472 CTGGGAAGGGGGAAGAAAGATGG + Intergenic
905939139 1:41848997-41849019 CTGAAGAATGGGAAGAAAGGAGG - Intronic
905943923 1:41885807-41885829 CTCAGAAATAGGAAGGAAGGAGG - Intronic
906066984 1:42988029-42988051 CAGTGAAACGGGATGGAAGGAGG - Intergenic
906227309 1:44132554-44132576 GTGAGAAAATGGAAGAAAGGCGG - Intronic
906534329 1:46543439-46543461 CCGAGACAGGGGAAGCCAGGAGG - Intergenic
906537656 1:46560585-46560607 CTGAGACTGAGGCAGGAAGGTGG - Intronic
906651387 1:47515489-47515511 AGGAGAAAAGGGAAGGATGGTGG + Intergenic
907325410 1:53634897-53634919 ATGAGATGGGGGATGGAAGGCGG - Intronic
907535662 1:55153465-55153487 ATGAGAGAGAGAAAGGAAGGAGG - Intronic
907708153 1:56850634-56850656 AAGAGAAAGTGGAAGAAAGGAGG - Intergenic
907791270 1:57667005-57667027 TTGAGCAAGGAGAAGGATGGTGG - Intronic
907910305 1:58820055-58820077 CTGAGCAACGGCCAGGAAGGAGG - Intergenic
908109936 1:60886931-60886953 TTGAGAAAGGGGCTGGGAGGGGG + Intronic
908300843 1:62759652-62759674 ATCAAAAAGGGGAAGGAAAGGGG + Intergenic
908605668 1:65793903-65793925 GTGAAAAACGGGAAGGAAGGAGG - Intronic
908630313 1:66098401-66098423 CTGAGAAAAGGTAAAGAAGCAGG - Intronic
909131504 1:71742559-71742581 GTGAGAAATGGGAAAGAAAGGGG - Intronic
909910824 1:81255833-81255855 CTGGGAAAGTGCAAAGAAGGAGG - Intergenic
910542607 1:88378029-88378051 CTAAGGAAGGAAAAGGAAGGAGG + Intergenic
910684660 1:89904028-89904050 CTGAGTAGGGGGAAGTTAGGTGG - Intronic
910714312 1:90214483-90214505 CTGACAAAAGGGAAGCAAGCTGG - Intergenic
911222111 1:95259553-95259575 CTAAGAAAAGGAAAGGAAGGAGG - Intergenic
911956671 1:104244194-104244216 CTAAGAAGGGGGAGGGTAGGGGG + Intergenic
912498507 1:110106635-110106657 CTGAGACCCGGGAAGGGAGGAGG + Intergenic
912727100 1:112068132-112068154 CTGAGGAAGGGAAAGGAAACTGG + Intergenic
913092032 1:115482797-115482819 CTGAGATAGGTGAAGGAATCAGG - Intergenic
913197588 1:116470895-116470917 GTGAGAGAGGGAGAGGAAGGGGG - Intergenic
913301009 1:117368244-117368266 CTGTGATGTGGGAAGGAAGGCGG - Exonic
913518151 1:119622623-119622645 CTGACCCAGGGGAAGGAAGTGGG - Exonic
913706687 1:121432245-121432267 GAAAGAAAGAGGAAGGAAGGAGG - Intergenic
913963675 1:143357556-143357578 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
913998889 1:143675515-143675537 ATCAGAATGGGGAAGAAAGGGGG + Intergenic
914058034 1:144183145-144183167 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
914121111 1:144783220-144783242 GTGGGAAGGGGGAAGGGAGGGGG + Intergenic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
914833685 1:151189969-151189991 CTGGGAAAAGGGAGGGGAGGAGG - Intronic
914945825 1:152065229-152065251 TTGAGAAACTGGAAGGACGGTGG - Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915128480 1:153681359-153681381 CTGGGAATAGGGAAGGATGGAGG - Intronic
915359803 1:155278993-155279015 CTAAGAGAGGGGAGGGAAAGAGG - Intronic
915572085 1:156750376-156750398 CTGAGACAGGTTAAGTAAGGAGG - Intronic
915579650 1:156805784-156805806 CAGAGAATGGGGAAGCAAGAGGG + Intergenic
915590104 1:156865806-156865828 CAGAGAGATGGGAAGGATGGTGG + Intronic
915602149 1:156929252-156929274 CTCACAAATGGGAGGGAAGGGGG - Intronic
915706599 1:157849652-157849674 CTGAGAGAGAGGCAAGAAGGAGG + Intronic
915897590 1:159823853-159823875 CTGAGAAAGGGGGTAGGAGGAGG - Intergenic
916062741 1:161111712-161111734 TTCAGAAAGGAGAAAGAAGGAGG - Intronic
916189794 1:162167611-162167633 CTGATGAAGGGAAAGGAAAGGGG - Intronic
916264397 1:162876263-162876285 CTGATAAAGGGAAAGAAAGTGGG + Intergenic
916817565 1:168368479-168368501 GAGATAATGGGGAAGGAAGGAGG + Intergenic
916822172 1:168410198-168410220 GGGAGGAAGGGGAAGGTAGGTGG + Intergenic
916874907 1:168958790-168958812 TTGAGATAGGGGAAGGAGGAGGG - Intergenic
917038294 1:170773573-170773595 CAGGGGAAGGGGGAGGAAGGGGG + Intergenic
917168562 1:172143507-172143529 GTGGGAGAGGGGGAGGAAGGTGG - Intronic
917366700 1:174239322-174239344 CAGAGAAAGGGAGAGGAAAGTGG - Intronic
917443981 1:175091258-175091280 GAGAGAAAAGGGAAGGCAGGGGG + Intronic
917521749 1:175753508-175753530 CTCGGGGAGGGGAAGGAAGGAGG - Intergenic
917707427 1:177648530-177648552 CTGAGAATGGAGAAGAGAGGAGG - Intergenic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918421260 1:184366294-184366316 CAGAGGAAGAGCAAGGAAGGAGG - Intergenic
918447551 1:184630281-184630303 GAGAGACAGGGGAAGGTAGGTGG - Intergenic
918861589 1:189833174-189833196 CTGAGCAAGGGCAAGTAAAGAGG - Intergenic
919003041 1:191859613-191859635 AGGAGAGAGAGGAAGGAAGGAGG - Intergenic
919024893 1:192155319-192155341 CTGAGAAAGGGACAGAAAAGAGG + Intergenic
919243923 1:194952399-194952421 CTGACAAAGAGAAAGGAAGATGG + Intergenic
919443770 1:197674587-197674609 CAGAGAAAAGGGAATGAAGTTGG + Intronic
919669120 1:200322611-200322633 CAAAGAAAAGGAAAGGAAGGTGG - Intergenic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
919776812 1:201199586-201199608 CTGAAAAAGGAGCAGGAATGAGG - Intronic
919924679 1:202186238-202186260 CTGAGAAGGGGGTGGGAAGGGGG - Intergenic
920099420 1:203507717-203507739 CTGAGAATGGGGCAGGCAGAGGG - Intronic
920351280 1:205339592-205339614 CTGAGCCAAGGGAAGGAAGGAGG + Intronic
920443977 1:206001858-206001880 GTGAGAAATGAGAGGGAAGGGGG - Intronic
920799589 1:209173998-209174020 CTGAAAAAGGGGCAGGCAGTAGG + Intergenic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
920883951 1:209908348-209908370 GGAAGGAAGGGGAAGGAAGGAGG - Intergenic
920886054 1:209929107-209929129 CAGAAAAAGAGGAAGGGAGGAGG - Intergenic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921165911 1:212506999-212507021 CTGAGAGTGGGGAAGGTAGGAGG - Intergenic
921237130 1:213144551-213144573 CTTAGAAAGGTCAAGAAAGGGGG - Intronic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
921352325 1:214248925-214248947 CTGAACCATGGGAAGGAAGGAGG - Intergenic
921408526 1:214809241-214809263 ATGAGAAAGTGGAAGGCATGAGG + Intergenic
921940142 1:220830664-220830686 CTGAGAAAGGGGAAGTGACTTGG - Intergenic
922023414 1:221727828-221727850 CAGTGAGAGGGGAAGGGAGGGGG - Intronic
922102148 1:222485889-222485911 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922104509 1:222501301-222501323 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922263231 1:223961000-223961022 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922264827 1:223973814-223973836 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
922614145 1:226951228-226951250 CTGAGAAAGTGGAGGGATGAAGG + Intronic
922860829 1:228814939-228814961 CTCAGAAAGGGGAGGGCGGGAGG - Intergenic
922968251 1:229710711-229710733 CTGAGAGAAGGGAAGCAGGGAGG + Intergenic
923012166 1:230096479-230096501 AGGGGAAAGGGGAAGGAAGGCGG - Intronic
923095021 1:230768353-230768375 CTGAGAAACGGGTGGGAGGGAGG - Intronic
923098732 1:230795617-230795639 CGGGGAAGGGGGGAGGAAGGGGG - Intronic
923226098 1:231940165-231940187 CAGAGAGAGGGGAAGGACAGAGG - Intronic
923455815 1:234164354-234164376 AGGAGAGAGGGGAAAGAAGGAGG - Intronic
923672478 1:236052492-236052514 GTGAGAAAGAGGAAGGAACCAGG - Intronic
923805248 1:237250587-237250609 CTGAGAATGGGAAGGGAAGACGG - Intronic
923857310 1:237858926-237858948 GTGAGAAAGGAGGAGGAAAGTGG + Intergenic
924140012 1:241012524-241012546 CTGATGAAGGGTCAGGAAGGGGG - Intronic
924309095 1:242721338-242721360 CTGAGAAAGCGGAGGGCAGATGG + Intergenic
924321933 1:242859402-242859424 CTTTGAAAGGGCAAGGCAGGTGG + Intergenic
924345071 1:243066009-243066031 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
924346684 1:243078820-243078842 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
924497201 1:244601998-244602020 AAGGGGAAGGGGAAGGAAGGAGG + Intronic
924547819 1:245046796-245046818 ATGAGGTAGGGGAAGGGAGGTGG - Intronic
924589758 1:245392619-245392641 CAGGGAAAGGGGAAGGGAGAGGG - Intronic
924815713 1:247440268-247440290 CAGAGAACGGGGGTGGAAGGTGG - Intronic
1063173820 10:3533864-3533886 CGGAGGAAGGTGCAGGAAGGTGG - Intergenic
1063758582 10:9044935-9044957 ACGTGAAAGGGGAAGGAAGGAGG - Intergenic
1064642657 10:17430047-17430069 CTCAGAAAGGGGAAGATGGGAGG - Intronic
1065463796 10:25997803-25997825 CTGAGAGAGGGGAAGAATGGGGG + Intronic
1065518759 10:26551670-26551692 CTGAGTAAGGGGTAGGAAGCAGG - Intronic
1066397587 10:35041249-35041271 CTGAGAGAGGTGAAGGAGGATGG + Intronic
1066442153 10:35449272-35449294 CAGAGATAGGGGCAGGGAGGGGG + Intronic
1066729665 10:38426029-38426051 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1067142966 10:43671587-43671609 GGGCGCAAGGGGAAGGAAGGAGG - Intergenic
1067793351 10:49303850-49303872 CTCAGCCAGGGGAAGGAAAGGGG - Intronic
1068788030 10:60998606-60998628 AAGAAAAACGGGAAGGAAGGGGG + Intronic
1068797251 10:61097187-61097209 ATGAGAAAGGAAAAGGAAGTGGG - Intergenic
1068993665 10:63178406-63178428 CTTGGAACAGGGAAGGAAGGTGG - Intronic
1069060628 10:63891076-63891098 GGGACAAAGGGGAAAGAAGGAGG - Intergenic
1069078450 10:64063325-64063347 AAAAAAAAGGGGAAGGAAGGAGG - Intergenic
1069108171 10:64409424-64409446 AAAAGAAAGAGGAAGGAAGGAGG + Intergenic
1069133935 10:64740692-64740714 ATGAGAAAAGGGAAGGATGCCGG - Intergenic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1069721884 10:70554968-70554990 CAAAGAAAGGGGAGGGGAGGAGG - Intronic
1069784099 10:70977065-70977087 GGGAGAGAGGGGAGGGAAGGGGG + Intergenic
1069879126 10:71580851-71580873 CAGAGAAAGGGGTAGGAATGGGG - Intronic
1069917067 10:71793707-71793729 AAGAGAAAGGAGAAAGAAGGGGG - Intronic
1070150237 10:73800828-73800850 CTGAGCAAGAGCTAGGAAGGAGG - Intronic
1070216324 10:74385472-74385494 CTGAGAAATGCTAAGGAATGGGG + Intronic
1070833931 10:79436336-79436358 CTGAGTAAGGGGAAAGGATGAGG - Intronic
1071175729 10:82924427-82924449 ATGAGGAAGGGGTAGGAAGTTGG + Intronic
1071652487 10:87406604-87406626 CCAAAACAGGGGAAGGAAGGAGG + Intergenic
1071710858 10:88047833-88047855 CAGAGAAAGGAAAAGGAAAGGGG - Intergenic
1071808832 10:89155602-89155624 CTGAGAAACAGGAAGGAAGAGGG + Intergenic
1072114278 10:92354781-92354803 CTGAGCAAGGAGAATAAAGGAGG + Intergenic
1072230357 10:93409157-93409179 CTGGGAAAGGGCAGGGCAGGTGG + Intronic
1072307241 10:94119560-94119582 TTGAGGAAGGGTAAGAAAGGGGG - Intronic
1072421667 10:95294938-95294960 ATGAGAAGAGGGAAGCAAGGAGG + Intergenic
1072645548 10:97251324-97251346 AGGGGAAAGGGAAAGGAAGGGGG + Intronic
1072960819 10:99927313-99927335 CTTATAAAGGGGAAGGGAGGTGG + Intronic
1072979502 10:100087911-100087933 AGGAGAAAGGGGAAGGGAGAGGG + Intergenic
1073150114 10:101305704-101305726 CTGAGGAAGGGGACGGGAGGGGG - Intergenic
1073213941 10:101826376-101826398 CTTAGAAGGGAGAGGGAAGGAGG - Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073439481 10:103544150-103544172 CAGAGCCAGGGGAGGGAAGGAGG + Intronic
1073502271 10:103951170-103951192 CTTAGAGAGGGGAAGGAAGCAGG + Intergenic
1073559090 10:104481742-104481764 CTAAGACAAGGAAAGGAAGGAGG - Intergenic
1073564915 10:104526701-104526723 CTGAGAGAGGCTAGGGAAGGTGG + Intergenic
1073847585 10:107576312-107576334 CAGAGAGAGGGGAAGGGAGAAGG + Intergenic
1073873384 10:107892099-107892121 ATGAGAAAGTAGAAGGAAGCTGG - Intergenic
1074190201 10:111128887-111128909 GGGAGGAAGGGGGAGGAAGGAGG - Intergenic
1074247333 10:111708113-111708135 TTGAGAAAGGGAAAGCAAGATGG - Intergenic
1074770698 10:116731757-116731779 CTGAGAGAGGGGGAGTTAGGGGG - Intronic
1074771345 10:116736578-116736600 CTTAGAAAGGGAATGGGAGGAGG + Intronic
1074786995 10:116849924-116849946 CAGAGAAAGTGGCAGAAAGGAGG + Exonic
1074866948 10:117550151-117550173 CCCAGAAGGGGGAAGGAGGGAGG - Intergenic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075131571 10:119744312-119744334 TTTAGCAAGGGGAAGGATGGAGG - Intronic
1075303680 10:121348519-121348541 GTGGGCAAGGGGAAGAAAGGTGG - Intergenic
1075651631 10:124131309-124131331 CTGGGAGAGGGGATGGAATGCGG - Intergenic
1075687151 10:124372126-124372148 CTGAGACTGGGAAAGGAAAGAGG - Intergenic
1076451751 10:130561257-130561279 CTGAGAATGGGGACCTAAGGAGG - Intergenic
1076821670 10:132942738-132942760 AGAAGAAAGGGGAGGGAAGGCGG + Intronic
1076855483 10:133113731-133113753 CTGGGAGAGGGCAAGGATGGGGG + Intronic
1076870885 10:133193582-133193604 AGGAAAAAGGAGAAGGAAGGAGG + Intronic
1076973274 11:150668-150690 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077384602 11:2263045-2263067 CTGGGGAGGGGGTAGGAAGGCGG + Intergenic
1077900294 11:6481970-6481992 CTGGGCATGGGGAAGAAAGGAGG + Intronic
1078575056 11:12494302-12494324 ATGAGAAAGGGGAAGGAAGCTGG - Intronic
1078637246 11:13063406-13063428 CTGAGATGGGGAATGGAAGGAGG - Intergenic
1079186815 11:18245615-18245637 CCCAGAAAGGCCAAGGAAGGAGG + Intronic
1079189384 11:18265119-18265141 AAGAGAGAGAGGAAGGAAGGAGG + Intergenic
1079190027 11:18269595-18269617 CCCAGAAAGGCCAAGGAAGGAGG - Intronic
1079652879 11:22951763-22951785 CTGAGAAAGAAGAAAGAAGATGG - Intergenic
1079931428 11:26567335-26567357 CTGAGAGAGGAAAAGGGAGGAGG + Intronic
1080387279 11:31817632-31817654 CTGAGGGAGGGATAGGAAGGGGG - Intronic
1080391377 11:31850230-31850252 CTGAGAAGAGGCAAGGAATGTGG + Intronic
1080526068 11:33120463-33120485 CTGAGAGATGGGAGGGAAAGTGG - Intronic
1080572045 11:33565521-33565543 CTCAGGAAGGGGAAGCCAGGAGG + Intronic
1080604674 11:33855145-33855167 GGAAGAAAAGGGAAGGAAGGAGG + Intergenic
1080634628 11:34112860-34112882 GGGAGAATGGGGAAGGGAGGTGG - Intronic
1080684629 11:34504851-34504873 CTGAGAAAGAGGAGGGAGGGTGG + Intronic
1080947745 11:36993965-36993987 CTGAGAAATGCAAAGGAAGTTGG + Intergenic
1081207743 11:40294117-40294139 CAGAGAAAGGGAAAGGAAAAGGG - Intronic
1081460816 11:43271239-43271261 CCTGGAAAGGGGAAAGAAGGAGG + Intergenic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1082053854 11:47796504-47796526 GAGAGAGAGAGGAAGGAAGGGGG + Intronic
1082063384 11:47879462-47879484 CCGAAAGAGGGGAAGGGAGGAGG + Intergenic
1082132366 11:48506224-48506246 GAGGGAAGGGGGAAGGAAGGGGG - Intergenic
1082262424 11:50087179-50087201 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1082565829 11:54676844-54676866 GAGGGAAGGGGGAAGGAAGGGGG - Intergenic
1083131263 11:60624825-60624847 ATGATAAAGGGGAAGTCAGGAGG + Intergenic
1083186770 11:61022219-61022241 AGGAGAAAGGGGAAGCCAGGAGG + Intergenic
1083224631 11:61276992-61277014 AGGAGACAGAGGAAGGAAGGAGG + Intronic
1083579220 11:63814014-63814036 GGGGGAAAGGGGAAGGGAGGGGG - Intronic
1083609546 11:63998517-63998539 CTGACTGGGGGGAAGGAAGGCGG - Intronic
1083777330 11:64900668-64900690 CTGAGGACGGGGAGGGAATGGGG - Intronic
1084033754 11:66495607-66495629 CTGTGAGAGGGGCAGGCAGGTGG - Intronic
1084147022 11:67270408-67270430 GCCAGAAAGGGGCAGGAAGGAGG - Intronic
1084221794 11:67685819-67685841 CTGGGAAAGGGGAAGAGATGAGG + Intergenic
1084725157 11:70936949-70936971 CTCAGGGAGGGAAAGGAAGGTGG - Intronic
1084856861 11:71994983-71995005 GTGGGAAAGGGTAGGGAAGGTGG - Intronic
1085095330 11:73755781-73755803 GGGAGAAAAGGAAAGGAAGGGGG + Intronic
1085101578 11:73805204-73805226 CTGAGAATGGGGAAGGAGCAAGG - Intronic
1085152859 11:74266103-74266125 CTGAGAAGTGGGAGTGAAGGTGG + Intronic
1085158001 11:74313645-74313667 CTACGAAAGGGAAAGGAAGCAGG - Intergenic
1085178052 11:74507829-74507851 GTGAGGAAGGTGAAGGAAGTGGG - Intronic
1085254238 11:75163502-75163524 CTGAGAGAGGGGCAGGATGGTGG + Intronic
1085267072 11:75243252-75243274 CTCAGAGAGGGGCAGGAAGTGGG + Exonic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085430018 11:76439834-76439856 ATCAGAAAGGGGAATAAAGGAGG - Intergenic
1085776666 11:79372680-79372702 CTGTGAAATGGGAGGGGAGGGGG + Intronic
1085973135 11:81618261-81618283 CTGAGAAAGGTAAAGGATGCAGG + Intergenic
1085990102 11:81831080-81831102 CTGAGTATGGGGATGCAAGGTGG - Intergenic
1086306425 11:85485564-85485586 GTGAGTAAGGAGAGGGAAGGGGG + Intronic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087432907 11:98076124-98076146 CGGGGAGAGGGGAAGGAAGGTGG - Intergenic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088368773 11:109066366-109066388 TTGTGAGATGGGAAGGAAGGTGG + Intergenic
1088430203 11:109750424-109750446 CTGAGGAAGGGGACAGAAGATGG - Intergenic
1088456676 11:110039995-110040017 CTGAGAAAGGGAAATGAAAAAGG + Intergenic
1088544024 11:110941928-110941950 CTGAGGAGGAGGAAGGGAGGGGG + Intergenic
1088613929 11:111603604-111603626 TTGAGGCAGTGGAAGGAAGGGGG - Intronic
1088737730 11:112741962-112741984 CTGAGACAGGGGGAGACAGGGGG + Intergenic
1088814209 11:113410403-113410425 CAGAGGAAGGTCAAGGAAGGCGG + Exonic
1088821632 11:113461977-113461999 GGAAGAGAGGGGAAGGAAGGGGG - Intronic
1089183977 11:116602515-116602537 CTGAAAAAGGGGCAGGATGGAGG - Intergenic
1089201251 11:116725910-116725932 GTGGGAAAGGGGCAGAAAGGCGG + Intergenic
1089257303 11:117200627-117200649 AGGAGGAAGGGGAAGGATGGTGG + Intronic
1089322470 11:117635728-117635750 ATGAGAAAGGAGAAGAAATGAGG + Intronic
1089778844 11:120858914-120858936 CTGTGGAAGGACAAGGAAGGGGG - Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090650083 11:128798851-128798873 CTGACAGTGGGGGAGGAAGGAGG + Intronic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1090806157 11:130203601-130203623 CTGAGCATGGGGAAGGCATGAGG - Intronic
1091395529 12:152175-152197 ACCAGAAAGGGGAAGGCAGGAGG + Intronic
1091416841 12:295254-295276 AGGAGAAAGGGGAAGGAAAAAGG + Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091799182 12:3313947-3313969 CTGAGTAATGGGAAGGGTGGAGG - Intergenic
1091834059 12:3572081-3572103 TTGAGAAAGAAGAAGAAAGGAGG - Intronic
1091883171 12:3996407-3996429 CTGAGAGAGAAGAAGGAAGGAGG - Intergenic
1092008969 12:5093849-5093871 AAGAGAGAGGGGAATGAAGGGGG - Intergenic
1092034672 12:5322603-5322625 CTGGGAAAAGGGGAGGAAAGTGG + Intergenic
1092127407 12:6084634-6084656 CTGACAAAGGAGAAGGGAGGGGG + Intronic
1092205973 12:6614266-6614288 TGGAGAAAGGGCAAGGGAGGAGG - Intergenic
1092258701 12:6941055-6941077 ATGAGAAAAGGGCAGAAAGGAGG + Intronic
1092262908 12:6962063-6962085 CTGACATGGGGGAAGGAAGAGGG - Intergenic
1092462276 12:8697602-8697624 CTGAGAAAGGGAAACGGATGGGG - Intronic
1092493443 12:8967969-8967991 TTAAGGAAAGGGAAGGAAGGAGG + Intronic
1092618750 12:10239505-10239527 GAAAGAAAGGGGAGGGAAGGAGG - Intergenic
1092859911 12:12711429-12711451 ATGAGAAAGGGGAAAGAGAGTGG + Intergenic
1092908118 12:13120897-13120919 CTGAGAAAGGTGACAGAAGGAGG + Intronic
1092971916 12:13704299-13704321 ATGAGAAAGGGAAAGGATGGAGG + Intronic
1093000833 12:13993923-13993945 GGAAGAAAGGGGAAGGGAGGGGG + Intergenic
1093534830 12:20210309-20210331 GAGAGAAAGGGGAAGGGAAGGGG - Intergenic
1093711840 12:22336192-22336214 CTGGAAAAGGGGAAGGGAAGGGG + Intronic
1094173975 12:27523408-27523430 CTGAAAAGGGTGGAGGAAGGAGG - Intergenic
1094216944 12:27952439-27952461 CAGGGAAAGGGGGAGGGAGGGGG + Intergenic
1094260358 12:28490143-28490165 ATGAGAAAGGGGCAGGAAGATGG - Intronic
1094572329 12:31651973-31651995 CTGACAAAGGGAAGGGAAGATGG - Intronic
1094628133 12:32145508-32145530 CTTGGAAGAGGGAAGGAAGGAGG + Intronic
1095085719 12:38056005-38056027 AGGGGAAAAGGGAAGGAAGGCGG - Intergenic
1095199592 12:39367165-39367187 CTGAAAAAGGGGAAGAAACAAGG + Intronic
1095446076 12:42283741-42283763 CTGAGAGAGGCCAAGGTAGGAGG - Intronic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1095664019 12:44773561-44773583 GTTAGAAAGAGGAAGGAAGAAGG - Intronic
1095926439 12:47584178-47584200 CTGAGCAACTGAAAGGAAGGAGG + Intergenic
1096081731 12:48837820-48837842 TTTGGAAAGGGGAAGGATGGTGG - Intronic
1096213066 12:49781198-49781220 CTGAAAAGAAGGAAGGAAGGAGG - Intergenic
1096408539 12:51360936-51360958 CTGAGAAAGAGGAAAGGAGGGGG - Intronic
1096557285 12:52411185-52411207 CTGGGCAGGGGGAAGAAAGGAGG + Intergenic
1096815598 12:54199986-54200008 AGGAGAAAGGGGAAGAAAGAAGG + Intergenic
1096835706 12:54349829-54349851 CTGAGAAAGGAGTTGGAAGTAGG - Intronic
1096850195 12:54430591-54430613 CTGAGAGAGAGAAAGGAAGAAGG + Intergenic
1096943176 12:55372425-55372447 GAAAGAAAGAGGAAGGAAGGAGG + Intergenic
1097520354 12:60661308-60661330 TTCAGAGAGGGGAGGGAAGGAGG - Intergenic
1097856529 12:64469365-64469387 CGGAGAAAGGAGCAGGAAGGGGG - Intronic
1097988443 12:65808924-65808946 CTGAGAAAGAGGATGGAACTGGG - Intergenic
1098006933 12:66007518-66007540 GTGGGACAGGGGAAGGAGGGAGG - Intergenic
1098245779 12:68516037-68516059 CTGGGAAGGGAGAAGAAAGGGGG + Intergenic
1098460808 12:70731096-70731118 AGGAGAGAGAGGAAGGAAGGAGG + Intronic
1098460813 12:70731122-70731144 GAGAGAGAGAGGAAGGAAGGAGG + Intronic
1098475948 12:70903100-70903122 CAGGGAATGGGGAAGGAATGAGG + Intronic
1098731602 12:74042174-74042196 CTGAGAAAGGGGAGAGAATATGG + Intergenic
1099167498 12:79324426-79324448 AGGAGAAAAGGGAATGAAGGCGG - Intronic
1099576675 12:84392039-84392061 ATGAAAAAGGGGAAGGAGAGGGG - Intergenic
1100098838 12:91077466-91077488 CTGAAAAAGGGTAAGTAATGTGG + Intergenic
1100127206 12:91441787-91441809 ATGAGAAAAGGGAGAGAAGGAGG - Intergenic
1100339114 12:93661125-93661147 GGGACAAAGGTGAAGGAAGGAGG - Intergenic
1100550747 12:95644415-95644437 AGAAGAAGGGGGAAGGAAGGGGG - Intergenic
1101387118 12:104267835-104267857 AAGAGAGAGAGGAAGGAAGGAGG - Intronic
1101450562 12:104774247-104774269 CTTAGAAAAGGGAACAAAGGAGG - Intergenic
1101619596 12:106372224-106372246 GTGAGGAAGGGGAGAGAAGGAGG - Intronic
1101901339 12:108793073-108793095 ATGACAACGGGGAAGGAACGCGG + Intronic
1102099744 12:110269337-110269359 CAGATAAAAAGGAAGGAAGGAGG - Intergenic
1102238553 12:111309611-111309633 CAGAAATAGAGGAAGGAAGGAGG - Intronic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102645290 12:114399805-114399827 AGGAGAAAGGCGAAGGGAGGAGG + Intronic
1102704694 12:114870828-114870850 CTGAGCAATGGGAAGACAGGAGG - Intergenic
1102856324 12:116297667-116297689 GAAAGAAAGAGGAAGGAAGGAGG + Intergenic
1102913676 12:116737566-116737588 CAGGGAGAGGGGAAGGAAGGAGG + Intronic
1102928343 12:116843616-116843638 CAGAGGAAGGGGGAGGAAGAAGG - Intronic
1103175043 12:118855614-118855636 AAGGGAAAGGGAAAGGAAGGGGG + Intergenic
1103231140 12:119331437-119331459 AGGATAAAGGGGAAGGAAGAAGG - Intergenic
1103480451 12:121247080-121247102 CTGAAGCAGGGCAAGGAAGGTGG - Intronic
1103750316 12:123154111-123154133 CTTAGCAAGGGAAAGGAAGGGGG + Intronic
1103862473 12:124025894-124025916 TTGAGACAGGGCAGGGAAGGAGG + Intronic
1104159978 12:126168664-126168686 CTGAGAGAAGGGAAGGAATGAGG + Intergenic
1104224967 12:126822655-126822677 CTGAGGCAGAGGAAGGGAGGGGG + Intergenic
1104243948 12:127018766-127018788 CAGAGAAAGTGGATGGAGGGAGG - Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104565925 12:129883043-129883065 CAGGGAAAAGGGAAAGAAGGAGG + Intronic
1104569911 12:129916125-129916147 CTCAGAAAGGGGAAGTAACTTGG - Intergenic
1104665207 12:130642900-130642922 CTGAGAGAGGGGCTAGAAGGAGG + Intronic
1104876025 12:132035443-132035465 CAGAGAAGTGGGAAGTAAGGCGG + Intronic
1104987743 12:132606466-132606488 CTGAGGCAGGGGAAAGAAGGTGG - Intronic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1106258286 13:28041300-28041322 CTGAAAAAGGAGAAGAGAGGAGG + Intronic
1107093953 13:36514907-36514929 CTGAGGAAGGTGAAGAGAGGAGG + Intergenic
1107519356 13:41163793-41163815 AAGAGAGAGAGGAAGGAAGGAGG + Intergenic
1107834919 13:44405299-44405321 GGGAGAGTGGGGAAGGAAGGTGG - Intergenic
1107873053 13:44764601-44764623 CTGAGAGATGTGAAGGACGGAGG + Intergenic
1107996052 13:45862184-45862206 GAGAGAAAGGGGAAGGAAAAGGG + Intergenic
1108392088 13:49956501-49956523 AGAAGAAAGAGGAAGGAAGGAGG - Intergenic
1108849040 13:54705614-54705636 ATCAAAAAGGGGAAGGAAAGGGG + Intergenic
1109181539 13:59219974-59219996 GGGAGGAAGGGGGAGGAAGGGGG + Intergenic
1109271718 13:60263084-60263106 TTGAGAAAGAGGAACCAAGGTGG + Intergenic
1110185090 13:72664599-72664621 CTGAGAAAGGGAGAGCGAGGTGG - Intergenic
1110210091 13:72961649-72961671 GGGTGAAAGGGTAAGGAAGGGGG - Intronic
1110364828 13:74670029-74670051 GAGGGAAAGGGGAGGGAAGGAGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111105376 13:83638726-83638748 CTGAGAAATGAGAATTAAGGTGG - Intergenic
1112092523 13:96096496-96096518 CTAAGCATGGGGTAGGAAGGAGG - Intronic
1112119136 13:96390735-96390757 CCCAGAAAGAGTAAGGAAGGGGG - Intronic
1112157453 13:96833199-96833221 CTGAGAGAGGAGAGGGCAGGAGG - Exonic
1112643928 13:101307671-101307693 CCAAGAAAAGGGAAGGGAGGAGG + Intronic
1113149985 13:107252477-107252499 GAGAGAGAGGAGAAGGAAGGAGG + Intronic
1113222776 13:108124244-108124266 CTGACAAAGAGGAGGGAAGATGG - Intergenic
1113402481 13:110006662-110006684 TTGAGCAATGGGAGGGAAGGAGG - Intergenic
1113566879 13:111324615-111324637 CAGAGAGAGGGCAAGGGAGGTGG + Intronic
1113923287 13:113926595-113926617 CAGAGGATGGGGAAGGAATGAGG + Intergenic
1114257298 14:21014304-21014326 AGGAAAAAGAGGAAGGAAGGTGG + Intergenic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114639977 14:24213180-24213202 CTGAGAGTGGGGGAGGACGGCGG + Intronic
1114746849 14:25157533-25157555 CTGCTAAAGGGGAAGGAAGGAGG - Intergenic
1114953059 14:27781371-27781393 CTGGGAAAAAGGAAGTAAGGTGG - Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115275599 14:31605807-31605829 ACGAGAAAGGAGAAGGGAGGAGG - Intronic
1115365132 14:32549378-32549400 CAGATAAAGGAAAAGGAAGGTGG + Intronic
1115399412 14:32939792-32939814 CTGGGGAGGGGGAGGGAAGGCGG + Intronic
1115498171 14:34027192-34027214 AGGAGGAAGGGGAAGGGAGGGGG + Intronic
1115788225 14:36850161-36850183 ATGGGAAAGGGGAAGGAGTGAGG + Intronic
1115964204 14:38868693-38868715 CTGAGAAAGCTCAAGAAAGGGGG + Intergenic
1116014794 14:39393447-39393469 GTTAGAAAGGGAAAGGAAGGGGG - Intergenic
1116058307 14:39891247-39891269 CTGAGGAAGGAGAACAAAGGTGG + Intergenic
1116290181 14:43024426-43024448 GTGGGAAAGGGGAAGGAAATCGG + Intergenic
1116475094 14:45331009-45331031 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
1116798116 14:49413418-49413440 CTTAGAAAGAGGAAGGCAGTGGG + Intergenic
1116806858 14:49502045-49502067 AATAGAAAGGGGAAGGAAGACGG + Intergenic
1116954549 14:50910771-50910793 CAGGAAAAGTGGAAGGAAGGAGG - Intronic
1117182148 14:53201730-53201752 GGGAGAAAGTGGAAAGAAGGTGG + Intergenic
1117405005 14:55393483-55393505 CTGAGAAATGGGAAGGAGTCAGG - Intronic
1117678065 14:58175156-58175178 GTGAGATAGAGGATGGAAGGTGG + Intronic
1117743597 14:58844815-58844837 CTGAAAAGGGGGTAGGAATGGGG - Intergenic
1117812449 14:59562573-59562595 CTGATGGAGGGGTAGGAAGGTGG + Intronic
1118072991 14:62266292-62266314 CTGTGGAAGGAAAAGGAAGGAGG - Intergenic
1118089571 14:62458232-62458254 GAGAGAAAGAGGAAGGAAAGAGG + Intergenic
1118467777 14:66046373-66046395 GTGAAGAAAGGGAAGGAAGGAGG - Intergenic
1118770002 14:68936409-68936431 GAGAGAAATGGGAAGGCAGGGGG + Intronic
1118810268 14:69268031-69268053 AAGAGAAAGGGGAAGGATGAGGG - Intronic
1119067415 14:71542678-71542700 AGGAGAAGGGAGAAGGAAGGAGG - Intronic
1119071103 14:71585136-71585158 ATGAGAAAAGGGAGGGAGGGAGG + Intronic
1119075970 14:71639623-71639645 CTGAGAAAGAGGAATTAATGTGG + Intronic
1119137604 14:72234910-72234932 GTGGGAAAGGGGAAGAAAAGAGG + Intronic
1119235415 14:73015338-73015360 GAAGGAAAGGGGAAGGAAGGGGG + Intronic
1119432038 14:74574855-74574877 GGGAGAAGGGGGAAGGTAGGAGG + Intronic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1119680005 14:76585103-76585125 CTGGGAGAAGGGAAAGAAGGAGG + Intergenic
1119866225 14:77977415-77977437 CTGAGAGAGGGGAGAGAAGTGGG + Intergenic
1119879742 14:78090862-78090884 CTAATAAAAGGGATGGAAGGAGG - Intergenic
1120554981 14:85918632-85918654 AAGAGAAAGCGGAAGGATGGAGG + Intergenic
1120677918 14:87443439-87443461 GAGAGAAAGAGGGAGGAAGGGGG + Intergenic
1120765878 14:88326134-88326156 CTGAGAAAGGAGAATGAAAGTGG - Intronic
1121100849 14:91249109-91249131 CTGAGCAAGGGGATGCAGGGTGG + Intronic
1121115422 14:91339574-91339596 CTAAGAAACGAGGAGGAAGGTGG + Intronic
1121447535 14:93988242-93988264 ATGAGAGAGGGGATGGAAGGAGG + Intergenic
1121447665 14:93988625-93988647 TTGAGAGAGGGGATGGGAGGAGG + Intergenic
1121550100 14:94792841-94792863 AAGAGAAAGAGGAAGGAGGGAGG + Intergenic
1122167139 14:99835562-99835584 CGAAGAAAGGAGAAGGAAGTAGG - Intronic
1122353803 14:101111951-101111973 AGGAGGAAGGGGAAGGAAGGAGG - Intergenic
1122735493 14:103837512-103837534 GAGAGAGAGAGGAAGGAAGGAGG - Intronic
1122804749 14:104250647-104250669 GTGAAAAGGGGGAAGGAGGGAGG + Intergenic
1122837637 14:104437853-104437875 CAGGGAAGGAGGAAGGAAGGGGG + Intergenic
1123771482 15:23534202-23534224 CTGACAAAGAGAAAGGAAGATGG - Intergenic
1123797412 15:23785920-23785942 TTCAGAAAGGGGAAGGAAGGCGG + Intergenic
1124231034 15:27946702-27946724 CTGAGAGATGGGCAGGCAGGAGG - Intronic
1124424759 15:29554416-29554438 GAAAGAAAGGGGAGGGAAGGGGG + Intronic
1124486221 15:30119588-30119610 CTGGGGAAGGGAAAGGAAAGGGG - Intergenic
1124541295 15:30588573-30588595 CTGGGGAAGGGAAAGGAAAGGGG - Intergenic
1124614882 15:31234312-31234334 CTGAGGAAGGGGCAGAAGGGTGG + Intergenic
1124757363 15:32419014-32419036 CTGGGGAAGGGAAAGGAAAGGGG + Intergenic
1125251294 15:37707931-37707953 CATGAAAAGGGGAAGGAAGGAGG - Intergenic
1125300698 15:38251973-38251995 CGGAGAAAGGGGGAGGGAGGCGG - Intergenic
1125695577 15:41634592-41634614 CTCAGTAAGGGGAAGGAAAGGGG - Intronic
1125723012 15:41854102-41854124 CTGATGAAGGGGGAGGACGGAGG - Exonic
1125750336 15:42023518-42023540 CTGGGATAGGGGAAGTAGGGTGG + Intronic
1125764286 15:42122924-42122946 CTGTGAATGAGGAAGGAAAGGGG - Intergenic
1126030185 15:44489162-44489184 CAGAGACAGGGAAAGGCAGGGGG - Intronic
1126385940 15:48093479-48093501 CTGAGGAAGATGAGGGAAGGGGG - Intergenic
1126410451 15:48368121-48368143 TAGAGAAAGGGGGAGAAAGGGGG - Intergenic
1127487158 15:59429897-59429919 CTGAGAACAGGGCAGGCAGGTGG + Intronic
1127499606 15:59544007-59544029 GTGAGAAAGGAGAAGTCAGGAGG + Intergenic
1127903517 15:63358988-63359010 CTGAGAAAGGGCAGGGAAACGGG - Intronic
1128092361 15:64927499-64927521 CTGAGAAGGGGTAAGGGACGGGG + Intronic
1128182720 15:65618958-65618980 CTGAGACAGGGGGATGCAGGTGG - Intronic
1128363454 15:66979561-66979583 ATGAGAAAGGGGAGGGAGGAAGG - Intergenic
1128393089 15:67196434-67196456 CTGTTAAGGGGGTAGGAAGGTGG - Intergenic
1128549399 15:68588507-68588529 CTGTGGAAGGCGAGGGAAGGTGG + Intronic
1128556834 15:68637572-68637594 CTGAGCCTGGAGAAGGAAGGCGG + Intronic
1128670319 15:69569925-69569947 TTGAGAAACAGGAAGGTAGGAGG - Intergenic
1128706063 15:69838120-69838142 CTGAGAGAGTGACAGGAAGGGGG - Intergenic
1128714228 15:69895455-69895477 CTGAGCAAGAGGAAGGATGGAGG - Intergenic
1128818648 15:70632195-70632217 CTGACAAAGGAAAAGGAAGCTGG - Intergenic
1129071682 15:72956700-72956722 TTGGGAAAGGAGAAGGAAGCAGG - Intergenic
1129675666 15:77631597-77631619 CTGAGAAGAGGGAGGTAAGGAGG - Intronic
1129946804 15:79545641-79545663 CTGGGACAGGTGAAGGAGGGGGG - Intergenic
1129970308 15:79772485-79772507 CTGAGAAATGGGACAGAAGAGGG + Intergenic
1130068405 15:80626253-80626275 CAGAGAAAGGAGGTGGAAGGAGG - Intergenic
1130080972 15:80733180-80733202 CGGGGACAGGGGAGGGAAGGTGG - Intronic
1130705812 15:86232055-86232077 GTGAGAGAGAGGAAGGAAGCAGG + Intronic
1131218852 15:90563880-90563902 TTGAAAAAAAGGAAGGAAGGCGG - Intronic
1131434499 15:92412265-92412287 ATGAGAGGAGGGAAGGAAGGGGG + Intronic
1132875867 16:2136709-2136731 CTTTGAGAGGGGGAGGAAGGTGG + Intergenic
1133153793 16:3857473-3857495 CTGACAAAGGGGAGTGAAGGAGG + Intronic
1133317560 16:4893821-4893843 CTACGAAAGAGGAGGGAAGGAGG - Intronic
1133599684 16:7326881-7326903 CTGAAAAAGTGTGAGGAAGGTGG - Intronic
1133897610 16:9944414-9944436 CAGAGGAAGGGGGAGGGAGGTGG - Intronic
1133929362 16:10219762-10219784 ATGAAAAAGGGAAAGGCAGGTGG + Intergenic
1133964320 16:10519598-10519620 GGAAGGAAGGGGAAGGAAGGGGG - Intergenic
1134111015 16:11515700-11515722 CTGAGGAGGGAGGAGGAAGGAGG + Intronic
1134149443 16:11794879-11794901 CTGGGGAATGGGAAGGAAAGAGG + Intronic
1134268959 16:12717037-12717059 CTGAACAGGGGGAAAGAAGGTGG + Intronic
1134519114 16:14910628-14910650 CTTTGAGAGGGGGAGGAAGGTGG - Intronic
1134554814 16:15155598-15155620 CTTTGAGAGGGGGAGGAAGGTGG + Intergenic
1134706784 16:16309283-16309305 CTTTGAGAGGGGGAGGAAGGTGG - Intergenic
1134718955 16:16370583-16370605 TGGAGAAAGGGGAGGGAAGGGGG - Intergenic
1134748056 16:16602980-16603002 GAGAGAGAGGGGAAAGAAGGAGG - Intergenic
1134826575 16:17289330-17289352 CAGAGAAAGGGGAAAAAAGCTGG - Intronic
1134902912 16:17954649-17954671 AGGAGGAAGGGGAAGGGAGGTGG + Intergenic
1134960756 16:18402841-18402863 CTTTGAGAGGGGGAGGAAGGTGG + Intergenic
1134997405 16:18750644-18750666 GAGAGAGAGGGGAAAGAAGGAGG + Intergenic
1135580126 16:23618399-23618421 CTGAGAGATGGGAAGGAAAAAGG + Intronic
1135591769 16:23710306-23710328 CTGAGAAATTGGAAGGAATTTGG - Intronic
1135607776 16:23837743-23837765 CAGAGAAAGGGGAACTAAGGAGG - Intronic
1135775384 16:25253414-25253436 GGGAGAAAAGGGAAGGGAGGGGG - Intronic
1135830455 16:25768396-25768418 CAGAGAGAGGGAAAGGAAGGGGG - Intronic
1135873562 16:26175711-26175733 CACAGAAAGGGGAAGGGAAGAGG - Intergenic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137640257 16:50022814-50022836 CTGACAAATGGGAAGGAGGAAGG + Intergenic
1137774383 16:51043235-51043257 TTGAGACAGGGGAAGGTGGGTGG - Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1137919699 16:52474882-52474904 GTGAGAAAGGGGAAGGACGATGG - Intronic
1137993413 16:53183407-53183429 GAGAGAAAGGGGAAGGAACAGGG + Intronic
1138212238 16:55173305-55173327 CTGTGAAGGGGGAAGGAGTGGGG + Intergenic
1138624289 16:58236885-58236907 CCGAGAAGGGGGCAGAAAGGAGG + Intronic
1138926387 16:61596576-61596598 ATGAGAAAGTGGAAGGAAGTAGG - Intergenic
1139226321 16:65235961-65235983 CTGAGAAAGGGGTGGGGAGGAGG - Intergenic
1139274917 16:65718725-65718747 CTGAGGAAGGCGAGTGAAGGTGG + Intergenic
1139846384 16:69924641-69924663 GGGAGACAGGGGAAAGAAGGGGG - Intronic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140314275 16:73879509-73879531 ATGAGAAATGGGAAGGAGGTAGG + Intergenic
1140859253 16:79004993-79005015 ATGAAAAAGGGGAAGGGAGAGGG + Intronic
1141056853 16:80824818-80824840 AAGAGAAGGAGGAAGGAAGGAGG + Intergenic
1141137302 16:81474638-81474660 CTGTGGAAGGGGAATGATGGGGG + Intronic
1141212651 16:81995495-81995517 CAGGGAATGGGGAAGGAATGTGG - Exonic
1141467401 16:84215344-84215366 TTGAGAGAGGGGAGGAAAGGGGG - Intergenic
1141683069 16:85555331-85555353 CAGAGAGAGGGGGTGGAAGGAGG - Intergenic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1141827068 16:86488038-86488060 CAGAGAAAGGGCACGGAGGGAGG - Intergenic
1141892738 16:86937933-86937955 CTCAGAAAGGGGATGGGATGGGG + Intergenic
1142109433 16:88323414-88323436 CAGAGAAGTGGGAAGGAAGAAGG - Intergenic
1142169965 16:88616582-88616604 CTGATAAGGGAGAAGGAAGCAGG - Intronic
1142218480 16:88841465-88841487 TTGAGGAAAGGGAAGGACGGGGG - Intronic
1142399895 16:89853026-89853048 CTGAGAGAGAGGACGGAAGATGG - Intronic
1142446977 16:90146858-90146880 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1142448573 16:90159645-90159667 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1142458912 17:75644-75666 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1142460515 17:88473-88495 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1142607610 17:1090766-1090788 CAGAGAACAGGGCAGGAAGGAGG + Intronic
1143029123 17:3957706-3957728 CTGGGAGAGAGCAAGGAAGGAGG - Intronic
1143496449 17:7315331-7315353 CTGAGAAAGCGCAGAGAAGGCGG - Exonic
1143527893 17:7482971-7482993 CTGTGAGAGGGAAGGGAAGGTGG + Exonic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143644242 17:8219685-8219707 GCAAGAAAGGGGAAGGAAAGCGG + Intergenic
1143867905 17:9937465-9937487 CTGAGATAGGGGCAGGAAGGGGG - Intronic
1144100885 17:11941324-11941346 GGGAGAGAGGGGAAGGAGGGAGG - Intronic
1144291665 17:13832577-13832599 GTAAGAAATGGGAAGGAAGAAGG + Intergenic
1145092605 17:19998395-19998417 GTGAGCAAGGGGAAAGAAGTGGG + Intergenic
1145727158 17:27140806-27140828 AGGAGAAAGGAGGAGGAAGGGGG - Intergenic
1146629358 17:34458814-34458836 CTGTGAACCGGGAAGAAAGGAGG - Intergenic
1146636120 17:34506468-34506490 CAGAGAAAAGGAAAGGAAAGAGG + Intergenic
1146931506 17:36781269-36781291 CTGGGAAGAGGGAAGGCAGGAGG + Intergenic
1147261182 17:39210495-39210517 CTGGGACAGAGGAAGGAAAGGGG - Intergenic
1147310326 17:39592263-39592285 CTGGGAAAGGGGATGGGATGGGG - Intergenic
1147581074 17:41627476-41627498 GTGGGGCAGGGGAAGGAAGGTGG - Intergenic
1148127147 17:45242715-45242737 GTGGGAAAGTGGAAGGAAAGAGG - Intronic
1148206394 17:45783010-45783032 CTGAGAAGAGGGCAGGAGGGAGG + Intergenic
1148278605 17:46329467-46329489 GTGAGAAAGGGGAAGAAACATGG - Intronic
1148300815 17:46547329-46547351 GTGAGAAAGGGGAAGAAACATGG - Intronic
1148324780 17:46776905-46776927 CTGGGAGAGGGGGAGGAAGGAGG - Intronic
1148546373 17:48522282-48522304 CTATGAACCGGGAAGGAAGGGGG + Intergenic
1148739873 17:49886706-49886728 TTCAGACAGGGGAAGGAAAGAGG + Intergenic
1148758703 17:49988084-49988106 CAGAGAGAGAGGAAGGAAGGAGG - Intergenic
1148835951 17:50465864-50465886 CTGAGAACTGGGGAGCAAGGTGG + Exonic
1149580199 17:57744715-57744737 ATGAGGAAGGGAAAGCAAGGGGG + Exonic
1149755544 17:59182691-59182713 TTGACTAAGGTGAAGGAAGGGGG - Intronic
1150065947 17:62109516-62109538 CTGAGCTAGGGTAAGCAAGGAGG - Intergenic
1150293071 17:63992997-63993019 GGAAGGAAGGGGAAGGAAGGTGG + Intergenic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150401688 17:64861934-64861956 GTGAGAAAGGGGAAGAAACATGG + Intronic
1150410159 17:64935633-64935655 ATTAGAAAGGGGAAGCAAAGGGG - Intergenic
1150528496 17:65951747-65951769 CTAAGCAAGTGGAAGAAAGGGGG - Intronic
1150591615 17:66567588-66567610 CTGGGAAAGGGGAGAGATGGTGG - Intronic
1150979812 17:70128403-70128425 CTGAGAGAGGGGAAGTTAGAAGG - Intronic
1151125388 17:71839226-71839248 CTGAGAGAGATGAAGGAAGATGG - Intergenic
1151258772 17:72900454-72900476 AAGAGAAAGAGGAATGAAGGGGG + Intronic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151680579 17:75620678-75620700 CTGAGACTGAGGAAGGAAAGGGG + Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152044674 17:77928113-77928135 CTTAGAAAGGGGCAGACAGGAGG + Intergenic
1152336627 17:79702840-79702862 AGGAGGAAGGGGAGGGAAGGAGG - Intergenic
1152350569 17:79781943-79781965 CTGAGAGACAGGAAGAAAGGGGG - Intronic
1152571651 17:81123724-81123746 CTGAGGGAGGGGGAGGGAGGGGG + Intronic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1153506159 18:5801168-5801190 CTGAAAAAGGGCAAAGGAGGAGG - Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154132603 18:11750242-11750264 CTGAGAAAGGAGCAGGTAGAAGG + Intronic
1154304021 18:13217882-13217904 CTGGGAAAGTGGAAGCAGGGCGG + Intronic
1155210136 18:23593391-23593413 CTGGGAAAGGGGCATAAAGGAGG - Intergenic
1155323119 18:24638368-24638390 CTGAGAGACAGGAAGGTAGGAGG + Intergenic
1155530050 18:26757936-26757958 CTGACAAAGGAGAAGGAAAATGG - Intergenic
1155536900 18:26828126-26828148 CCGAAAAAGTGAAAGGAAGGTGG - Intergenic
1156675664 18:39524712-39524734 CTGAGTAAGGGGAGGGGAGAAGG - Intergenic
1156843792 18:41639305-41639327 GGGAGGGAGGGGAAGGAAGGAGG + Intergenic
1156920034 18:42510751-42510773 GAGGGAAAGAGGAAGGAAGGAGG - Intergenic
1157171386 18:45409633-45409655 CTGGGAAAGGGGTGGGTAGGAGG - Intronic
1157190163 18:45574976-45574998 CTCAGAAAGATGAAGCAAGGAGG + Intronic
1157406434 18:47425770-47425792 ATGAGAGAGGGGAAGCAGGGAGG - Intergenic
1157444139 18:47732101-47732123 CTGAGGAAGGGGAATAGAGGTGG + Intergenic
1157602451 18:48902324-48902346 TGGAGAAAGGGGAAGGAGGGCGG - Intergenic
1157967460 18:52224346-52224368 GAGAGAAAGAGAAAGGAAGGGGG - Intergenic
1158139156 18:54238982-54239004 ATGAGTAAGGGGAAGGAATGAGG - Intergenic
1158236564 18:55322396-55322418 CGGAGAAAGGGGAGGGAAAGGGG + Intronic
1158371175 18:56806276-56806298 CTGAGCATGGCGAAGGCAGGAGG - Intronic
1159119735 18:64154852-64154874 AAGATAGAGGGGAAGGAAGGGGG - Intergenic
1159209944 18:65305605-65305627 CTGTGAAAGGGAGAGAAAGGAGG - Intergenic
1159231539 18:65613385-65613407 GAGAAAAGGGGGAAGGAAGGAGG + Intergenic
1159657350 18:71048073-71048095 CTGAGATTGAGGAAGGAAGAAGG - Intergenic
1159930711 18:74310525-74310547 CAGAGAAAGTGGGAGAAAGGAGG - Intergenic
1160047287 18:75398773-75398795 GAGAGAGAGAGGAAGGAAGGGGG - Intergenic
1160087052 18:75786349-75786371 CTCAAAAAGGCAAAGGAAGGGGG - Intergenic
1160115649 18:76076736-76076758 CTGAGAAAGCAGAAGTGAGGAGG + Intergenic
1160122258 18:76141230-76141252 TTGAGATAGGCGAAGGATGGGGG + Intergenic
1160178294 18:76613439-76613461 CTGAGAAAAGGGATGGAGGCAGG + Intergenic
1160355886 18:78228195-78228217 CTGGGCAAGGCAAAGGAAGGCGG + Intergenic
1160648631 19:208157-208179 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1160650230 19:220973-220995 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1160872128 19:1282365-1282387 GTATGAAGGGGGAAGGAAGGAGG + Intergenic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1160983277 19:1826469-1826491 CAGAGATGGGGGAAGGGAGGAGG + Intronic
1161437164 19:4270529-4270551 CTGAAAAAGGGGGAGGGGGGTGG + Intergenic
1161746235 19:6061806-6061828 CTGAGAAAGGGGCTGGGAGGGGG + Intronic
1161821539 19:6533551-6533573 CTCTGGAGGGGGAAGGAAGGGGG - Intronic
1162333055 19:10042224-10042246 CTGAGAGTGGAGAGGGAAGGAGG - Intergenic
1162562519 19:11425894-11425916 CTGAGTAAGGGGAAGGCTGGAGG + Intronic
1162565987 19:11446109-11446131 CTGAGGAGGGGGCAGGAGGGTGG + Intronic
1162726863 19:12695108-12695130 CTGGGAAATGGGCAGGCAGGTGG - Intronic
1162935415 19:13979307-13979329 CCGGGAAAGGGGAAGGATGTAGG + Intronic
1163206058 19:15803479-15803501 GGGAGAAGGGGGAGGGAAGGGGG + Intergenic
1163282991 19:16328404-16328426 CTGAGAATGGGGAAGGTGAGGGG - Intergenic
1163348787 19:16762199-16762221 TGCAAAAAGGGGAAGGAAGGAGG - Intronic
1163454912 19:17400846-17400868 GTGAGCAAGGGGAAGTGAGGGGG + Intergenic
1163624406 19:18380636-18380658 CTGTGAGAGGACAAGGAAGGAGG + Intronic
1164009550 19:21188013-21188035 CTGAGATAGGCCAAGGAGGGTGG + Exonic
1164676358 19:30104247-30104269 CTGAGGAAGGGGAGGCAGGGGGG - Intergenic
1164676986 19:30107508-30107530 CCCAGCAAGGGGAAGGAAGGGGG + Intergenic
1164737226 19:30550626-30550648 GAAAGAAAAGGGAAGGAAGGGGG + Intronic
1164859444 19:31551248-31551270 CTGTGAGAGGGGAGAGAAGGAGG - Intergenic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165844271 19:38808262-38808284 GAGGGAAGGGGGAAGGAAGGAGG + Intronic
1165848950 19:38837977-38837999 CTGAGGCAGCGGAAGGGAGGAGG - Intronic
1165933053 19:39372761-39372783 CTGAGAAGGGAGAAAGAAGGAGG + Intronic
1166164372 19:40976990-40977012 GAGAGAAAGGAAAAGGAAGGAGG - Intergenic
1166182333 19:41117677-41117699 ATGACAATGGGGAATGAAGGGGG - Intronic
1166294478 19:41882418-41882440 CTGAGAAAGGGAGAGGAGAGAGG + Intergenic
1166392877 19:42419661-42419683 CTGAGCAGGGGTAAGGAGGGCGG + Intronic
1166539882 19:43598074-43598096 CCCAGAAGGAGGAAGGAAGGAGG + Intronic
1166678488 19:44753802-44753824 CTGGGGAGGGGGCAGGAAGGCGG + Intronic
1166823619 19:45595931-45595953 CCCAGAGAGGGGACGGAAGGAGG + Intronic
1166856444 19:45784671-45784693 CCCAGACAGGGGAAGGAAGTTGG - Exonic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1167104425 19:47421870-47421892 CGGAGAGAGGGAGAGGAAGGAGG - Intergenic
1167337818 19:48897465-48897487 CTGAGATAGGGGCAGGATGGGGG - Intronic
1167526670 19:49988556-49988578 GAGAGAGAGGGGAAGGAAGGGGG - Intronic
1167612216 19:50513012-50513034 CTGGGAGAGGGGAAAGAGGGCGG + Intronic
1167674706 19:50877149-50877171 CAGGGAAGGGGGAAGGAGGGCGG - Intronic
1167792623 19:51690929-51690951 GGGAGGAAGGGGAAGGGAGGAGG - Intergenic
1168077177 19:53987435-53987457 GAGTCAAAGGGGAAGGAAGGAGG + Exonic
1168326186 19:55539619-55539641 CTGAGAAAGGGGGACGGAGCTGG + Intergenic
1168402148 19:56091594-56091616 CTGGGAGTGGGGAAGGCAGGAGG + Intronic
1168528240 19:57105792-57105814 CTGAGAAAGGTGTAGTAATGCGG - Intergenic
1168683891 19:58336356-58336378 CAGAGACAGGGAGAGGAAGGAGG + Intronic
1202697518 1_KI270712v1_random:135813-135835 GTGGGAAGGGGGAAGGGAGGGGG - Intergenic
925169736 2:1743628-1743650 CTGGGGGAGGAGAAGGAAGGGGG + Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925239675 2:2312839-2312861 TGGAGAAATGGGAAGAAAGGGGG + Intronic
925299430 2:2800133-2800155 GAGGGAAGGGGGAAGGAAGGAGG + Intergenic
925356739 2:3246959-3246981 GGGAGAGAGGGGAAGGAGGGAGG + Intronic
925440763 2:3883339-3883361 CGGAGAAAGTGGGAGGAAAGGGG - Intergenic
925445363 2:3922647-3922669 AAGAGGAAGGGGAAGGAAAGAGG + Intergenic
925482172 2:4287613-4287635 TTGAGAGAGGAGAAGCAAGGAGG - Intergenic
925869715 2:8259224-8259246 TTGAGAAAAGGAAAGAAAGGGGG - Intergenic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
926194196 2:10752276-10752298 CTGATAAAAGCAAAGGAAGGAGG - Intronic
926369248 2:12163700-12163722 GAGAGGAAGGGGAATGAAGGAGG - Intergenic
926370499 2:12173991-12174013 CTAAAAAAGTGGAAGGAAAGAGG - Intergenic
926394868 2:12430558-12430580 CTGAGAAAAGGGAAGGGAAAAGG + Intergenic
926417660 2:12665651-12665673 CTGAAGTAGAGGAAGGAAGGTGG - Intergenic
926464726 2:13174366-13174388 GTGGGAAAGAGGAAGGAATGAGG - Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927104225 2:19810125-19810147 CTGGGAAAGGGCAAGGCTGGAGG + Intergenic
927522496 2:23707874-23707896 CTGAGAAAAGGGAAGCCAGGAGG + Exonic
927563964 2:24094724-24094746 CTTAGAGAGGCCAAGGAAGGAGG - Intronic
927628627 2:24750911-24750933 CTTAAAAGGGGGAAGGAGGGGGG + Intronic
927641714 2:24849737-24849759 CTGACAGAGGGGAAAGGAGGAGG + Intronic
927650845 2:24912880-24912902 CTGCGACAGGGAAAGGATGGAGG + Intronic
927665519 2:25029533-25029555 CTGAGGAAGGGGCAGCAATGTGG - Intergenic
927789992 2:26002259-26002281 CAGACAAATGGGAAGGAAGTTGG - Intergenic
927852817 2:26510750-26510772 CTGAGTAGGGGGAAGAAATGAGG + Intronic
927873632 2:26640090-26640112 CGGAGAAAGGGCAGGGAGGGAGG + Intronic
927877811 2:26670501-26670523 GTGGGAGAAGGGAAGGAAGGAGG + Intergenic
927996934 2:27493479-27493501 CTGAGAAGGGAGAAGGCAGAAGG + Intronic
928102965 2:28450111-28450133 CAGAGGAGGGGGAAAGAAGGAGG - Intergenic
928143135 2:28748232-28748254 CTGACCAAGGGCAGGGAAGGAGG + Intergenic
928529138 2:32172949-32172971 CAGAGAAATAGGAGGGAAGGCGG - Intronic
928622768 2:33107914-33107936 CTGAGAGGAGGGAAGGGAGGAGG + Intronic
928915314 2:36464377-36464399 CTGGGAAATGGGAAGGCAGGAGG - Intronic
929162168 2:38843211-38843233 CTGAGAAAGACAAAGGAATGTGG + Intronic
929230966 2:39559854-39559876 CTGAGAAAGGTGAATGAGTGGGG - Intergenic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
929912003 2:46097890-46097912 CTAACAAAGGGGAAGGGAGGAGG + Intronic
930027862 2:47040332-47040354 CTGGGAAAGGGGAAGGAGCGTGG - Intronic
930673573 2:54176942-54176964 CTGTGAAAGGAGAGGGAAGCTGG - Intronic
930929328 2:56861653-56861675 GTGAGAAAGGGGGTGGAAGAAGG + Intergenic
930933543 2:56918845-56918867 TTAGGAAAGGGAAAGGAAGGTGG - Intergenic
931037002 2:58254917-58254939 GTGGGAAAAGGGAAGGAAGCCGG - Intergenic
931188036 2:59972556-59972578 TTGAAAAAGGGGAAAGAAAGTGG - Intergenic
931443620 2:62308512-62308534 CTGAGAGAGAGGAAGGAAAAGGG + Intergenic
931529971 2:63202842-63202864 CACAGACAAGGGAAGGAAGGAGG - Intronic
931922637 2:67037723-67037745 CTGAGAAAGGGGTGGGAAACAGG + Intergenic
932309653 2:70729301-70729323 CTGAGGCAGAGGGAGGAAGGAGG - Intronic
932429593 2:71666127-71666149 ATGGGAAAAGGGAATGAAGGGGG - Intronic
932433104 2:71687042-71687064 CCGAGTAAGGAGAAGGCAGGGGG - Intergenic
932486841 2:72089305-72089327 GGGAGAGAGTGGAAGGAAGGAGG + Intergenic
932559128 2:72851722-72851744 ATGAGAAGGAGGGAGGAAGGAGG - Intergenic
932882447 2:75516454-75516476 ATGAGTATGGGGCAGGAAGGAGG + Intronic
932947757 2:76257105-76257127 CTGAGAAAAGGGTAGGAATTGGG + Intergenic
932952086 2:76305394-76305416 CAGAGAAAGGGGGACAAAGGAGG + Intergenic
933787346 2:85854078-85854100 TAGAGAAAGAGGAAGGAATGGGG - Intronic
934484262 2:94688062-94688084 CTGGGAAAAAGGAAGTAAGGTGG + Intergenic
934554919 2:95282040-95282062 CTGGGACCGGGGAAGGAAGGAGG + Intronic
934637773 2:96006769-96006791 CTAAGAAAGGTGAGGGAAGTAGG + Intergenic
935098364 2:99968803-99968825 CTTATAAAGGGAAAGGCAGGAGG - Intronic
935131301 2:100263119-100263141 AGGAGGGAGGGGAAGGAAGGAGG - Intergenic
935167340 2:100580872-100580894 GTCAGAAAGTAGAAGGAAGGGGG - Intergenic
935364475 2:102275064-102275086 CTGACAAAGAGAAAGGAAGTTGG - Intergenic
935554474 2:104493348-104493370 CTAAGAAAGAGCAAGAAAGGGGG - Intergenic
935579706 2:104746033-104746055 CGGAGAAGGAGAAAGGAAGGCGG + Intergenic
935593017 2:104857724-104857746 CTCTGAAATGGGAAGGAGGGGGG + Exonic
935597228 2:104888715-104888737 CTGAGAGTGGGGAAGGAAGTGGG - Intergenic
935626657 2:105177262-105177284 GAGAGAAGGAGGAAGGAAGGAGG - Intergenic
935813587 2:106825226-106825248 CTGAGAAAGAGCAAGGAGGAAGG - Intronic
935874822 2:107494869-107494891 AGGAAAAAGGGGAAGGATGGAGG + Intergenic
935903566 2:107818365-107818387 AGAAGAAAGGAGAAGGAAGGAGG - Intergenic
936485256 2:112919899-112919921 ATGTGAAAGAGGAAGGCAGGAGG - Intergenic
936580025 2:113691486-113691508 CTCAGAAGGGGGAGGGTAGGAGG - Intergenic
936834683 2:116694305-116694327 CTATGAAAGGGGAAGGGATGAGG + Intergenic
937062798 2:118992773-118992795 GAGAGAGAGGGAAAGGAAGGAGG - Intronic
937345216 2:121121163-121121185 CTGTGGAAGGGGAGGGCAGGGGG + Intergenic
937382712 2:121395052-121395074 TTGACAATGAGGAAGGAAGGAGG + Intronic
937450099 2:121994772-121994794 ATGATAAAGGGGAAGAAACGTGG - Intergenic
937705682 2:124918181-124918203 CTGAGAAAAGGGAAGGAGAGGGG - Intergenic
938364588 2:130725030-130725052 GTGAGAAAGAGAAGGGAAGGAGG - Intergenic
938416126 2:131105215-131105237 CTGAGAAACGGGACGGAAGGCGG - Exonic
938555855 2:132423620-132423642 CTGGGGAAGGGGATGGAAGTGGG - Intronic
939087295 2:137736770-137736792 CAGAGGAAAGGGTAGGAAGGGGG + Intergenic
939169267 2:138675000-138675022 ATGAAACAGGAGAAGGAAGGTGG - Intronic
939427990 2:142065591-142065613 ATGACAAAGGGGAATTAAGGTGG - Intronic
939630041 2:144518601-144518623 CTGAGAGGGGTGAAGGGAGGGGG + Intronic
939963998 2:148592835-148592857 CTGAGAGAGGGGAAGCAGTGGGG - Intergenic
940006869 2:149016324-149016346 CTGAAGAAGGGGTAGGAATGGGG + Intronic
940007052 2:149017361-149017383 CTGAGAGAGAGGGAGGAAGCAGG + Intronic
940160584 2:150708338-150708360 AGGAGAAAGGGGAGGGGAGGAGG + Intergenic
940261582 2:151785428-151785450 TTGAGAAATGGGAAAGAAGGAGG + Intergenic
940557448 2:155248683-155248705 AGGAGAAAGGAGAAGGAAAGAGG + Intergenic
940847476 2:158657178-158657200 CTGAGTAAGAGGAAAGTAGGTGG - Intronic
940860996 2:158770744-158770766 CTGAGAACTGGCAAGCAAGGAGG + Intergenic
941451497 2:165665874-165665896 AAGAGAGAGAGGAAGGAAGGAGG + Intronic
941479238 2:165985317-165985339 GGGAGAAAGGGAAAGGTAGGAGG + Intergenic
941558874 2:167018821-167018843 CTGAGAAAGGGAAGGCAAGTGGG - Intronic
941632526 2:167900411-167900433 CTGAGCTGGGGAAAGGAAGGAGG - Intergenic
942124960 2:172814796-172814818 CTGGGAAAGTGGAATGAATGGGG + Intronic
942535031 2:176954333-176954355 GTGAGAGAGAGGAAGGAATGTGG + Intergenic
942967525 2:181915030-181915052 GTGAGAAAGTGAGAGGAAGGAGG + Intronic
943426834 2:187748611-187748633 CTTGGAGAGGGGAAGGAAAGTGG - Intergenic
943449377 2:188028764-188028786 CTAGGGAAGGGGAAGGAAGCCGG + Intergenic
943660230 2:190552211-190552233 CTGAGCAGGAGGAAGCAAGGGGG - Intergenic
943920334 2:193699156-193699178 CTGAGAAACTGGAAGGAGGTGGG - Intergenic
943976463 2:194484722-194484744 CTGAGAAAATGGAAGGAAAAAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944481894 2:200165715-200165737 GTGAGAAAGGGGAAGGTTTGAGG - Intergenic
944634398 2:201660796-201660818 CCCAGGAAGGGGAAGGAATGAGG - Intronic
944827586 2:203501027-203501049 TAGAGAAAGGGGCAGGAGGGAGG + Intronic
945004639 2:205391220-205391242 TAGAGAAAAGGGAAGGAAAGAGG + Intronic
945160040 2:206880553-206880575 CTGAGAAAGGAGAACAAAGTTGG - Intergenic
945307073 2:208268759-208268781 AAGAGGAAGGGGAAGGAAAGAGG - Intronic
945683854 2:212945738-212945760 CTGAGAAATTGGTAGGAAGACGG - Intergenic
946031879 2:216711851-216711873 CTGAGAAATAGGAAGGATGTAGG - Intergenic
946032994 2:216719875-216719897 ATGGGGAAGGGGAAAGAAGGAGG - Intergenic
946946851 2:224830232-224830254 ATGAAAAGGGGGAAGGAAGGAGG - Intronic
947125180 2:226861274-226861296 CAGAGAAACGGGTTGGAAGGAGG + Intronic
947251722 2:228113827-228113849 TTGAGAAAGGGAGAGGGAGGAGG - Intronic
947368060 2:229416935-229416957 AGGAGCAAGGGGAAAGAAGGAGG + Intronic
947382583 2:229559627-229559649 CAGAAGAAAGGGAAGGAAGGAGG + Intronic
947448875 2:230186653-230186675 CTCAGAAAGGAGAGGGACGGAGG - Intronic
947833387 2:233158029-233158051 AAGAGAGAGGGGAAGGAGGGAGG + Intronic
947935017 2:233997354-233997376 CTGGGAATGGGGCAGGGAGGAGG - Intronic
948091881 2:235302039-235302061 GAGAGAAGGGGGAAGGAGGGAGG - Intergenic
948307146 2:236956769-236956791 CTGTGAAAGGAAAAGGGAGGAGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
1168806733 20:676016-676038 CGGAGAAAGGGGAGTGAGGGGGG + Exonic
1168904341 20:1391807-1391829 TTGAGAAAGGGGAAGGAGGAGGG + Intronic
1168955064 20:1828918-1828940 GAGGGAGAGGGGAAGGAAGGAGG - Intergenic
1169218563 20:3807390-3807412 CTGAGAAAGGGAGATGGAGGAGG + Intergenic
1169371369 20:5030735-5030757 GTGAGACAGGGAAGGGAAGGCGG - Intergenic
1169652838 20:7888733-7888755 GGGAGAAAGGGAAAGGAAGGAGG + Intronic
1169784451 20:9344130-9344152 GGTAGAAAGGGGAAGGGAGGTGG - Intronic
1169843868 20:9968496-9968518 CTGAGAATGGATATGGAAGGAGG + Intergenic
1170382588 20:15777626-15777648 GAGAGAGAGAGGAAGGAAGGAGG - Intronic
1170633333 20:18083606-18083628 GTGTGGAAGGGAAAGGAAGGTGG + Intergenic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1170871443 20:20210209-20210231 CCAGGAAAGTGGAAGGAAGGGGG - Intronic
1170894737 20:20403014-20403036 GTGAGAAATGACAAGGAAGGAGG - Intronic
1171082638 20:22203249-22203271 ACTAGAAAGGGGAAAGAAGGAGG + Intergenic
1171218890 20:23375646-23375668 CTCAGAACTTGGAAGGAAGGAGG + Exonic
1171388012 20:24783159-24783181 CTGGGCAGGGGGAAGGAGGGAGG - Intergenic
1171780986 20:29417601-29417623 CTGAGGAAGGGTGAGAAAGGGGG - Intergenic
1172033147 20:31995544-31995566 CTGGCAACGGGGAAGGGAGGAGG - Intronic
1172479142 20:35260739-35260761 TTGAGCAACGGAAAGGAAGGGGG - Intronic
1172767734 20:37359639-37359661 GTGAGAAAGGGGAAGAACAGGGG + Intronic
1173151081 20:40566816-40566838 ATGAGCAAGGGGGAGGGAGGAGG - Intergenic
1173273596 20:41558703-41558725 CTGAGAAGGGGGAGAGAGGGTGG - Intronic
1173664443 20:44754599-44754621 CGGGGACAAGGGAAGGAAGGGGG + Intronic
1173751678 20:45481439-45481461 CCGAAAAAGGGGAGGGCAGGTGG - Exonic
1174197412 20:48783336-48783358 CTGAGCAAGTGGAAGAATGGAGG + Intronic
1174418145 20:50381091-50381113 GAGAGAAAGAGGGAGGAAGGAGG + Intergenic
1174818529 20:53707847-53707869 CTGACCAGTGGGAAGGAAGGTGG + Intergenic
1175010968 20:55735625-55735647 AGGAGAAAGAGGAAGGATGGAGG - Intergenic
1175369497 20:58478403-58478425 AGGGGAAAAGGGAAGGAAGGAGG - Intronic
1175838717 20:62013334-62013356 GCCAGAGAGGGGAAGGAAGGTGG + Intronic
1176121508 20:63456217-63456239 ACCAGAATGGGGAAGGAAGGCGG - Intronic
1176291093 21:5045121-5045143 CTCAGAAAGAGGCAGGAAGGTGG - Intergenic
1176443451 21:6798897-6798919 CTCTGCAACGGGAAGGAAGGTGG - Intergenic
1176511546 21:7752118-7752140 CTAAGAGAGGGGCAGGAAGGGGG + Intronic
1177111170 21:17031178-17031200 CTGAGAACGTGGCAAGAAGGTGG - Intergenic
1177821359 21:26034234-26034256 GAGAGAGAGGGGAAGGAAGGAGG - Intronic
1178050185 21:28738435-28738457 AAGATAAAGGGCAAGGAAGGGGG + Intergenic
1178070364 21:28958913-28958935 GAGAGAAAGAGGAAGGAAGAAGG + Intronic
1178168536 21:30010703-30010725 CTGATAAGGGGAAAGGAAGAAGG - Intergenic
1178174169 21:30077197-30077219 CTTATTAAGAGGAAGGAAGGAGG + Intergenic
1178327339 21:31656645-31656667 AAGAGAAAGAAGAAGGAAGGAGG - Intergenic
1178365939 21:31988841-31988863 CCGAGAAAGAAAAAGGAAGGAGG - Intronic
1178645660 21:34382646-34382668 CTAAGAGAGGGGCAGGAAGGGGG + Intronic
1178758459 21:35376519-35376541 CTGAAAGAGTGGAAGGAAGCCGG - Intronic
1179061404 21:37982991-37983013 GGGAGAGAGGGAAAGGAAGGAGG - Intronic
1179782196 21:43708677-43708699 TTGAGAAAGGCTAAGGCAGGAGG - Intergenic
1179866162 21:44218520-44218542 CTCAGAAAGAGGCAGGAAGGTGG + Intergenic
1180051050 21:45331103-45331125 GTGGGAAAGGGGAGGGGAGGTGG + Intergenic
1180118013 21:45724815-45724837 CTGAGAAAGTGGGTGGCAGGAGG + Intronic
1180877493 22:19181492-19181514 CTGAGAAATGAGGAGGAAGCAGG + Intronic
1181417409 22:22770677-22770699 CAGAGAAAAGGGCAGGGAGGTGG - Intronic
1181615192 22:24049525-24049547 CTGGGAAGGGGAAAGGCAGGAGG - Intronic
1181762468 22:25067685-25067707 GAGAGAAAGGGGCTGGAAGGAGG - Intronic
1181802774 22:25358255-25358277 CTGTGAAAGAGGAAGGGACGGGG - Intronic
1181853917 22:25769021-25769043 CTGAGAATGGGGGAGAAAGCAGG + Exonic
1181897162 22:26120461-26120483 CGGAGAAAAGGGAGAGAAGGTGG + Intergenic
1182276844 22:29195297-29195319 CTCAGAAAGGGGAAGCAATTTGG + Intergenic
1182458828 22:30470124-30470146 CTGAGAACAGGGATGGAAGGAGG + Intronic
1182751423 22:32644854-32644876 CCGGGAAAGGGGAGGGATGGGGG + Intronic
1182769109 22:32780978-32781000 GTGAGAGAGAGGAAGGAAGGAGG - Intronic
1182797378 22:33000715-33000737 ATCTGAAAGGGGAAAGAAGGGGG + Intronic
1183111616 22:35653636-35653658 GCGAGAGAGGTGAAGGAAGGAGG + Intronic
1183316343 22:37139052-37139074 CAGAGGAGGTGGAAGGAAGGAGG + Intronic
1183546661 22:38457767-38457789 AGGAGGAAGGGGCAGGAAGGAGG + Intergenic
1183618519 22:38959428-38959450 CGGAGCAGGGGGAAGGAGGGTGG + Intronic
1184088825 22:42281980-42282002 CTGTGAGAGGGCAAAGAAGGTGG + Intronic
1184191075 22:42894915-42894937 ATGGGCAAGGGGAGGGAAGGGGG + Intronic
1184191814 22:42900020-42900042 CTGAGATGGGGGCAGGTAGGAGG - Intronic
1184286460 22:43474479-43474501 CTGAGAGAGGGGCGGGCAGGAGG - Intronic
1184286484 22:43474646-43474668 CTGAGAGAGGGGCGGGCAGGAGG - Intronic
1184385299 22:44170749-44170771 CTGAGAGATGCCAAGGAAGGGGG - Intronic
1184437608 22:44488930-44488952 GGGAGAAAGGGGAGGGAGGGAGG + Intergenic
1184451848 22:44587143-44587165 AAGAGAAGGGAGAAGGAAGGGGG + Intergenic
1185149088 22:49154088-49154110 CTAAGCAAGGGGCAGGGAGGTGG + Intergenic
949382796 3:3464912-3464934 GAGAGAGAGGGGAAGGGAGGTGG - Intergenic
949482914 3:4510987-4511009 CTGAGAAATGGCTATGAAGGAGG + Intronic
949930424 3:9074121-9074143 CGGAGAATGGGAAACGAAGGAGG + Intronic
950007020 3:9697976-9697998 CTGAGAGAGGGGAGGGCAGGAGG - Intronic
950067526 3:10124938-10124960 GTGAGAAAGGCATAGGAAGGGGG - Intronic
950132740 3:10558443-10558465 CTGAGAAGGTGGGAGGAGGGGGG + Intronic
950708193 3:14796760-14796782 CTGAGAAAGGAGGAGGGAGCTGG - Intergenic
951114604 3:18845422-18845444 GAAAGAAGGGGGAAGGAAGGAGG - Intergenic
951273764 3:20659797-20659819 GGAAGGAAGGGGAAGGAAGGAGG - Intergenic
951289077 3:20853888-20853910 ATGAGAAAGGGGAAAGAAACTGG - Intergenic
951858870 3:27228325-27228347 CTGAGCAATGGGAGGGAAAGTGG - Intronic
952590147 3:34942633-34942655 CAGAGAGAGAGGAAGGAAGGAGG - Intergenic
952717032 3:36490249-36490271 CTGAGAAAGGAGATGCAACGTGG - Intronic
952908426 3:38160161-38160183 CTGGGGAAGGGGAAATAAGGAGG + Intergenic
952920023 3:38277661-38277683 ATGAGAAAGGTGAAGGAGGCCGG - Exonic
953138595 3:40205880-40205902 CAGAGAAAGGAGCAGTAAGGAGG - Intronic
953191379 3:40691086-40691108 CTGGGAGCGGGGATGGAAGGAGG - Intergenic
954144603 3:48628317-48628339 GGGAGAAAGGGGAAGGGATGAGG + Intronic
954293999 3:49664163-49664185 GCAGGAAAGGGGAAGGAAGGAGG - Intronic
954407556 3:50353910-50353932 CAGAGAAAGGGGAAGGAAATGGG - Exonic
954411847 3:50374318-50374340 AGGAGAAAGGGGAGGGTAGGGGG + Intronic
954432948 3:50480910-50480932 GGGAGGAAGGGGGAGGAAGGGGG + Intronic
954432953 3:50480920-50480942 GGGAGGAAGGGGGAGGAAGGGGG + Intronic
954493187 3:50927225-50927247 GTCAGTGAGGGGAAGGAAGGAGG - Intronic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
954982506 3:54759332-54759354 GAGAGAAAGGGGAGGGAAAGTGG + Intronic
954994564 3:54869905-54869927 CAGATGAAGGGGAAGGAAAGTGG - Intronic
955011659 3:55022639-55022661 AGGAGAGAGAGGAAGGAAGGAGG - Intronic
955072441 3:55583446-55583468 GGGAGAGAGGGGAAGGAGGGAGG - Intronic
955206447 3:56900012-56900034 CCCAAAAAGGGGAAGGAAGAAGG - Intronic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
955352372 3:58203294-58203316 CTCAGAAGTGGGAAGGAAGCTGG - Intronic
955767141 3:62356743-62356765 ATGAGTAAGGAGAAGGATGGAGG + Intergenic
955769379 3:62373100-62373122 CTTTGAAAGGGGGAAGAAGGGGG + Intronic
955867925 3:63405132-63405154 TTGAGAAAGGGGAAGGACAGAGG - Intronic
956026863 3:64992589-64992611 CTGGGAAAGGGGAACCAAGTGGG - Intergenic
956139270 3:66129159-66129181 CTGGGAAATGTGAAGTAAGGTGG - Intergenic
956539621 3:70321249-70321271 CTGGGAATGGGGATGGAGGGAGG - Intergenic
956731873 3:72203860-72203882 CAGAGGAAGAGGAAGGAAGTGGG + Intergenic
957084009 3:75663684-75663706 CTGAGGAAGGGTGAGAAAGGGGG + Intergenic
958119416 3:89264454-89264476 CTGAGCAAGGGGTACGAGGGAGG - Intronic
958781467 3:98548481-98548503 CAAAGAAAGGGGAGGGAGGGAGG + Intronic
959311695 3:104745955-104745977 GAGAGTAATGGGAAGGAAGGGGG + Intergenic
959943255 3:112101798-112101820 CTGAGAAAGGCGTAGGTGGGAGG - Intronic
960322572 3:116254435-116254457 AAGAGAAAGGGAAAGGAAGAAGG + Intronic
960616929 3:119604603-119604625 CTGAGAAGGGGGAAGGAGTTGGG + Intronic
960619900 3:119627659-119627681 CTGAAAAAGAGGAAAGAAGGAGG - Intronic
961053329 3:123766294-123766316 CAGAGAAGGGGGAATGAGGGTGG - Intronic
961173563 3:124816110-124816132 GTGGGAAGGGGGAAGAAAGGGGG + Intronic
961396797 3:126599235-126599257 CAGGGAGAGGGGAAGGAAGGAGG - Intronic
961501086 3:127336634-127336656 CTGAGAAAGACAAAGAAAGGGGG - Intergenic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961786280 3:129348985-129349007 CTGAGAAAGGGGAAGTGAGTAGG + Intergenic
961811665 3:129525470-129525492 CCCAGAGAGGGGAAGGAAGCAGG + Intergenic
961827730 3:129607431-129607453 CTGAGAAAGGTGGTGGAGGGAGG - Intergenic
962244325 3:133779046-133779068 CTAAGGAAGGGGCAAGAAGGAGG + Intergenic
962480450 3:135793699-135793721 GTGAGAACAGGGAAGGAAGAAGG - Intergenic
962662613 3:137619038-137619060 CTAAGGATGGAGAAGGAAGGTGG + Intergenic
963110192 3:141682267-141682289 GAAAGAAAGAGGAAGGAAGGAGG + Intergenic
963237324 3:142968470-142968492 CTGGGAGAGGGGATGGAAGCAGG - Intronic
963345787 3:144095481-144095503 GGGTGAAAGGGGAAGAAAGGGGG - Intergenic
963496853 3:146075147-146075169 CTGTGAAAGAGGAAGGTATGTGG + Intronic
963843623 3:150132777-150132799 GAGAGAGAGGGGAGGGAAGGGGG + Intergenic
963863623 3:150336219-150336241 TAGAGAAAGGGGAAGGAGAGTGG - Intergenic
963879382 3:150511732-150511754 CTGAGAAAGAGCAGGGAAGGAGG + Intergenic
963891190 3:150637640-150637662 CTGAGAAGGGGAAAAGAATGGGG - Intergenic
964093793 3:152907822-152907844 CCTAGACAGGGGAGGGAAGGAGG + Intergenic
964193139 3:154029656-154029678 TTGAGAAAGGGAAAGGGAGGAGG - Intergenic
964632373 3:158825711-158825733 CTGAGAAAGGGAGAGGAAAGAGG + Intronic
964741157 3:159967576-159967598 ATGATAAAGTGGGAGGAAGGTGG - Intergenic
964828097 3:160851763-160851785 CCAGGAAATGGGAAGGAAGGAGG + Intronic
965301826 3:167014483-167014505 ATGAGAAATGGGAAGGTAGTAGG - Intergenic
965615303 3:170586218-170586240 CAGACAGAGGGGAAGGCAGGGGG - Intronic
965689846 3:171344003-171344025 TTGAGCAATGGGAAGGAGGGAGG - Intronic
965904229 3:173683275-173683297 AAGAGGAAGAGGAAGGAAGGAGG - Intronic
966279994 3:178215005-178215027 GTGGGGAGGGGGAAGGAAGGAGG - Intergenic
966497084 3:180593332-180593354 TTGAGAAATAGCAAGGAAGGCGG - Intergenic
966886888 3:184381816-184381838 GTGAGAAAGGGGAAGGAGCAAGG + Intronic
967439038 3:189485645-189485667 CTAAGAAAGAGGAGGGAGGGTGG - Intergenic
967741519 3:193008198-193008220 CAGAGAAATGGGATGGTAGGTGG - Intergenic
967817981 3:193815306-193815328 CTGGGGAAGGGAAGGGAAGGGGG - Intergenic
967954707 3:194869280-194869302 CTGAGGGAGGGGAAGGAAAGGGG + Intergenic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968131004 3:196192777-196192799 AGGAGCAAGGGGAAGGGAGGAGG + Intergenic
968274339 3:197428385-197428407 CTGAGCAAGGAGAAGGGCGGTGG + Intergenic
968367616 3:198199156-198199178 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
968369218 3:198211958-198211980 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
968902006 4:3436312-3436334 CTGAGAACACGGCAGGAAGGGGG - Intronic
969000401 4:3976176-3976198 CTGAGAAAATGCAGGGAAGGTGG - Intergenic
969075489 4:4574849-4574871 GGGAGGAAGGGGGAGGAAGGAGG - Intergenic
969228970 4:5816626-5816648 GGGAGAGAGGGGAAGGAGGGAGG - Intronic
969228980 4:5816652-5816674 GGGAGAGAGGGGAAGGAGGGAGG - Intronic
969278332 4:6152086-6152108 AAGAGACAGGGGAAGGAAGAAGG + Intronic
969561334 4:7950249-7950271 GTGAGCAAGGGGATGGATGGTGG - Intergenic
969607794 4:8211181-8211203 GGGAGAAAAGGGGAGGAAGGAGG - Intronic
969616049 4:8253132-8253154 CAGGGAAAGGGGAAAGAAGGAGG - Intergenic
969728064 4:8937250-8937272 CAGAGAATGGGAAGGGAAGGGGG + Intergenic
970158796 4:13168621-13168643 CAGAGAAAGTTGTAGGAAGGAGG - Intergenic
970311655 4:14788230-14788252 AGGAGTGAGGGGAAGGAAGGGGG + Intergenic
970639092 4:18043828-18043850 ATGGGAAAGGGTAAGGAATGGGG + Intergenic
970672399 4:18411972-18411994 ATGAGAGGAGGGAAGGAAGGAGG - Intergenic
970708106 4:18829775-18829797 CTTGGAAGGGGGAAGGATGGCGG - Intergenic
970894156 4:21083283-21083305 CTGAGGAGGGGGAAGGAAAGAGG - Intronic
970903179 4:21183908-21183930 CTGAGAAGGGAGAGGAAAGGAGG - Intronic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971307546 4:25496794-25496816 ATGAGAAAGGGGAAGGGTGGGGG - Intergenic
971366683 4:25983292-25983314 CTGGAAAAGGAGCAGGAAGGAGG + Intergenic
971405572 4:26319295-26319317 CGGAGGAAGGGGAAGCCAGGAGG - Intronic
972271017 4:37510934-37510956 TTGTGAAAGGGGAGGGAAGAAGG - Intronic
972400325 4:38695928-38695950 AAGAGAAAAGGGAAGGAAAGTGG + Intronic
972445984 4:39144387-39144409 ATAAGAAAGGGGGAGGAGGGTGG - Intergenic
972469503 4:39390162-39390184 CTGAGCAAATGGAAGGATGGAGG - Intergenic
972575023 4:40343624-40343646 CTGAGGAAAGGGAAGGTAAGAGG + Intronic
972790239 4:42364860-42364882 AAGAGAAAGAGGAAGGAAGGAGG - Intergenic
972993175 4:44847465-44847487 CTGAGAATGGTAAAGGAATGGGG - Intergenic
973319434 4:48794982-48795004 ATGGGAGAGGGGAAGGAAGCAGG - Intergenic
973602899 4:52559636-52559658 TTGAGGAAGGGGAAGGGAGGTGG + Intergenic
973639818 4:52891842-52891864 CTTAGAAAGTGGAGGGCAGGGGG - Intronic
974073382 4:57146283-57146305 GAGAGAAAGGGTAAGGAAGGAGG - Intergenic
974212795 4:58803358-58803380 CTGAGACTGGGGAAAAAAGGAGG + Intergenic
974693715 4:65337364-65337386 AAGAGGAAGGGGAAGGGAGGAGG - Intronic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
974838438 4:67276920-67276942 ATCAGAAAGGGGAAGGAGAGGGG - Intergenic
975183043 4:71369152-71369174 TGGGGAAAGGGCAAGGAAGGTGG + Intronic
975290480 4:72672108-72672130 CTCAGAAGTGGGAGGGAAGGAGG - Intergenic
975391471 4:73822897-73822919 GGGAGAAAGGGGAGGGAGGGAGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976259033 4:83128423-83128445 AAGGGAAAGGGGAAGGAAGGAGG - Intronic
976315294 4:83653447-83653469 CTGAGAACCGGGATGGAAAGTGG + Intergenic
976598665 4:86917624-86917646 AAGAGAAAGAGAAAGGAAGGAGG + Intronic
977007882 4:91594918-91594940 CAGAGAAAGGGAAAAGTAGGAGG - Intronic
977433360 4:96960899-96960921 CTGAGGATGGGGAAGGAATATGG - Intergenic
977509530 4:97945207-97945229 CTTAGAAAGGGGAGGGTGGGAGG - Intronic
977705383 4:100064887-100064909 CAGAGAGAAGGGAAGGAGGGAGG - Intergenic
977919220 4:102625191-102625213 GGGAGAAAGAGGAAGGAGGGAGG - Intergenic
977960626 4:103081061-103081083 GTGAGAAGAGGGAAGGAAAGGGG - Intronic
977998323 4:103523720-103523742 GAAAGAAAGAGGAAGGAAGGAGG - Intergenic
978315603 4:107433110-107433132 CTAAGAATGGGCCAGGAAGGTGG - Intergenic
978555829 4:109979425-109979447 AGGAGAGAGGGGAAAGAAGGTGG + Intronic
978624053 4:110664481-110664503 CAGAGAAAGGGGAAGCAGTGAGG - Intergenic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
978831097 4:113085780-113085802 CTGAGAAATTTGGAGGAAGGGGG + Intronic
978872594 4:113597903-113597925 CTGAGGAAAGGGAAAGAATGGGG + Intronic
979256031 4:118608868-118608890 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
979257643 4:118621686-118621708 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
979293196 4:119000707-119000729 AGGAGAAAGGGGAAGGGAGGTGG + Intronic
979330704 4:119418876-119418898 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
979332313 4:119431669-119431691 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
979754514 4:124324512-124324534 CTGAGAACCAGGAAGGCAGGTGG + Intergenic
980113167 4:128653958-128653980 CTGGGAAAGGGAAAAAAAGGTGG + Intergenic
980135895 4:128858196-128858218 ATGAGATAGGGGAATTAAGGAGG + Intronic
980179024 4:129381619-129381641 CTGAGGCAGGGGGAGCAAGGCGG + Intergenic
980195234 4:129579239-129579261 CTGAGACAGGGAATGGAGGGAGG - Intergenic
980447518 4:132930397-132930419 CAGAGAAAGGGAGAGGAAGATGG - Intergenic
981010388 4:139919236-139919258 TTGAAGAAGGGGGAGGAAGGGGG + Intronic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
981912250 4:149995397-149995419 AGGAGAGAGGGGGAGGAAGGAGG + Intergenic
982671670 4:158327622-158327644 CTGACAAAGAGAAGGGAAGGTGG - Intronic
983139513 4:164132183-164132205 CGAAGAAAGAGGAAGGAAGACGG - Intronic
983265473 4:165503552-165503574 TGGAGAAAGGAAAAGGAAGGAGG - Intergenic
983297714 4:165887259-165887281 ATGAGAAAGTGGGAGGAGGGAGG + Intronic
983904314 4:173168758-173168780 CGGAGGAGGGGGAAGGAGGGAGG + Exonic
984172982 4:176383389-176383411 CTGAGAAAGGGAAATGATGCAGG + Intergenic
984473201 4:180203482-180203504 CTGAGAAAAGAGTAGGAGGGAGG + Intergenic
984597227 4:181683797-181683819 CTGAGACAGGGGACAGAAGGTGG + Intergenic
984949970 4:185000843-185000865 TGGAGAAAGGAGAAGAAAGGTGG - Intergenic
985126690 4:186701681-186701703 CTGTGACAGGAGAAGGAATGTGG - Intronic
985851626 5:2392626-2392648 AAGAGAAAGAGGAAGGAGGGAGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986203895 5:5605115-5605137 CAGAGAAAGGTCAAGGAAGTGGG - Intergenic
986283978 5:6346517-6346539 GTGAGAGGAGGGAAGGAAGGAGG + Intergenic
986294396 5:6424927-6424949 GGAAGAAAGGAGAAGGAAGGAGG - Intergenic
986617048 5:9628448-9628470 CTGATAAAGGGGAAGACAGATGG - Intergenic
986730412 5:10631193-10631215 CTGAGACATGGGAGGGCAGGAGG + Intronic
986736659 5:10673522-10673544 CTGAGAAAGGGCAGGGATTGGGG - Intergenic
987041251 5:14064903-14064925 AAGAGACAGGGAAAGGAAGGAGG - Intergenic
988252626 5:28780087-28780109 CAGAGAAGAAGGAAGGAAGGAGG - Intergenic
988895192 5:35664742-35664764 GAGAGAGAGAGGAAGGAAGGAGG + Intronic
988927978 5:36008359-36008381 CAGAGAAAAAGGAAGGCAGGGGG + Intergenic
988949697 5:36243489-36243511 CTGTGAAATGGGAAGAAATGAGG - Intergenic
989141991 5:38210615-38210637 GTGAGAAAGGAGTAGGAAGGTGG + Intergenic
989323155 5:40160303-40160325 CTGAGAAGGAGGAGGAAAGGAGG + Intergenic
989756216 5:44958768-44958790 AGGAGGAAGGAGAAGGAAGGAGG - Intergenic
989970975 5:50523647-50523669 GAAAGAAAGAGGAAGGAAGGAGG + Intergenic
990378992 5:55202922-55202944 GAAAGAAAGAGGAAGGAAGGGGG + Intergenic
990558204 5:56957076-56957098 CTCAGAAAAGGGAAGGAAAATGG + Intronic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
992030957 5:72721095-72721117 CTGAGAAAGGCTGAGGAGGGAGG - Intergenic
992071724 5:73154786-73154808 CTGGGAATGGAGAAGGAGGGAGG - Intergenic
992417362 5:76564828-76564850 CTGGGAGAGGAGCAGGAAGGAGG + Intronic
992748881 5:79843918-79843940 CTGAGAAACGGCCATGAAGGGGG - Intergenic
992850122 5:80798374-80798396 CTGAGATAAGGGAAGGAATTGGG - Intronic
993278009 5:85887324-85887346 GTGAGAAAAGGGAAAGACGGAGG - Intergenic
994002011 5:94791871-94791893 CTGAGAAAGGTGCTGGAAGAGGG - Intronic
994099879 5:95880745-95880767 CAGAGAAAGAGGAGGGAAGGAGG + Intergenic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
995242185 5:109898089-109898111 CTGAGAGATGGGAAAGAGGGAGG + Intergenic
995701116 5:114937075-114937097 CTGAGAAAAGGGAAGAAGGCAGG + Intergenic
995867801 5:116710220-116710242 CTGAGAGAAGGGAATGAATGAGG + Intergenic
996211888 5:120820074-120820096 CTGAGAAAGAGAAGGGAAGGTGG + Intergenic
996765946 5:127034108-127034130 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
996766500 5:127039598-127039620 CTGGGGATGGGGAAGGATGGAGG + Intergenic
996823896 5:127660059-127660081 CTGAGGAAGGGCACGGAAGCTGG - Intergenic
997391388 5:133520092-133520114 CTGAGAAAGGAGAAGAAAAGAGG - Intronic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997646539 5:135485940-135485962 TTGGGAAGGGGAAAGGAAGGTGG - Intergenic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
998146691 5:139733329-139733351 CTGAGGCAGCGGAGGGAAGGGGG - Intergenic
998182618 5:139956030-139956052 CTGAGACAGGCAGAGGAAGGTGG + Intronic
998395779 5:141816928-141816950 CTCTGAAAGGGCTAGGAAGGAGG - Intergenic
998426578 5:142033935-142033957 AGGTGAGAGGGGAAGGAAGGAGG + Intergenic
998488269 5:142523014-142523036 CTGTGAATGGGGAAAGAAAGGGG - Intergenic
998503135 5:142651071-142651093 CAGAGAGAGGTGAAGGAAGGCGG + Intronic
998636987 5:143966478-143966500 CTTGGAAATGGGAAGGAAGTAGG - Intergenic
998778386 5:145628966-145628988 CAGAAAATGGGCAAGGAAGGTGG + Intronic
998813217 5:145986888-145986910 CAGGGAAAAGGGAAGGAAGTAGG - Intronic
999072795 5:148765349-148765371 ATGAGAAAGGAGAGGGAAGAGGG - Intergenic
999092634 5:148950760-148950782 CAGAGTAGAGGGAAGGAAGGGGG - Intronic
999165901 5:149549554-149549576 CTGAGAAAAGGGCAGGAATATGG + Intronic
999269597 5:150289036-150289058 CTGAGAAAGGGGAGGTAGGGAGG + Intronic
999524156 5:152384026-152384048 GAGAGAAAGAGAAAGGAAGGAGG - Intergenic
999687084 5:154112727-154112749 AAGAGAAAGGGAGAGGAAGGGGG + Intronic
1000048762 5:157544114-157544136 AACAGAAAGGCGAAGGAAGGGGG + Intronic
1000245953 5:159448736-159448758 CTCTGAGAGGGGAAGGAAGCGGG + Intergenic
1000508105 5:162147335-162147357 GAGAGACAGAGGAAGGAAGGAGG - Intronic
1000641070 5:163702258-163702280 CTCAGAAGGGTGAAGGAAAGGGG - Intergenic
1000898898 5:166889603-166889625 CTAAGAAAGTGGAAAGATGGAGG + Intergenic
1000965293 5:167648668-167648690 CTGAGAAAGAGGGCGGAGGGTGG + Intronic
1001049352 5:168402146-168402168 CAGAGGGAGGGGAAGAAAGGAGG - Intronic
1001106201 5:168856840-168856862 CTCAGAGAAGGCAAGGAAGGAGG + Intronic
1001224537 5:169932409-169932431 GAGAGAATGGGGAAGGAAGATGG + Intronic
1001301749 5:170538574-170538596 CTGAGAATGGGTAAGAATGGAGG - Intronic
1001412939 5:171523747-171523769 CTCGGAGAAGGGAAGGAAGGAGG - Intergenic
1001569923 5:172723877-172723899 GAGAGAAAGAGGGAGGAAGGGGG + Intergenic
1001582105 5:172805964-172805986 AAGAGAAAGGAGAAGCAAGGCGG - Intergenic
1001695900 5:173669598-173669620 CAGAAAAAGAGGAAAGAAGGAGG - Intergenic
1002511442 5:179721331-179721353 CTTCGAAAGGCGAAGGCAGGTGG - Intronic
1002726839 5:181304385-181304407 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1002728496 5:181317543-181317565 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1002825642 6:771079-771101 CAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1002899470 6:1398988-1399010 CAGAGAAAAGGCAAAGAAGGGGG + Intergenic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003124394 6:3344401-3344423 CTAGAAAAGGGGAAGGAAAGAGG - Intronic
1003130664 6:3392756-3392778 CTGAGGATGTGGGAGGAAGGAGG + Intronic
1003145184 6:3504425-3504447 CAGACACAGGGAAAGGAAGGTGG + Intergenic
1003199262 6:3943847-3943869 CTGAGAAAGGGAAGGGATGATGG + Intergenic
1003488728 6:6602067-6602089 GTCAAGAAGGGGAAGGAAGGTGG - Intronic
1003491740 6:6628268-6628290 GGGAGGAAGGGGAGGGAAGGAGG - Intronic
1003941079 6:11027677-11027699 CTAAGAAAGGTGAAAGCAGGGGG - Intronic
1004013621 6:11712237-11712259 GTAAGAAAGAGGAAGGAAAGTGG + Intronic
1004363286 6:14990061-14990083 CAGAGATAGGGCAGGGAAGGAGG - Intergenic
1004448056 6:15719894-15719916 TTGGCAAAGGGGAAGAAAGGAGG - Intergenic
1004744834 6:18499441-18499463 CTGAGAAGGAGGAGGGAAGGTGG + Intergenic
1004751380 6:18565795-18565817 ATGAAAAAAGGGAGGGAAGGAGG - Intergenic
1005777110 6:29146238-29146260 CTGGGGCAGGGGAAGGAAGGGGG - Intergenic
1006072501 6:31507632-31507654 CTGGGACAGGGGATGGAAGCTGG + Intronic
1006180654 6:32151719-32151741 CTGAGGAGGGGTAAGGGAGGGGG + Intronic
1006246426 6:32740981-32741003 CAGAGAAAGGGGAGGGAATGGGG + Intergenic
1006367341 6:33623145-33623167 CTGATAAAGCTGAGGGAAGGAGG + Intronic
1006407600 6:33854386-33854408 CTGGGTCGGGGGAAGGAAGGAGG - Intergenic
1006442167 6:34059525-34059547 GTGAGAATGGGCAAGGAATGTGG - Intronic
1006459575 6:34150606-34150628 CTGAGGCTGGGGAAGGAAAGAGG - Intronic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006669465 6:35720606-35720628 CTGAGTAAAGGGAAGGGAAGAGG + Intronic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1006810843 6:36819690-36819712 CAAGGAAAGGGGAAGGGAGGGGG - Intronic
1007088419 6:39166903-39166925 CCGAGGAAGGGGAGAGAAGGAGG - Intergenic
1007160840 6:39790824-39790846 ATGAGAGAGGGAATGGAAGGAGG + Intergenic
1007188058 6:39989458-39989480 ATCAGAAAGGGGAGGGTAGGAGG - Intergenic
1007303255 6:40884647-40884669 CTAAGGTAGGGAAAGGAAGGAGG + Intergenic
1007357978 6:41334701-41334723 CTGAGAATGGGAAAGGCAGAGGG - Intergenic
1007377474 6:41466663-41466685 AAGAGAAGGGGGGAGGAAGGAGG + Intergenic
1007402989 6:41615117-41615139 CTGCGAAAGGGGCAAGAAAGTGG + Intergenic
1007595342 6:43047688-43047710 GGGAGAAAGGGGGATGAAGGAGG - Intronic
1007664957 6:43508617-43508639 CTCAGGAAGGGGCAGGACGGGGG - Intronic
1008005122 6:46402374-46402396 CTGAGCAACTGGAAGGCAGGAGG - Intronic
1008591187 6:52995204-52995226 GAGAGAAAGGGCGAGGAAGGGGG + Intronic
1008635700 6:53408357-53408379 CAGAGAGAGGGGAGAGAAGGTGG + Intergenic
1008730440 6:54475688-54475710 CTCAGAAAGGGGAAAGTGGGAGG + Intergenic
1008760642 6:54847952-54847974 ATGAGAAAGGGAAAGAAGGGAGG - Intronic
1008863236 6:56176906-56176928 GGGAGGAAGGGGGAGGAAGGGGG + Intronic
1009422337 6:63477775-63477797 CTTTGAAAGGCCAAGGAAGGAGG - Intergenic
1009715039 6:67380210-67380232 CTGAGAGAGAGGGAGGAAGAAGG + Intergenic
1010050229 6:71495408-71495430 CAAAGAATGGGGAAGGAAGGTGG + Intergenic
1010073280 6:71769666-71769688 CCAAGAAAGGGGAAGGCATGGGG - Intergenic
1010193324 6:73215072-73215094 AGGAGAGAGGGGAAGGAAAGAGG - Intronic
1010775187 6:79877250-79877272 CTGGTAAAGGGGAGGTAAGGAGG + Intergenic
1010849517 6:80754821-80754843 CTGAGCAAAAAGAAGGAAGGTGG - Intergenic
1011822833 6:91273257-91273279 CTGACAAAGCGGAGGGACGGAGG - Intergenic
1012054784 6:94392724-94392746 CAGAGAGAGGGGAAGGAGTGTGG - Intergenic
1012959690 6:105609433-105609455 CTGGTAAAGGGAGAGGAAGGAGG - Intergenic
1013040306 6:106426466-106426488 ATCAGAAAGGGGAAGAAAGTGGG - Intergenic
1013211989 6:107995345-107995367 CTAAGGAAGGGGAAGAGAGGAGG + Intergenic
1013307442 6:108862644-108862666 CAGAGATAGGGGAAGGGAGAGGG + Intronic
1013590850 6:111618669-111618691 ACGAGAAAGGGGAAGGAGAGAGG - Intergenic
1013618034 6:111862873-111862895 CTAAGGAAAGGGAAGGACGGGGG + Intronic
1014459060 6:121673565-121673587 GGGAGCAAGGGGAAGGAAGGCGG - Intergenic
1014551220 6:122790909-122790931 CTACTAAAGGGGAAGGAAGAGGG + Intronic
1014699508 6:124666293-124666315 CTGAAATAGGAGAATGAAGGTGG + Intronic
1014942623 6:127460967-127460989 TTGAGAGAGGGAAAGGGAGGAGG + Intronic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1015916503 6:138222865-138222887 CTCAGAATGGGGGAGGGAGGAGG - Intronic
1015935345 6:138402831-138402853 AAGAGAAATGGGAAGGAGGGTGG - Intergenic
1015973502 6:138766652-138766674 CTGTCAAAGTGGTAGGAAGGAGG - Intronic
1016050374 6:139524351-139524373 GAGAGAGAGAGGAAGGAAGGAGG - Intergenic
1016533283 6:145082641-145082663 CTGAGAAGTGGGAAAGAAAGAGG - Intergenic
1016598511 6:145828614-145828636 CAGAGAACGGGGAAGGAAGAGGG + Intergenic
1016882752 6:148927184-148927206 GAGAGAAAGGGGAGGGAAAGGGG + Intronic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017097543 6:150817926-150817948 CTGTGAAAGAGGAGGGAGGGAGG - Intronic
1017616323 6:156250413-156250435 CTAGGGAAAGGGAAGGAAGGAGG - Intergenic
1017757620 6:157542838-157542860 CTGAGCGCTGGGAAGGAAGGAGG + Intronic
1017820500 6:158045659-158045681 CTTAGAAACAGGAGGGAAGGTGG - Intronic
1018162264 6:161056747-161056769 CTGAGGAAGGTGAAGGAAAAAGG - Intronic
1018379072 6:163241160-163241182 CTGAGAGAGGGGAAGAAAAAAGG + Intronic
1018915903 6:168132194-168132216 CTGAGAAGGAGGCAGGAAGAAGG - Intergenic
1018921709 6:168180051-168180073 CAGAGAAAGGCGGAGGAAAGTGG + Intergenic
1019182424 6:170198971-170198993 CTGAGAATGGGGATGGAGGCAGG + Intergenic
1019258152 7:64726-64748 CTGAGCAAGAAGAAGGGAGGGGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019326618 7:441549-441571 CTGCCGAGGGGGAAGGAAGGAGG + Intergenic
1019334970 7:478666-478688 AGGAGGAAGGGGAGGGAAGGAGG + Intergenic
1019398440 7:836236-836258 CAGAGAGAGAGGAGGGAAGGAGG + Intronic
1019549163 7:1593703-1593725 CTGGCCAAGGGGAAGGAAGGAGG + Intergenic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1020240406 7:6390042-6390064 AAAAGAAAGGAGAAGGAAGGAGG - Intronic
1020660490 7:10974956-10974978 CTGGGAAAGGGGAAGAGAGAAGG - Intronic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1021712673 7:23431617-23431639 CTGAACAGGAGGAAGGAAGGGGG + Intronic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1021869193 7:24986839-24986861 TGGAGAAAGGGAAAGGAAGAAGG - Intergenic
1022523238 7:31021066-31021088 CTGACCAAGGGTAAGGAATGGGG - Intergenic
1022591585 7:31668988-31669010 TTGAGGAAGGAGAAGGAAGTAGG + Intergenic
1023438173 7:40159709-40159731 CTGAGAGATAGGAAGGCAGGAGG + Intronic
1023494700 7:40782724-40782746 CTGAAAAGGGGTAAGGAATGAGG - Intronic
1023598438 7:41856695-41856717 ATGAGAAAGGTGGAAGAAGGAGG + Intergenic
1023759413 7:43450073-43450095 CACAGAAATGGGAAAGAAGGAGG - Intronic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024071732 7:45791998-45792020 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1024072563 7:45798749-45798771 ATGAGAGAGGGGAGGGAAGGGGG + Intergenic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1024553342 7:50581973-50581995 CTGAGAGAGGGGAAGGGTAGTGG - Intergenic
1024650769 7:51401433-51401455 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1025054890 7:55757013-55757035 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1025132963 7:56387239-56387261 ATGAGAGTGGGGAGGGAAGGGGG - Intergenic
1025184599 7:56847662-56847684 ATGAGAATGGGGTGGGAAGGGGG - Intergenic
1025687330 7:63729306-63729328 ATGAGAATGGGGTGGGAAGGGGG + Intergenic
1025909515 7:65817104-65817126 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1025911028 7:65828827-65828849 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1026582725 7:71631666-71631688 AGGAGATAAGGGAAGGAAGGAGG + Intronic
1026617789 7:71921835-71921857 CTGGGAAGGGGGTAGGATGGCGG - Intronic
1026830189 7:73605879-73605901 CTGAGAAAGGGCAGGGGAGAGGG - Intronic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1027005987 7:74693503-74693525 CTGAGGAAAGGGAATGATGGGGG - Intronic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1027386355 7:77663000-77663022 AGGAGAGAGAGGAAGGAAGGAGG + Intergenic
1027794835 7:82679444-82679466 GAGAGAGAGAGGAAGGAAGGAGG - Intergenic
1028137260 7:87234987-87235009 CTGAGATAGGGGAGGAAAGGAGG - Intergenic
1028398846 7:90403304-90403326 CAGAGAAAGGGAAGGGCAGGAGG + Intronic
1028399037 7:90404668-90404690 CGGTGAAAGGATAAGGAAGGTGG - Intronic
1028451799 7:90993514-90993536 AAGAAGAAGGGGAAGGAAGGAGG + Intronic
1028584609 7:92440301-92440323 AAGGGAAAGGGGAAGGAAGGAGG + Intergenic
1029204890 7:98863668-98863690 CAGGGAAGGAGGAAGGAAGGAGG - Intronic
1029580845 7:101435869-101435891 CTGGCAGAGGGGAATGAAGGAGG - Intronic
1029635168 7:101778708-101778730 AAAAGAAAGAGGAAGGAAGGTGG - Intergenic
1029745111 7:102512294-102512316 GAGAGAAAGGAGAAGAAAGGAGG + Intronic
1029763103 7:102611455-102611477 GAGAGAAAGGAGAAGAAAGGAGG + Intronic
1030099459 7:105932780-105932802 TTCAGAAAGGGGAAGGAACGTGG + Intronic
1030523129 7:110622588-110622610 CTAAGAGAGAAGAAGGAAGGAGG + Intergenic
1030551370 7:110964771-110964793 AATAGAAAGAGGAAGGAAGGAGG - Intronic
1030786412 7:113668802-113668824 ACTAGAAAGGGGAGGGAAGGAGG + Intergenic
1030811900 7:113982832-113982854 AGGAGAAAGGTGGAGGAAGGTGG + Intronic
1030898831 7:115096558-115096580 CTGAGAATGTGGAAAGAAGCTGG - Intergenic
1030992740 7:116319855-116319877 AAGAGAGAGAGGAAGGAAGGAGG + Intronic
1031003328 7:116443164-116443186 CTGAGAGAGGTGAAGGAGGGAGG + Intronic
1031216672 7:118901390-118901412 CAGAAAATGGGGAATGAAGGTGG - Intergenic
1032048349 7:128629604-128629626 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1032049950 7:128642427-128642449 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1032517623 7:132518833-132518855 CTGGGGGAGGGAAAGGAAGGAGG - Intronic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1032891908 7:136205805-136205827 CTGAGAAAGAGGTGGGAAGTAGG + Intergenic
1032957634 7:136989932-136989954 CTGGGAGAGGTGAAGGGAGGTGG - Intronic
1033023725 7:137753190-137753212 ATGAGAAAGGAAAAGCAAGGTGG + Intronic
1033137642 7:138798217-138798239 CTGGGAAGGGGGAGGGAAGGAGG + Intronic
1033419331 7:141192450-141192472 TTGAGAGATGGGAAGGAATGGGG + Intronic
1033477758 7:141707028-141707050 CTGGGAATGGGGAAGGAATTAGG + Intergenic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1034179698 7:149127167-149127189 GAGAGAGAGGGCAAGGAAGGGGG + Intronic
1034283049 7:149866726-149866748 CTGACAAAGGGGAACGGAGCAGG - Exonic
1034653411 7:152710497-152710519 AGGAGAAAAGGGAAGGAAAGAGG + Intergenic
1035161404 7:156952840-156952862 CTGAGAAGCAGGAAGGAAAGGGG + Intronic
1035246711 7:157567059-157567081 CTGAGAGAGGGAAAGAAGGGAGG + Intronic
1035413524 7:158665662-158665684 CTGACAAGGGGGAGGGAAGGTGG - Intronic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035920406 8:3669882-3669904 TTAAGAAAGAAGAAGGAAGGAGG - Intronic
1036421691 8:8602087-8602109 CTGACAAAGGGGAAGGAAACAGG - Intergenic
1036451584 8:8872380-8872402 CTGTAAAAGGGGACGGCAGGAGG + Intronic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1036634250 8:10538235-10538257 CTGAAGATGGGGAAGGAAGGGGG - Intronic
1036635490 8:10547512-10547534 GTCAGAAAGAGGAAGGCAGGAGG - Intronic
1036640439 8:10580104-10580126 CAGGGAAAGGGGGAGGCAGGTGG + Intergenic
1036672489 8:10801186-10801208 CTGCAGAAAGGGAAGGAAGGGGG + Intronic
1036713866 8:11101978-11102000 CTGAGAAAGAGGAATGACAGCGG + Intronic
1036906354 8:12711243-12711265 CTGAGAGAGGCAAGGGAAGGGGG - Intergenic
1037090792 8:14915533-14915555 CTGACAAAGAGGAGGGAAGATGG - Intronic
1037523562 8:19703060-19703082 CTGAGGCAGGGGAAGAAGGGAGG + Intronic
1037548274 8:19944959-19944981 AAGGGGAAGGGGAAGGAAGGAGG - Intronic
1037616116 8:20520300-20520322 CAGAGAGAGGGGAAGGAGAGTGG - Intergenic
1037752550 8:21692347-21692369 AAGAGAAAGGGGAAAGGAGGAGG + Exonic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038041122 8:23725280-23725302 CTGAGAATAGGGAAGGAGGTGGG - Intergenic
1038370066 8:26980115-26980137 CTGACAAAGAGAAGGGAAGGTGG - Intergenic
1038440407 8:27567442-27567464 CTGCGGAAGGGGAAGGACTGAGG + Intergenic
1038679334 8:29652432-29652454 AGAAGAAAGAGGAAGGAAGGAGG + Intergenic
1038820893 8:30951100-30951122 AAAAGAAAGAGGAAGGAAGGAGG - Intergenic
1038982477 8:32775095-32775117 ATGCGAGAGGGGATGGAAGGAGG - Intergenic
1039027673 8:33275521-33275543 GTGAGAGAAGGGAAGGGAGGTGG - Intergenic
1039054739 8:33526610-33526632 TTGACATAGGGGAAGGGAGGAGG + Intergenic
1039161590 8:34627595-34627617 CTGAGAAACAGCAAGGAAGGTGG - Intergenic
1039260519 8:35766323-35766345 GAGAGAAAGAGGGAGGAAGGAGG - Intronic
1039381038 8:37085882-37085904 CTGGGAGAGGGCAAAGAAGGGGG - Intergenic
1039381053 8:37085936-37085958 CTGGGAGAGGGCAAAGAAGGGGG - Intergenic
1039737541 8:40348639-40348661 ATGAGAAAGAGGGAGGAAGGTGG - Intergenic
1039846675 8:41330378-41330400 GGGAGAAAGGGAAAGGAAGAGGG + Intergenic
1039954526 8:42196852-42196874 ATGAGAAGAAGGAAGGAAGGGGG + Intronic
1040106292 8:43544186-43544208 CTGAGAGAGGAGAGGAAAGGAGG - Intergenic
1040306519 8:46214770-46214792 TTGAGGAAGGGGGAGGAAAGAGG + Intergenic
1040439535 8:47426735-47426757 GTGAGAGAGGGAGAGGAAGGTGG + Intronic
1040528023 8:48241331-48241353 ATCAAAAAGGGGAAGGAATGGGG + Intergenic
1040554227 8:48464960-48464982 CTCAGAAATGGGATGGCAGGGGG + Intergenic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1041115355 8:54530481-54530503 CTGAGAAAGAGCAAGAGAGGAGG - Intergenic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041608228 8:59810990-59811012 CTGAGACAGGGAAAAGGAGGAGG + Intergenic
1042339720 8:67666410-67666432 CTGAGAGAGGGGTGGGGAGGGGG + Intronic
1042515220 8:69652157-69652179 CTTATAAAGGGAAAGGGAGGTGG - Intronic
1042552355 8:70005220-70005242 AAGAGAGAGAGGAAGGAAGGAGG + Intergenic
1042749837 8:72146723-72146745 CTGGGAAAGGGGAAGGGATAGGG + Intergenic
1043585477 8:81763821-81763843 CTGAGAAGCAGGAAGGAGGGTGG + Intergenic
1043775440 8:84261560-84261582 CTGAGACTGGGTAAGGAAAGAGG - Intronic
1044398073 8:91737105-91737127 CTGATAAAGGAGAAAGAAGTGGG + Intergenic
1044706174 8:95010866-95010888 AAGACAAAGGGGAAGGAAGCAGG + Intronic
1044769366 8:95613888-95613910 CAGGGAAAAGGGCAGGAAGGGGG - Intergenic
1044919467 8:97153520-97153542 TTCAAAAAAGGGAAGGAAGGAGG - Intergenic
1045031203 8:98138124-98138146 CTGAAAAGGAGGAAGGATGGAGG - Intronic
1045112174 8:98946629-98946651 CAGAGAAAAGGGAAAGAAGATGG + Intronic
1045135938 8:99218451-99218473 CTAAGAGAGGGTAAGGGAGGTGG + Intronic
1045393845 8:101740841-101740863 CTGGGAAGGGGGATGGATGGGGG - Intronic
1045399718 8:101801074-101801096 GAAAGAAAGAGGAAGGAAGGAGG + Intronic
1045447583 8:102283325-102283347 CTTAGGAAGGGGAAGGCGGGGGG + Intronic
1045866692 8:106874254-106874276 ATTAAAAAGAGGAAGGAAGGGGG + Intergenic
1046133304 8:109994880-109994902 CTGAGAACATGGAACGAAGGTGG - Intergenic
1046263065 8:111796295-111796317 CTGACAAAGAGAAAGGAAGACGG - Intergenic
1046383818 8:113483803-113483825 CAGAGAGTGGGGAAGGAAGTGGG - Intergenic
1046398352 8:113671253-113671275 CTTTGAAAGATGAAGGAAGGAGG - Intergenic
1046506505 8:115144708-115144730 CTGAAAGAGGGAAAGGAAGAGGG - Intergenic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1046918917 8:119706852-119706874 AAGAGAGAGAGGAAGGAAGGAGG - Intergenic
1047015698 8:120720849-120720871 CTGTGGAAGGGTAAGGTAGGTGG - Intronic
1047059522 8:121209052-121209074 GGGAGGGAGGGGAAGGAAGGAGG - Intergenic
1047309815 8:123682703-123682725 CTGGGACACGGGCAGGAAGGTGG + Intronic
1047549055 8:125850053-125850075 GGAAGGAAGGGGAAGGAAGGAGG - Intergenic
1047701392 8:127452696-127452718 AGGAGAAAGGGGAAGGGAGAGGG + Intergenic
1047780814 8:128109478-128109500 CTCAGAAAGGAGAAAGAAAGAGG - Intergenic
1048054002 8:130846643-130846665 GGAAGGAAGGGGAAGGAAGGAGG - Intronic
1048314112 8:133349572-133349594 GTGAGGGAAGGGAAGGAAGGGGG + Intergenic
1049004647 8:139847108-139847130 CTGACAACAGGGAAGGAAGAAGG + Intronic
1049214829 8:141402735-141402757 ATGAGAAAGCGGAAGCAGGGGGG - Intronic
1049270559 8:141693439-141693461 CTGAGGGATGGGCAGGAAGGAGG + Intergenic
1049296245 8:141841237-141841259 AAGAGAAAGGGGAAGCAAGGCGG - Intergenic
1049920708 9:361180-361202 CTGTGACAGAGGAAGGCAGGGGG + Intronic
1049958339 9:713485-713507 CTGGGAATGAGGAAGGATGGGGG + Intronic
1050068449 9:1785819-1785841 CTGAGAAGGGGGAAGACAGTGGG - Intergenic
1050796779 9:9556286-9556308 CTGAGTAAGTTGAAGAAAGGAGG + Intronic
1050848773 9:10258017-10258039 GGGAGAAGGGGGCAGGAAGGTGG + Intronic
1051188043 9:14481355-14481377 GTGAGACAGGGAAGGGAAGGAGG - Intergenic
1051328274 9:15997083-15997105 AAGATAAAGGGGAAGAAAGGAGG + Intronic
1051333354 9:16045255-16045277 ATGAGACAGGGAAGGGAAGGAGG + Intronic
1051660568 9:19422558-19422580 CTGACAAAGGGCAACGAAGGGGG + Intronic
1051675541 9:19554706-19554728 GCAAGAAAGAGGAAGGAAGGAGG - Intronic
1051823163 9:21191883-21191905 CTGAGACAGGCCATGGAAGGTGG - Intergenic
1051824988 9:21210420-21210442 CTGAGACAGGCAATGGAAGGTGG - Intronic
1051826980 9:21232483-21232505 CTGAGACAGGCCATGGAAGGTGG - Intronic
1052104004 9:24488779-24488801 CTGGGAAAGGGGAAAAAAGATGG + Intergenic
1052262240 9:26530589-26530611 CTGAGACAGGGGAATGAATAAGG + Intergenic
1052467176 9:28843606-28843628 CAGAGAAAGGGGAGGGATGGAGG + Intergenic
1052987922 9:34501731-34501753 CTGAGGAGGAGGCAGGAAGGGGG - Intronic
1053051478 9:34964539-34964561 ATAAGGAAGGGGAAGGAAGCTGG - Intronic
1053307211 9:36993545-36993567 CAGAGAAAGGGACAGGAAGAAGG + Intronic
1053440077 9:38108838-38108860 CTGAGGAAGGGGAAAAATGGTGG + Intergenic
1054744902 9:68844349-68844371 CTGGGAAGGGGGAACCAAGGGGG + Intronic
1055228576 9:74031707-74031729 GTGAGAATGGGAAGGGAAGGAGG + Intergenic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1055477598 9:76678380-76678402 AGGAGAAAGGGAAAGGAGGGAGG + Intronic
1055588477 9:77783610-77783632 CTGAGCAGTGGGAAGGTAGGTGG - Intronic
1055644705 9:78352052-78352074 CTTAGAAACAGGAAGTAAGGTGG - Intergenic
1055727912 9:79251230-79251252 CTGAGAAGGAGAAAGGATGGTGG - Intergenic
1055730272 9:79273804-79273826 GAGAGAAAGAGGAAGGAAGGAGG + Intergenic
1055760458 9:79601679-79601701 CTGAGGAGAGGGAAAGAAGGGGG - Intronic
1055782527 9:79834737-79834759 GTGAGAGAGGGGAGGGAGGGAGG + Intergenic
1055791340 9:79926227-79926249 AGGAGAAAGGGGAAGGGAGAAGG + Intergenic
1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG + Intergenic
1056521110 9:87402463-87402485 GAGAGAGAGAGGAAGGAAGGAGG + Intergenic
1056635575 9:88328649-88328671 GAGAGAGAGAGGAAGGAAGGGGG + Intergenic
1056965187 9:91159459-91159481 AAGAGAAAGAGGAGGGAAGGAGG + Intergenic
1057012413 9:91616890-91616912 CTCAGAAAGGGGAAGGAAGTTGG + Intronic
1057172823 9:92974014-92974036 CTGAGAGACGGGAATGAATGAGG - Intronic
1057195160 9:93112441-93112463 CTGAGAAAGGGGATGTGAGGAGG + Intronic
1057904636 9:98974494-98974516 CTGACAAAGGGCAAGGAGGAGGG + Intronic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058561440 9:106233161-106233183 AGGAGAAAGGAGAAGGAAGAAGG - Intergenic
1058880076 9:109278212-109278234 CTGAGAAATGAGAAGGAACCCGG + Intronic
1058940953 9:109812224-109812246 CTGAGAAGGGAGAAGGGAGGAGG + Intronic
1059003163 9:110372326-110372348 CTAGGAAAGGGGAAGGGATGTGG - Intronic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059208964 9:112493423-112493445 CTGGGAAAATGGATGGAAGGTGG - Intronic
1059327810 9:113514897-113514919 CAGAGAAAGGGGAGGCGAGGTGG - Intronic
1059835757 9:118150240-118150262 CTGAGCAATGGGAGGGAAAGTGG + Intergenic
1060215147 9:121734442-121734464 CTGAGCAGGGGCTAGGAAGGAGG + Intronic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060592709 9:124828995-124829017 GAAAGAAAGAGGAAGGAAGGAGG - Intergenic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060835353 9:126751563-126751585 CTGTGAAAGGAGAAAGGAGGAGG - Intergenic
1061138820 9:128752146-128752168 CTGAGGATCAGGAAGGAAGGAGG - Intronic
1061232187 9:129321389-129321411 CAGGGAAAGGCGAAGGAATGTGG - Intergenic
1061264893 9:129499172-129499194 CTGAGTAAGAGGTAGGCAGGTGG - Intergenic
1061510026 9:131054764-131054786 AAGAGAGAGGGGAAGGGAGGGGG + Intronic
1062050524 9:134444448-134444470 GGGAGGCAGGGGAAGGAAGGAGG - Intergenic
1062050604 9:134444634-134444656 AAGAGAAGAGGGAAGGAAGGAGG - Intergenic
1062050628 9:134444718-134444740 AGGAGAAGGGGGAAGGAAGGAGG - Intergenic
1062580009 9:137225287-137225309 CTGAGAGATGGGAGAGAAGGGGG - Intronic
1062751957 9:138261861-138261883 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1062753559 9:138274642-138274664 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1203525750 Un_GL000213v1:85630-85652 CTCTGCAACGGGAAGGAAGGTGG + Intergenic
1203576071 Un_KI270745v1:9421-9443 ATGAGAGTGGGGAGGGAAGGGGG + Intergenic
1185592516 X:1286935-1286957 CGGGGAGAGGGGAGGGAAGGAGG + Intronic
1185593065 X:1291424-1291446 AAGAAAAAGAGGAAGGAAGGAGG - Intronic
1185713819 X:2325470-2325492 CTGACAAAGAGGAGGGAAGATGG - Intronic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1185926437 X:4152314-4152336 CTCAGAAGGGGGAGGGTAGGGGG - Intergenic
1187025678 X:15433623-15433645 AGGAGAAAGGAGAAAGAAGGAGG + Intronic
1187025738 X:15433899-15433921 AGGAGGAAGGGGAAAGAAGGAGG + Intronic
1187135676 X:16545113-16545135 TTCAGAAAGGGGAACAAAGGAGG - Intergenic
1187361951 X:18636860-18636882 CTGGGAAAGGGGATGGAAGGTGG - Intronic
1187399743 X:18948995-18949017 CCGAAAAGAGGGAAGGAAGGAGG + Intronic
1187452674 X:19412588-19412610 AAGAGAAAGAGGAAGGGAGGGGG + Intronic
1187791797 X:22958338-22958360 CTGAAATAGGGAAAGGGAGGGGG + Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188510613 X:30932151-30932173 CAGAGAAAGGGGAAGGGCTGGGG + Intronic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1188987082 X:36777585-36777607 CTGAGGAAGGGCATGGTAGGAGG - Intergenic
1189116569 X:38349198-38349220 ATGAGACAGGGAAGGGAAGGTGG + Intronic
1189128972 X:38478967-38478989 CTGAGAAAGGTGAAGGGACTGGG + Intronic
1189282045 X:39825818-39825840 AAGGGAGAGGGGAAGGAAGGAGG - Intergenic
1189473682 X:41333391-41333413 CGGAGTAAGGGGAAAGGAGGAGG - Exonic
1189612350 X:42750933-42750955 CTGAGAAAGGGGAAGCATTGAGG - Intergenic
1189860523 X:45266496-45266518 CTGAGCAAGGGGCAGGAGTGGGG - Intergenic
1190298023 X:49039963-49039985 CTGAGAGAGGGGAGGGGAGGGGG - Intronic
1190411238 X:50139265-50139287 CTTAGAAAGGAGATGGAATGAGG - Intergenic
1190469991 X:50769212-50769234 GGAAGAAAGGGGAAGGAGGGAGG + Intronic
1190480571 X:50872721-50872743 CTGAGAAAGGGGAATGACCAAGG - Intergenic
1190598458 X:52067898-52067920 CTGTGAATGGGGGAGGGAGGAGG - Intronic
1190610366 X:52186175-52186197 CTGTGAATGGGGGAGGGAGGAGG + Intronic
1190735768 X:53255256-53255278 ATGAGAAAGGAGAAGGAGAGAGG + Intronic
1190781297 X:53598472-53598494 CTGAGGAGGAGGAAGGAAGTGGG - Intronic
1190953135 X:55165512-55165534 GAGGGAAAGAGGAAGGAAGGAGG - Intronic
1192135786 X:68599105-68599127 CTGAGCCAGGGGAAGGAACAGGG - Intergenic
1192243043 X:69349851-69349873 AGGAGAAGGGGGAAGGAGGGAGG - Intergenic
1192594191 X:72388826-72388848 GTGAGAATGTGGCAGGAAGGTGG + Intronic
1192797457 X:74435880-74435902 TTGAGAAAGGGGAAGGGACTTGG - Intronic
1193521162 X:82530519-82530541 CAGAGACAGGGGAAAGACGGAGG - Intergenic
1193679631 X:84502297-84502319 GTGAGAAGGGCGAAGGAGGGAGG - Intronic
1194088517 X:89558251-89558273 CTCAGAAGGGGGAGGGTAGGAGG + Intergenic
1194268077 X:91779294-91779316 GGGAGAAAGGGGAAGGAAGGGGG - Intronic
1194378000 X:93159922-93159944 ACCTGAAAGGGGAAGGAAGGAGG + Intergenic
1194414878 X:93598835-93598857 TTAAGAAAGGGGAAGAAAAGGGG + Intergenic
1194482147 X:94439722-94439744 CTGACAAAGAGAAAGGAAGATGG + Intergenic
1195026494 X:100882821-100882843 ATGGCAAAGGGGAATGAAGGTGG + Intergenic
1195059407 X:101179168-101179190 CTGGGAAAAGGGAAGGAATGAGG - Intergenic
1195355287 X:104033700-104033722 CTGAGGAAGGGGCAGGAAGGAGG + Intergenic
1195468074 X:105203025-105203047 CTGTGAAACTGGAAGCAAGGGGG - Intronic
1195957565 X:110348839-110348861 CTAAGAAAGGGGAAGTAAAATGG + Intronic
1195965506 X:110426729-110426751 CTTAGAAAGGAAAAGGAAGACGG - Intronic
1196549462 X:117005389-117005411 ATGAAAGAGGGGAAGGTAGGGGG + Intergenic
1196619359 X:117804923-117804945 GGGAGGGAGGGGAAGGAAGGAGG + Intergenic
1196674988 X:118410264-118410286 AGGAGAAAGGAGAAGAAAGGTGG + Intronic
1196681705 X:118476117-118476139 TTGAGAAAGAGCAAGGAAGCTGG + Intergenic
1197800014 X:130339060-130339082 GAGAGAAAGAGAAAGGAAGGAGG - Intergenic
1197988501 X:132292697-132292719 CTGAAAATGGGGTAGGGAGGGGG - Intergenic
1198053145 X:132968366-132968388 CTGAGAAAAGGACAGGAAGAGGG - Intergenic
1198225670 X:134642911-134642933 CAGAGAAAGGGAGAGGAAGAAGG + Intronic
1198686406 X:139232235-139232257 GTGAGGAAGGCGAAAGAAGGAGG + Intergenic
1198750553 X:139933006-139933028 CAGAGAAAGTGGAAGTAAGAAGG - Intronic
1199036122 X:143052996-143053018 TTTGGAAAGGGGAAGGAAGAGGG - Intergenic
1199288360 X:146078536-146078558 TAGAGAAAGGAGAAAGAAGGTGG + Intergenic
1199651346 X:149947923-149947945 CTGGGAAGGGAGAAGGAAGGAGG - Intergenic
1199803941 X:151279351-151279373 CAGAGAAAGGCAAAGGAATGGGG - Intergenic
1199950987 X:152706152-152706174 GAGAGAAGGGGGAAGGGAGGAGG + Intergenic
1199953286 X:152722766-152722788 GAGAGAAGGGGGAAGGGAGGGGG + Intergenic
1199956396 X:152745684-152745706 GAGAGAAGGGGGAAGGGAGGGGG - Intergenic
1199958695 X:152762309-152762331 GAGAGAAGGGGGAAGGGAGGAGG - Intergenic
1200149394 X:153943865-153943887 CTGGGAGATGGGCAGGAAGGGGG + Intronic
1200152008 X:153955774-153955796 CAGGGCAAGGGGAAGGCAGGAGG + Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200441193 Y:3214298-3214320 CTCAGAAGGGGGAGGGTAGGAGG + Intergenic
1200585280 Y:5000215-5000237 GGGAGAAAGGGGAAGGAAGGGGG - Intronic
1201300168 Y:12498411-12498433 GAGAGAAAGAGGAAGGAGGGAGG - Intergenic
1201672691 Y:16541973-16541995 CTCAGAAAGGGGAGGCTAGGAGG - Intergenic