ID: 1165638722

View in Genome Browser
Species Human (GRCh38)
Location 19:37365635-37365657
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 13, 1: 29, 2: 30, 3: 30, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900781190 1:4618050-4618072 TCCTTATCTTGAGTGGGTGCTGG + Intergenic
901064868 1:6489864-6489886 TCCTCAAGTTGAGGGAGCTCGGG - Intronic
901148457 1:7084432-7084454 TCCTTCTGGGGAGGGAGTGGGGG + Intronic
901929495 1:12587926-12587948 TCCTGTTGTTGAGTGAGTGAGGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903402302 1:23063838-23063860 TCCTTATGGGGTGGGAGTGGGGG + Intronic
909089644 1:71209230-71209252 CCCTGAAGGTGAGGGAGTGCAGG - Intergenic
909742376 1:79045833-79045855 TCCTTATGATACGGGAGTGCTGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916125911 1:161571092-161571114 TCCTAAAGTTGGGGTAGTGCAGG - Intergenic
916135827 1:161652941-161652963 TCCTAAAGTTGGGGTAGTGCAGG - Intronic
916489028 1:165285230-165285252 TCCTTAGGTGGAGAGAGTTCTGG + Intronic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
918767748 1:188510824-188510846 TCATCATGTTGTGGAAGTGCAGG - Intergenic
919167123 1:193909663-193909685 TTCTTTTGGTCAGGGAGTGCTGG - Intergenic
919437559 1:197580860-197580882 TCCTTATGTTGAGACAGTACAGG - Intronic
922331953 1:224585295-224585317 TACGTATGTTGAGTGATTGCGGG - Intronic
922806591 1:228393462-228393484 TCCTTATGTGGAGCTATTGCCGG - Intergenic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1069449098 10:68501841-68501863 TACTTTTGTAGAGGGAGTGAGGG - Intronic
1070482831 10:76902049-76902071 TCCTTATGTGATGGGAGTGAGGG + Intronic
1073390776 10:103174572-103174594 TTCTTTTTTTGAGGGAGTGCTGG - Intronic
1076825915 10:132967930-132967952 TCCTTATGATACGGAAGTGCTGG - Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1080236150 11:30070671-30070693 TCCTTACTTTGAGAGAGGGCTGG - Intergenic
1080756264 11:35202444-35202466 TTCTTATGTTTGGGGAGTGAGGG - Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1090476428 11:127025791-127025813 TCCTAATGTTGAGGGTATGGAGG + Intergenic
1091397234 12:161528-161550 TCCTTATGATGCTGGAGTGGTGG + Intronic
1091705678 12:2691505-2691527 TCCTTTTGGTGAGGGCGCGCGGG - Intronic
1095554111 12:43480788-43480810 TCCACATGCTGAGGGAGTGTGGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096124099 12:49107129-49107151 GCCTTATCTTGAGGAAGTGATGG - Intronic
1097101289 12:56591373-56591395 TCCTAGGGGTGAGGGAGTGCGGG + Exonic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1099192769 12:79577373-79577395 TTCTTATGTTGAGGCAGTTGAGG - Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1103568948 12:121831277-121831299 TTCTTAGGTTGAGGGGCTGCCGG - Exonic
1104751131 12:131239887-131239909 GCTTTCTGTTGAGGGAGGGCTGG - Intergenic
1106622654 13:31385782-31385804 TCCTTATGATATGGAAGTGCTGG - Intergenic
1107140679 13:36995538-36995560 TCTTCATGTCGATGGAGTGCTGG + Exonic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1111613498 13:90635968-90635990 TCCTTCTGTTGAAGGAGTCTAGG + Intergenic
1112017765 13:95345487-95345509 CCCTTATGTTAAGTGATTGCTGG + Intergenic
1115623974 14:35171291-35171313 TCCTTATGTTGCAGGCTTGCTGG + Intronic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116581392 14:46646685-46646707 TCCATATTTTGAGAGATTGCAGG + Intergenic
1117015460 14:51513023-51513045 TCCTAATTTTGAGAGAGTGAGGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129145281 15:73641488-73641510 TCCTTGTGTGGAGGGAGAACTGG - Intergenic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130409978 15:83639289-83639311 TCATTATGTTGAGGCTGTGAGGG + Intergenic
1136049542 16:27640551-27640573 TTCTAATGTTGAGTGGGTGCTGG - Intronic
1137597654 16:49735496-49735518 TCGTTATGATGAGGGAGTCAAGG - Intronic
1140218678 16:73028125-73028147 TCCTTTTTTTGGGGGAGTGTGGG + Intronic
1141764939 16:86052020-86052042 TGCTTGTGTTGAGGGTGTGCAGG + Intergenic
1144244934 17:13353413-13353435 TTCTTCTGTAGAGGCAGTGCTGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146618488 17:34376236-34376258 TCCTTAGGTTGGGGGAGTCAGGG - Intergenic
1149180689 17:53932520-53932542 TCCTGGTGTTGAGGGAGGGGTGG + Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152033038 17:77855428-77855450 TCCTTATGATAAGGGAGAGGCGG - Intergenic
1152928477 17:83098644-83098666 TCCTCATGTGGAGGGAGTCGAGG - Intergenic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163385996 19:17000983-17001005 TCCTGATGCAGAGGGAATGCTGG + Intronic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164778017 19:30869491-30869513 CCCTTTTGTTGCAGGAGTGCAGG - Intergenic
1165167502 19:33867079-33867101 TCCTGCTGTGGAGGGAGGGCAGG + Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1165790493 19:38488813-38488835 TCATTATGTTGACTGAGAGCTGG + Intronic
1166246812 19:41534199-41534221 TCCCTACATTGAAGGAGTGCTGG + Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
925893414 2:8454078-8454100 TGCTTCTGATGAGTGAGTGCCGG - Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
934032518 2:88061113-88061135 TCTTTAGGGTGAGGGAATGCTGG + Intergenic
935855173 2:107265924-107265946 ACCTTTTGTTGAAGGAGGGCAGG + Intergenic
937771213 2:125722488-125722510 TCCTTATGGGGAAGAAGTGCAGG + Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
941557454 2:166999135-166999157 TGCTTAGGTTGAGGGATTGAAGG + Intronic
941842493 2:170101432-170101454 TACTTTTATTTAGGGAGTGCTGG - Intergenic
943831638 2:192471671-192471693 TCCTTCAGGTGAGTGAGTGCTGG - Intergenic
945031008 2:205663590-205663612 TCCTTATGGTGAGGGAAGGATGG + Intergenic
945436150 2:209820251-209820273 TCTTTAGGAAGAGGGAGTGCAGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1168788639 20:561071-561093 TCCACATAATGAGGGAGTGCTGG - Intergenic
1172162769 20:32879944-32879966 TCCTCATGCTTAGGGAGTCCAGG - Intronic
1173503632 20:43570703-43570725 AAATGATGTTGAGGGAGTGCAGG - Exonic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179172146 21:38981077-38981099 GCCTTATCTTAAGGGAGGGCTGG - Intergenic
1180791213 22:18576717-18576739 TCCTGCTGTTGGGGGAGTGGGGG + Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181230525 22:21418597-21418619 TCCTGCTGTTGGGGGAGTGGGGG - Intronic
1181248125 22:21516272-21516294 TCCTGCTGTTGGGGGAGTGGGGG + Intergenic
1185135980 22:49072891-49072913 TCCTTATGGTGAAGCAGGGCAGG + Intergenic
952107110 3:30083634-30083656 TCCTTCTGGTGAGGCAGTGCTGG - Intergenic
952631655 3:35477193-35477215 TCCTTATAGTGAGTGAGTCCTGG + Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
963460700 3:145611290-145611312 TCCTGATGTTGAGGGCTTTCTGG + Intergenic
964690554 3:159444879-159444901 ACCTGATGTTGAGGGAGTGAAGG + Intronic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
969833980 4:9823910-9823932 TGCTTATGTTGGGGGAGTGAAGG + Intronic
969999413 4:11349618-11349640 ACCTTATGTTTGGGGAGTGGAGG + Intergenic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
972705945 4:41542644-41542666 TACTTATCTTAAGGGAGTGTTGG - Intronic
974989277 4:69064290-69064312 TCCCTATGTTGAAGGAGTTTTGG - Intronic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
976073885 4:81274308-81274330 TGCTTATATTCAGGGAGTACAGG - Intergenic
976926080 4:90497891-90497913 TTCTTCTCATGAGGGAGTGCAGG + Intronic
977919031 4:102623904-102623926 TTCATTTGTTGAGGGAATGCTGG - Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
980822972 4:138040145-138040167 TCCATCTGATGATGGAGTGCTGG + Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
987781733 5:22445857-22445879 TGCTTATGTAGAGGAACTGCAGG - Intronic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
991938967 5:71831764-71831786 TCTTTATGTTGAAGGAGATCAGG + Intergenic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
998587604 5:143443726-143443748 TCCTTATGTTGAGCTAGGGGAGG + Intergenic
999007671 5:148000756-148000778 TTCTACTGTTGAGAGAGTGCTGG - Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003634217 6:7817285-7817307 TGCTTATGTGGAGGTGGTGCAGG + Intronic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006296907 6:33173804-33173826 TCAGGATGTTGAGGGAGAGCTGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007177991 6:39909509-39909531 GCCTTCTGTTTAGGGAGGGCAGG - Intronic
1007903867 6:45439262-45439284 TCATAATGTTGAGTCAGTGCTGG + Intronic
1009854328 6:69241667-69241689 TTCTTATTTTGAGGAAGGGCTGG + Intronic
1011504960 6:88031282-88031304 TCCTTATTTTGAGAGAGTGCTGG - Intergenic
1015806968 6:137119458-137119480 TCCCAAGGTTGAGGGAGTGCTGG - Intergenic
1016739137 6:147509372-147509394 TCCTTACCTTGCGGGAGTACGGG - Exonic
1017091954 6:150767129-150767151 TCTTTATTTTGAGGGAGTGTAGG + Intronic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1021106129 7:16641781-16641803 TCCTTTTTTTGAGGGGGGGCTGG - Intronic
1022363019 7:29681357-29681379 TTCTTATATTGAAGGAGTGTGGG - Intergenic
1022428295 7:30289242-30289264 TTCTTATATTGAAGGAGTGTGGG + Intronic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1022698374 7:32732430-32732452 TTCTTATATTGAAGGAGTGTGGG + Intergenic
1023287723 7:38636715-38636737 TCCTTGTGTTCAAGGAGGGCGGG - Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1030978425 7:116156085-116156107 TCCTGATGCTGAAGGAGTCCTGG + Intronic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1035860396 8:3021972-3021994 TCCTGATGCTGTGGGATTGCAGG - Intronic
1039193729 8:35006468-35006490 TCTTTTTGTTGAGACAGTGCTGG + Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041400856 8:57443210-57443232 TCCCTATGTTGCCAGAGTGCTGG + Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043096196 8:75976930-75976952 TTCTTATGTTGAAGAAGTGAAGG - Intergenic
1045158545 8:99508874-99508896 GCCTTATGTTAAGGGAGTTAAGG + Intronic
1046611143 8:116426827-116426849 TCCTTGTTCTGATGGAGTGCAGG - Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1053549434 9:39060391-39060413 TCCTTATGGTGAGAGGGAGCGGG + Intergenic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1053813549 9:41880465-41880487 TCCTTATGGTGAGAGGGAGCGGG + Intergenic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054617047 9:67306974-67306996 TCCTTATGGTGAGAGGGAGCGGG - Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055093364 9:72385466-72385488 TTAGTATGTTGAGGGAGTTCAGG - Intergenic
1055438871 9:76319640-76319662 TCCTTTTCTTGAGGGAGTCAGGG + Intronic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057083857 9:92191094-92191116 TCCTTTTGTTGCTGGAGTGGTGG - Intergenic
1057248295 9:93478089-93478111 TCCTTATTTTTAGGAAGTGATGG - Intronic
1057414048 9:94845728-94845750 GCCATTTGTTGAGGGAGGGCTGG + Intronic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1194926169 X:99827409-99827431 TCCTTAAGTTGTTGGAGTACAGG + Intergenic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1199440077 X:147857822-147857844 TCCCAATGTTGAGGGAGACCCGG - Intergenic
1200082762 X:153587172-153587194 TGCTTATGTGGAGGGAGAGATGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic